FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6164fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-6164fjev1
20/13/2405    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palazuelos, J.
Right arrow Articles by Galve-Roperh, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palazuelos, J.
Right arrow Articles by Galve-Roperh, I.
(The FASEB Journal. 2006;20:2405-2407.)
© 2006 FASEB

Non-psychoactive CB2 cannabinoid agonists stimulate neural progenitor proliferation

Javier Palazuelos*, Tania Aguado*, Ainara Egia*, Raphael Mechoulam{dagger}, Manuel Guzmán*,1,2 and Ismael Galve-Roperh*,1,2

* Department of Biochemistry and Molecular Biology I, School of Biology, Complutense University, Madrid, Spain;

{dagger} Department of Medicinal Chemistry and Natural Products, School of Pharmacy, The Hebrew University, Jerusalem, Israel

2Correspondence: Department of Biochemistry and Molecular Biology I, School of Biology, Complutense University, 28040 Madrid, Spain. E-mail: igr{at}quim.ucm.esmgp{at}bbm1.ucm.es

ABSTRACT

Cannabinoids, the active components of marijuana and their endogenous counterparts, act on the brain and many other organs through the widely expressed CB1 cannabinoid receptor. In contrast, the CB2 cannabinoid receptor is abundant in the immune system and shows a restricted expression pattern in brain cells. CB2-selective agonists are, therefore, very attractive therapeutic agents as they do not cause CB1-mediated psychoactive effects. CB2 receptor expression in brain has been partially examined in differentiated cells, while its presence and function in neural progenitor cells remain unknown. Here we show that the CB2 receptor is expressed, both in vitro and in vivo, in neural progenitors from late embryonic stages to adult brain. Selective pharmacological activation of the CB2 receptor in vitro promotes neural progenitor cell proliferation and neurosphere generation, an action that is impaired in CB2-deficient cells. Accordingly, in vivo experiments evidence that hippocampal progenitor proliferation is increased by administration of the CB2-selective agonist HU-308. Moreover, impaired progenitor proliferation was observed in CB2-deficient mice both in normal conditions and on kainate-induced excitotoxicity. These findings provide a novel physiological role for the CB2 cannabinoid receptor and open a novel therapeutic avenue for manipulating neural progenitor cell fate.—Palazuelos, J., Aguado, T., Egia, A., Mechoulam, R., Guzmán, M., Galve-Roperh, I. Non-psychoactive CB2 cannabinoid agonists stimulate neural progenitor proliferation.


Key Words: signaling systems • hippocampus • neurogenesis

THE HEMP PLANT Cannabis sativa produces ~70 unique compounds known as cannabinoids, of which {Delta} 9-tetrahydrocannabinol (THC) is the most important owing to its high potency and abundance in cannabis. THC exerts a wide variety of biological effects by mimicking endogenous substances—the endocannabinoids anandamide (1) and 2-arachidonoylglycerol (2) —that bind to and activate specific cannabinoid receptors. So far, two cannabinoid-specific G protein-coupled receptors have been cloned and characterized from mammalian tissues: CB1 and CB2 (3 , 4) . It is well established that the central and most of the peripheral effects of cannabinoids rely on CB1 receptor activation (4) . This receptor is highly abundant in the central nervous system (CNS) and is expressed by the major types of brain cells [neurons (5) , astrocytes (6) , oligodendrocytes (7) , and microglia (8) ]. In particular, CB1 receptors present in central neurons that control processes such as motor activity, memory and cognition, pain, emotion, sensorial perception, and endocrine functions are targets for the neuromodulatory action of endocannabinoids, as well as for the psychoactive effects of marijuana-derived cannabinoids (4) . Functionally active CB1 receptors are also expressed in peripheral nerve terminals, and various extraneural sites such as testis, eye, vascular endothelium, and spleen (3 , 4) .

The CB2 receptor displays a more limited pattern of expression than the CB1 receptor, which is found almost exclusively in cells (e.g., B- and T-lymphocytes, macrophages) and tissues (e.g., spleen, tonsils, lymph nodes) of the immune system (9) . Within the brain, the CB2 receptor is expressed only in perivascular microglial cells (10) , vascular endothelial cells (11) , and certain neuron subpopulations (12 13 14) . This restricted expression pattern in the brain, however, makes the CB2 receptor an interesting therapeutic target since the unwanted psychotropic effects of cannabinoids, which severely limit their medical use, are mediated largely or entirely by neuronal CB1 receptors (4) . While CB2 receptor expression in brain has been examined to date only in differentiated cells, the presence and function of this receptor in neural progenitor cells remain unknown. Here we show that CB2 receptors are expressed in neural progenitors and that its selective activation stimulates cell proliferation. This finding provides a new conceptual view in the understanding of how the endocannabinoid system signals in brain and how neural progenitor proliferation is controlled, and it points to the potential pharmacological modulation of neural progenitor cell fate by psychoactivity-devoid CB2-selective ligands.

MATERIALS AND METHODS

Materials
The following materials were kindly donated: CB2 receptor knockout mice by Nancy Buckley (National Institute of Health, Bethesda, MD, USA), HU-308 by Pharmos (Rehovot, Israel), JWH-133 by John W. Huffman (Clemson University, Clemson, NC, USA), SR144528 by Sanofi-Aventis (Montpellier, France), and anti-mouse phosphorylated-S55 vimentin monoclonal 4A4 antibody (Ab) by Verónica Cerdeño (University of California San Francisco, CA, USA). Anti-CB2 receptor polyclonal antibody (pAb) was from Affinity Bioreagents (Golden, CO, USA). Mouse monoclonal antinestin Ab was from Chemicon (Temecula, CA, USA), and mouse monoclonal anti-NeuN, anti-GFAP, anti-{alpha}-tubulin antibodies were from Sigma (St. Louis, MO, USA). Rat monoclonal anti-bromodeoxyuridine Ab was from Abcam (Cambridge, UK) and monoclonal anti-RC2 Ab was from the Developmental Studies Hybridoma Bank (Iowa City, IA, USA). Sheep polyclonal antiphosphoY180-extracellular signal-regulated kinase (ERK)1/2 was from Upstate Biotechnology (Lake Placid, NY, USA) and rabbit polyclonal anti-Akt, phosphoS473-Akt and anti-ERK1/2 were from Cell Signaling Technology (Beverly, MA, USA). PD98059 and LY294,002 were from Alexis Biochemicals (San Diego, CA, USA).

Neurosphere and neural progenitor cell culture
Multipotent self-renewing progenitors were obtained from the dissected cortices of embryonic mice at the indicated developmental stages, subventricular zone in adult brain, and grown in chemically defined medium constituted by Dulbecco’s modified Eagle’s and F12 media supplemented with N2 (Invitrogen, Carlsbad, CA, USA), 0.6% glucose (Glc), nonessential amino acids, 50 mM HEPES, 2 µg/ml heparin, 20 ng/ml epidermal growth factor (EGF), and 20 ng/ml basic fibroblast growth factor (bFGF) (15) . Clonal neurospheres were cultured at 1000 cells/ml, dissociated, and experiments were performed with early (up to 10) passage neurospheres. Neurosphere generation experiments were performed in 96-well dishes with 100 µl of medium, and the number of neurospheres was quantified. Embryonic neural progenitors from wild-type (WT) and CB2-deficient mice were cultured (10,000 cells/ml) in the continuous presence of cannabinoids for the indicated number of passages (1 passage every 4 d). Adult neural progenitors were obtained from hippocampi of 4-month-old adult mice and cultured as described above. Neural progenitor cell differentiation was performed as described (15) . Stock solutions of cellular effectors were prepared in dimethyl sulfoxide. No significant influence of dimethyl sulfoxide on any of the parameters determined was observed at the final concentration used (0.1% v/v). Control incubations included the corresponding vehicle content.

Cell proliferation assays
Neural progenitor proliferation was determined by quantifying bromodeoxyuridine (BrdU)-positive cells 16 h after incubation with 10 µg/ml BrdU, followed by immunostaining (16) .

Western blot
Cleared cell extracts were subjected to SDS-PAGE, transferred to PVDF membranes, and following Ab incubations developed with enhanced chemiluminiscence detection kit (16) . Loading controls were performed with an anti-{alpha}-tubulin Ab.

RT-polymerase chain reaction (RT-PCR)
RNA was obtained with the RNeasy Protect kit (Qiagen, Valencia, CA) using the RNase-free DNase kit. cDNA was subsequently obtained using the Superscript First-Strand cDNA synthesis kit (Roche, Welwyn Garden City, UK), and amplification of cDNA was performed with the following primers: mouse CB2, sense GGATGCCGGGAGACAGAAGTGA and antisense CCCATGAGCGGCAGGTAAGAAAT (506 bp product); human CB2, sense, CAACCCAAAGCCTTCTAGACAAG and antisense GTGGATAGCGCAGGCAGAGGT (464 bp product). Mouse and human CB2 polymerase chain reaction (PCR) reactions were performed using the following conditions: 1 min at 95°C and 35 cycles (30s at 95°C, 30s at 58°C, and 1 min at 72°C). Finally, after a final extension step at 72°C for 5 min, PCR products were separated on 1.5% agarose gels.

Animals and drug treatment
Adult CB2 receptor knockout mice (8 weeks old) and their respective WT littermates were injected i.p. with 50 mg/kg BrdU daily for 3 d and perfused 1 d later. HU-308 (15 mg/kg) was administered i.p. for 5 d either alone or in combination with 1 mg/kg SR144528 (injected 30 min before HU-308). Control animals received the corresponding vehicle injection (100 µl PBS supplemented with 0.5 mg defatted BSA and 4% dimethyl sulfoxide). BrdU was administered daily during the pharmacological administration period. In the case of experiments on kainate-induced excitotoxicity, animals were injected with 15 mg/kg kainate or vehicle. E17.5 mouse embryos from mothers injected twice with 100 mg/kg BrdU (30-min interval between injections) were obtained 1 h after the first injection. Animal procedures were performed according to the European Union guidelines (86/609/EU) for the use of laboratory animals.

Immunostaining and confocal microscopy
Mice were perfused and immunostaining was performed in 30 µm brain coronal free-floating sections (15 , 17) . Sections were incubated with polyclonal anti-CB2 Ab together with anti-nestin, anti-Neu, or anti-GFAP antibodies followed by secondary staining for rabbit and mouse IgGs with highly cross-adsorbed AlexaFluor 594 and AlexaFluor 488 secondary antibodies (Molecular Probes, Eugene, OR, USA), respectively. Neural progenitor proliferation was determined with anti-bromodeoxyuridine Ab and secondary antirat IgG-AlexaFluor 594 in sections counterstained with TOTO-3 iodide. Preparations were examined using Leica TCS-SP2 software Leica (Wetzlar, Germany) and SP2 microscope with 2 passes with a Kalman filter and a 1024 x 1024 collection box. BrdU+ cells were counted in the subgranular zone and granule cell layer of the dentate gyrus. A 1-in-6 series of adult hippocampal mouse sections located between 1.3 and 2.1 mm posterior to bregma were used. The number of cells was normalized to the area of the dentate gyrus of each 30-µm section followed by the determination of the total positive cell number per animal. Frozen mouse embryo sections were incubated with anti-bromodeoxyuridine Ab together with Yoyo-1 iodide, and positive cells were determined in 7 sections per animal. The specificity of CB2 receptor immunoreactivity was corroborated using CB2–/– mouse sections, in which no immunoreactivity was observed, and allowed to adjust optimal confocal microscope settings.

Statistical analysis
Results shown represent the means ± SD of the number of experiments indicated in every case. Statistical analysis was performed by ANOVA. A post hoc analysis was made by the Student-Neuman-Keuls test. In vivo data were analyzed by an unpaired Student’s t test.

RESULTS

Neural progenitors express CB2 receptors in vitro and in vivo
To determine whether neural progenitor cells express CB2 receptors, we generated clonally expanded neurospheres derived from embryonic and adult brain. Reverse transcription-polymerase chain reaction (Fig. 1 A) and Western blot (Fig. 1B ) analyses revealed that neural progenitors express CB2 receptors and that their presence remains evident as well in adult-derived cells. These findings were extrapolated to human neural progenitors (Fig. 1C ), as CB2 is also present in the hNSC1 cell line (18) . We next labeled neural progenitors with antibodies directed against the CB2 receptor and nestin, a widely used marker of multipotent neuroepithelial cells. As inferred from the colocalization images, we confirmed that neural progenitor cells, including those actively dividing (as identified by BrdU incorporation), express CB2 receptors (Fig. 1D , upper panels). Importantly, radial progenitor cells, the postulated continuum lineage from embryonic toward adult neural progenitors (19) , were also positive for CB2 receptors. Thus, cells expressing the radial glial marker RC2, as well as dividing radial cells identified by an Ab against phosphorylated vimentin, were double-labeled with the anti-CB2 Ab (Fig. 1D , middle panels). In line with these observations, CB2 receptor expression persisted in adult neural progenitor cells (Fig. 1D , lower panels). As CB2 receptor expression is known to be restricted in neural cells, we next sought to investigate its potential regulation regarding neural differentiation. Thus, neural progenitors were differentiated and CB2 expression was analyzed in parallel with ß-tubulin-III and GFAP, markers of neuronal and astroglial cells, respectively. CB2 receptor expression was abrogated in differentiated cells with the concomitant appearance of the neuronal and astroglial markers (Fig. 1E ).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Neural progenitors express CB2 receptors in vitro. A) Expression of the CB2 receptor and nestin in embryonic (E), postnatal (P), and adult neural progenitors as determined by RT-PCR. Differentiated cortical neurons as well as spleen were used as negative and positive controls, respectively. B) Expression of the CB2 receptor as above determined by Western blot. C) Expression of the CB2 receptor in the human hNSC.1 stem cell line and the human U373MG astrocytoma cell line (control) as determined by RT-PCR (upper panel) and Western blot (lower panel). D) Adherent embryonic (upper panels) and adult (lower panels) neural progenitor cultures were immunostained with antinestin (green), BrdU (red), and CB2 receptor (blue) antibodies. Postnatal radial glial progenitors (middle panels) were labeled against RC2 or phosphorylated-vimentin (green) and the CB2 receptor (red). Colocalization is shown in the merged images. Scale bars 20 µm. E) Analysis of CB2 receptor expression in undifferentiated neural progenitors (NP) and their differentiated neural cell progeny (Diff NC) evaluated by the presence of nestin, ß-tubulin III and GFAP transcripts.

Next, we determined by confocal microscopy whether CB2 receptors are expressed in vivo in progenitor cells resident in the subgranular zone of the dentate gyrus of the hippocampus, one of the most prominent neurogenic areas throughout life span, including adulthood (19 , 20) . As shown in Fig. 2 , CB2 receptor expression was found only in nestin-positive cells, while we could not find its presence in differentiated hippocampal neurons (NeuN-positive cells) and astrocytes (GFAP-positive cells). Altogether, these results show that CB2 cannabinoid receptors are expressed in neural progenitor cells both during development and in adulthood and become down-regulated with neural cell differentiation.


Figure 2
View larger version (181K):
[in this window]
[in a new window]
 
Figure 2. Neural progenitors express CB2 receptors in vivo. Expression of the CB2 receptor (red) in neural progenitors (nestin-positive cells; green) but not in mature neurons (NeuN-positive cells; green) and astrocytes (GFAP-positive cells; green) as assessed by confocal microscopy in adult hippocampal sections. Inset shows a high magnification image of a representative double nestin-CB2 positive cell. Sections from CB2–/– deficient were employed as specificity controls. Cells were counterstained with TOTO-3 iodide (blue). Scale bars: 40 and 10 µm.

CB2 receptors control neural progenitor cell proliferation in vitro
To determine whether CB2 receptors control neural progenitor cell function, we first generated neurospheres from CB2-deficient mice (21) and their WT littermates. Genetic ablation of the CB2 receptor impaired primary neurosphere generation (Fig. 3 A, inset). Moreover, neural progenitor self-renewal, as determined by neurosphere generation for several consecutive passages, was reduced in CB2-deficient cells (Fig. 3A ). The observed impairment of neural progenitor function in CB2–/– cell cultures prompted us to analyze the prominin (cluster of differentiation-133)-positive subpopulation, as these cells are considered to constitute the stem cell fraction responsible for neurosphere formation activity (22) . Of interest, CB2–/– neurospheres, when compared to WT cultures by flow cytometry analysis, showed a reduction in their cluster of differentiation (CD)-133+ subpopulation (cluster of differentiation-133+ cells: 5.8±2.0% vs. 7.4±1.5%, respectively).


Figure 3
View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. CB2 receptors control neurosphere generation and neural progenitor cell proliferation in vitro. A) Self-renewal of E17.5 neural progenitors derived from WT and CB2–/– mice. The number of neurospheres was quantified after 5 consecutive neurosphere passages. Inset: Primary neurosphere generation in the two mouse strains. B) Primary neurosphere generation was determined after 7 d of exposure of neural progenitors (black bars) to vehicle (C), the CB2-selective agonists HU-308 or JWH-133 (30 nM) and/or the CB2-selective antagonist SR144528 (2 µM; SR). CB2–/– progenitors (gray bars) were also used. C) Self-renewal of WT neural progenitors (solid line) incubated as above for five consecutive passages. Self-renewal of CB2-deficient progenitors in the presence of vehicle is also shown (dashed line). D) Quantification of BrdU-positive cells from dissociated neurospheres incubated as above for 16 h. E) Quantification of BrdU-positive cells (upper panel) and neurosphere generation (lower panel) of progenitors treated with vehicle (C) HU-308 (30 nM) and/or PD98059 (10 µM; PD) and/or LY294,002 (5 µM; LY). F) ERK and Akt phosphorylation after progenitor challenge with vehicle (C) or HU-308 (alone or in the presence of SR144528) for 15 min (ERK) or 2 min (Akt). Results correspond to 3 (A, C, E, and F) or 4 (B and D) independent experiments. Significantly different from control WT cells: *P < 0.05, **P < 0.01.

The functional relevance of the CB2 receptor was investigated further by incubating neurospheres with selective receptor ligands. Thus, the CB2-selective agonists HU-308 (23) and JWH-133 (24) increased both primary neurosphere generation (Fig. 3B ) and neural progenitor self-renewal (Fig. 3C ), and both actions were prevented by the CB2-selective antagonist SR144528. The selectivity of CB2 agonists was confirmed by the observation that neither HU-308 nor JWH-133 could enhance neurosphere generation in CB2-deficient neural progenitors (Fig. 3B ). Moreover, HU-308 and JWH-133 increased the number of BrdU-incorporating cells in a CB2-dependent manner (Fig. 3D ), supporting the direct impact of CB2 receptor activation on neural progenitor cell proliferation. Likewise, increased neurosphere generation was observed on CB2 receptor activation in postnatal and adult progenitors (percentage of neurosphere number relative to vehicle incubations: HU-308: 130±8% and 161±20%, respectively; JWH-133: 154±22% and 149±6%, respectively), and this action was prevented by SR144528 (data not shown).

To determine the potential signaling mechanism responsible for CB2-mediated proliferation, neural progenitors were incubated in the presence of HU-308 and selective inhibitors of the ERK cascade (PD98059) and the phosphatidylinositol 3-kinase/Akt pathway (LY294,002). HU-308 induction of cell proliferation was prevented by both inhibitors (Fig. 3E , upper panel), a finding that was confirmed in neurosphere generation assays (Fig. 3E , lower panel). These results prompted us to analyze CB2-mediated regulation of ERK and Akt. Thus, HU-308 stimulated ERK and Akt, and this action was prevented by SR144528 (Fig. 3F ).

CB2 receptors control neural progenitor cell proliferation in vivo
The functional relevance of the CB2 receptor in controlling neural progenitor cell proliferation in vivo was determined by assessing BrdU incorporation in CB2-deficient mice and their WT littermates. In both embryonic (Fig. 4 A) and adult (Fig. 4C ) brain, CB2 knockout animals showed a significant decrease in BrdU-labeled cells in the dentate gyrus of the hippocampus. These results suggest that neural progenitor proliferation in vivo may be suitable for CB2 pharmacological manipulation. Thus, HU-308 and/or SR144528 were administered for 5 consecutive days and hippocampal proliferation was determined. Importantly, CB2 activation increased progenitor proliferation, while CB2 blockade exerted the opposite action (Fig. 4B ). The selectivity of HU-308 in vivo was confirmed by SR144528 antagonism and by the lack of HU-308 agonistic effect in CB2-deficient mice. We further tested whether CB2 receptors may be implicated in the control of neural progenitor cell proliferation in a situation of brain injury such as kainate-induced excitotoxicity. As shown in Fig. 4C , the remarkable excitotoxic stimulation of neural progenitor cell proliferation was abrogated in CB2-deficient mice.


Figure 4
View larger version (54K):
[in this window]
[in a new window]
 
Figure 4. CB2 receptors control neural progenitor cell proliferation in vivo. A) Number of BrdU-positive cells per section in the dentate gyrus of WT (n=5) and CB2–/– (n=7) mouse E17.5 embryos. B) Number of BrdU-positive cells per section in the dentate gyrus of WT (black bars; n=4) and CB2–/– (gray bars; n=3) adult mice injected with the indicated agents. C) Number of BrdU-positive cells per section in the dentate gyrus of WT (black bars; n=4) and CB2–/– (gray bars; n=4) adult mice injected with saline (plain bars) or kainic acid (dashed bars). Lower panels show representative immunostainings of BrdU-positive cells (red) costained with TOTO-3 (blue). Scale bars: 90 µ m (A) and 45 µm (B, C). Significantly different from control WT mice: *P < 0.05, **P < 0.01. Significantly different from WT mice treated with kainic acid: #P < 0.05.

DISCUSSION

To date, the effects of endocannabinoids on the modulation of synaptic plasticity and neuronal excitability (4) , as well as of neural cell survival (25 , 26) , have been attributed solely to the engagement of "central" CB1 receptors. The expression pattern of the CB1 receptor is regulated during brain development (27) , and the receptor remains expressed at high levels in differentiated neurons and at lower levels in glial cells of various adult brain areas, such as the hippocampus, basal ganglia, and cortex (3 , 4) . In contrast, the presence of the "peripheral" CB2 receptor in differentiated neurons and glial cells is more restricted (4) . Thus, only recently the expression of CB2 receptors in normal brain could be demonstrated in the cerebellum (13 , 14) as well as in a subpopulation of neurons of the vagus nerve in the brainstem (12) , where it participates in the regulation of emesis. In addition, CB2 receptor expression in the brain is also found in microglia (9 , 10) and endothelial cells (11) . Here, we provide evidence that neural progenitors from embryonic to adult stages express functional CB2 receptors. Of interest, other studies had previously suggested an inverse relation between CB2 receptor expression and stage of cell differentiation. For example, CB2 receptor expression decreases during B-cell differentiation (28) and increases with dedifferentiation (i.e., with increased malignancy) of glial tumors (29) . Likewise, CB2 receptor activation and overexpression (30) block neutrophil cell differentiation. Thus, it is tempting to speculate that endocannabinoids may control neural progenitor cell function via CB2 receptors acting as a "cell dedifferentiation signal" by favoring a nondifferentiated, proliferative state.

During mammalian development, the generation of the CNS relies on a finely regulated balance of neural progenitor proliferation, differentiation and survival that is controlled by a number of extracellular signaling cues (19 , 20) . The existence of hippocampal neurogenesis in the adult brain has received strong support by the identification of a neural progenitor cell population located in the subgranular zone (19 , 20 , 22) . These neural progenitors give rise to newly generated cells that can integrate properly in hippocampal circuits and thus may contribute to synaptic plasticity (31) , cognitive functions (20) , and neuroregeneration on brain damage (32) . Our finding of impaired neural progenitor proliferation after neuroexcitotoxic damage in CB2-deficient mice, together with the protective role of endocannabinoids in a variety of brain damage models (25) , suggest that endocannabinoids generated on demand on brain injury may enhance neural progenitor proliferation via CB2 receptors. The relevance of our results is further strengthened by the recent demonstration of the role of the endocannabinoid system in the regulation of adult neurogenesis. Hippocampal progenitors produce endocannabinoids in a regulated manner and express the CB1 receptor (16) . In vivo regulation of cannabinoid signaling during CNS development alters neuronal activity (33) and generation (15 , 34) . These findings add to the reported impairment of cognitive functions in CB1 knockout mice (35) and the potential of cannabinoid-mediated regulation of adult neurogenesis (17 , 36) .

The use of cannabinoids in medicine is severely limited by their well-known psychotropic effects. Although psychoactivity tends to disappear with tolerance on continuous cannabinoid use (4) , it is obvious that cannabinoid-based therapies devoid of side effects would be desirable. As the unwanted effects of cannabinoids are mediated largely or entirely by CB1 receptors within the brain (4) , the most conceivable possibility would be to use cannabinoids that selectively target CB2 receptors. In this context, the recent synthesis of CB2-selective agonists (23 , 24) opens an attractive clinical possibility. By showing that CB2 receptor activation is functional in stimulating neural progenitor cell proliferation in vitro and in vivo, the present report, together with the implication of CB2 receptors in the control of processes such as pain initiation (37 , 38) , emesis (12) , neuroinflammation (39 , 40) , and brain-tumor cell death (29) opens the attractive possibility of finding cannabinoid-based therapeutic strategies for neural disorders devoid of nondesired psychotropic effects. Specifically, the proliferative effect of cannabinoids reported here may set the basis for the potential pharmacological modulation of neural progenitor cell fate by CB2-selective ligands.

ACKNOWLEDGMENTS

We are indebted to our lab colleagues for fruitful scientific discussions and to A. Martínez-Serrano and B. Navarro for providing the human hNSC.1 cell line. I.G.R. is research associate supported by the Ramón y Cajal Program of MEC. Research in our laboratory was financially supported by Ministerio de Ciencia y Tecnología (SAF2003–00745), Santander Complutense (PR27/05–13988) Fundación de Investigeción Médice Mutua Modrileña Automovilistica, and Fundación Científica de la Asociación Española Contra el Cáncer.

FOOTNOTES

1 These authors contributed equally to this work.

Received for publication March 17, 2006. Accepted for publication June 26, 2006.

REFERENCES

  1. Devane, W. A., Hanus, L., Breuer, A., Pertwee, R. G., Stevenson, L. A., Griffin, G., Gibson, D., Mandelbaum, A., Etinger, A., Mechoulam, R. (1992) Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science 258,1946-1949[Abstract/Free Full Text]
  2. Mechoulam, R., Ben Shabat, S., Hanus, L., Ligumsky, M., Kaminski, N. E., Schatz, A. R., Gopher, A., Almog, S., Martin, B. R., Compton, D. R., et al (1995) Identification of an endogenous 2-monoglyceride, present in canine gut, that binds to cannabinoid receptors. Biochem. Pharmacol. 50,83-90[CrossRef][Medline]
  3. Howlett, A. C., Barth, F., Bonner, T. I., Cabral, G., Casellas, P., Devane, W. A., Felder, C. C., Herkenham, M., Mackie, K., Martin, B. R., et al (2002) International Union of Pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol. Rev. 54,161-202[Abstract/Free Full Text]
  4. Piomelli, D. (2003) The molecular logic of endocannabinoid signalling. Nat. Rev. Neurosci. 4,873-884[CrossRef][Medline]
  5. Herkenham, M., Lynn, A. B., Little, M. D., Johnson, M. R., Melvin, L. S., de Costa, B. R., Rice, K. C. (1990) Cannabinoid receptor localization in brain. Proc. Natl. Acad. Sci. U. S. A. 87,1932-1936[Abstract/Free Full Text]
  6. Bouaboula, M., Bourrie, B., Rinaldi-Carmona, M., Shire, D., Le Fur, G., Casellas, P. (1995) Stimulation of cannabinoid receptor CB1 induces krox-24 expression in human astrocytoma cells. J. Biol. Chem. 270,13973-13980[Abstract/Free Full Text]
  7. Molina-Holgado, E., Vela, J. M., Arevalo-Martin, A., Almazán, G., Molina-Holgado, F., Borrell, J., Guaza, C. (2002) Cannabinoids promote oligodendrocyte progenitor survival: involvement of cannabinoid receptors and phosphatidylinositol-3 kinase/Akt signaling. J. Neurosci. 22,9742-9753[Abstract/Free Full Text]
  8. Sinha, D., Bonner, T. I., Bhat, N. R., Matsuda, L. A. (1998) Expression of the CB1 cannabinoid receptor in macrophage-like cells from brain tissue: immunochemical characterization by fusion protein antibodies. J. Neuroimmunol. 82,13-21[CrossRef][Medline]
  9. Walter, L., Stella, N. (2004) Cannabinoids and neuroinflammation. Br. J. Pharmacol. 141,775-785[CrossRef][Medline]
  10. Nunez, E., Benito, C., Pazos, M. R., Barbachano, A., Fajardo, O., Gonzalez, S., Tolon, R. M., Romero, J. (2004) Cannabinoid CB2 receptors are expressed by perivascular microglial cells in the human brain: an immunohistochemical study. Synapse 53,208-213[CrossRef][Medline]
  11. Golech, S. A., McCarron, R. M., Chen, Y., Bembry, J., Lenz, F., Mechoulam, R., Shohami, E., Spatz, M. (2004) Human brain endothelium: coexpression and function of vanilloid and endocannabinoid receptors. Brain Res. Mol. Brain Res. 132,87-92[Medline]
  12. Van Sickle, M. D., Duncan, M., Kingsley, P. J., Mouihate, A., Urbani, P., Mackie, K., Stella, N., Makriyannis, A., Piomelli, D., Davison, J. S., et al (2005) Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science 310,329-332[Abstract/Free Full Text]
  13. Gong, J., Onaivi, E. S., Ishiguro, H., Liu, Q., Tagliaferro, P. A., Brusco, A., Uhl, G. R. (2006) Cannabinoid CB2 receptors: immunohistochemical localization in rat brain. Brain Res. 1071,10-23[CrossRef][Medline]
  14. Ashton, J. C., Friberg, D., Darlington, C. L., Smith, P. F. (2006) Expression of the cannabinoid CB2 receptor in the rat cerebellum: an immunohistochemical study. Neurosci. Lett. 396,113-116[CrossRef][Medline]
  15. Aguado, T., Palazuelos, J., Monory, K., Stella, N., Cravatt, B., Lutz, B., Marsicano, G., Kokaia, Z., Guzmán, M., Galve-Roperh, I. (2006) The endocannabinoid system promotes gliogenesis by acting on neural progenitor cells. J. Neurosci. 26,1551-1561[Abstract/Free Full Text]
  16. Aguado, T., Monory, K., Palazuelos, J., Stella, N., Cravatt, B., Lutz, B., Marsicano, G., Kokaia, Z., Guzmán, M., Galve-Roperh, I. (2005) The endocannabinoid system drives neural progenitor proliferation. FASEB J. 19,1704-1706[Abstract/Free Full Text]
  17. Rueda, D., Navarro, B., Martínez-Serrano, A., Guzmán, M., Galve-Roperh, I. (2002) The endocannabinoid anandamide inhibits neuronal progenitor cell differentiation through attenuation of the Rap 1/B-Raf/ERK pathway. J. Biol. Chem. 277,4645-4650
  18. Villa, A., Snyder, E. Y., Vescovi, A., Martinez-Serrano, A. (2000) Establishment and properties of a growth factor-dependent, perpetual neural stem cell line from the human CNS. Exp. Neurol. 161,67-84[CrossRef][Medline]
  19. Alvarez-Buylla, A., Lim, D. (2004) For the long run: maintaining germinal niches in the adult brain. Neuron 41,683-686[CrossRef][Medline]
  20. Lie, D. C., Song, H. S., Colamarino, A., Ming, G., Gage, F. H. (2004) Neurogenesis in the adult brain: new strategies for central nervous system diseases. Annu. Rev. Pharmacol. Toxicol. 44,399-421[CrossRef][Medline]
  21. Buckley, N. E., McCoy, K. L., Mezey, E., Bonner, T., Zimmer, A., Felder, C. C., Glass, M., Zimmer, A. (2000) Immunomodulation by cannabinoids is absent in mice deficient for the cannabinoid CB(2) receptor. Eur. J. Pharmacol. 396,141-149[CrossRef][Medline]
  22. Gotz, M., Huttner, W. B. (2005) The cell biology of neurogenesis. Nat. Rev. Mol. Cell. Biol. 6,777-788[CrossRef][Medline]
  23. Hanus, L., Breuer, A., Tchilibon, S., Shiloah, S., Goldenberg, D., Horowitz, M., Pertwee, R. G., Ross, R. A, Mechoulam, R., Fride, E. (1999) HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor. Proc. Natl. Acad. Sci. U. S. A. 96,14228-14233[Abstract/Free Full Text]
  24. Huffman, J. W., Liddle, J., Yu, S., Aung, M. M., Abood, M. E., Wiley, J. L., Martin, B. R. (1999) 3-(1',1'-Dimethylbutyl)-1-deoxy-delta8-THC and related compounds: synthesis of selective ligands for the CB2 receptor. Bioorg. Med. Chem. 7,2905-2914[CrossRef][Medline]
  25. Mechoulam, R., Spatz, M., Shohami, E. (2002) Endocannabinoids and neuroprotection. Sci. STKE 129,RE5
  26. Guzmán, M. (2003) Cannabinoids: potential anticancer agents. Nat. Rev. Cancer. 3,745-755[CrossRef][Medline]
  27. Fernández-Ruiz, J., Berrendero, F., Hernández, M. L., Ramos, J. A. (2001) The endogenous cannabinoid system and brain development. Trends Neurosci. 23,14-20[CrossRef]
  28. Carayon, P., Marchand, J., Dussossoy, D., Derocq, J. M., Jbilo, O., Bord, A., Bouaboula, M., Galiegue, S., Mondiere, P., Penarier, G., et al (1998) Modulation and functional involvement of CB2 peripheral cannabinoid receptors during B-cell differentiation. Blood 92,3605-3615[Abstract/Free Full Text]
  29. Sánchez, C., de Ceballos, M. L., del Pulgar, T. G., Rueda, D., Corbacho, C., Velasco, G., Galve-Roperh, I., Huffman, J. W., Ramon y Cajal, S., Guzmán, M. (2001) Inhibition of glioma growth in vivo by selective activation of the CB(2) cannabinoid receptor. Cancer Res. 61,5784-5789[Abstract/Free Full Text]
  30. Alberich Jorda, M., Rayman, N., Tas, M., Verbakel, S. E., Battista, N., van Lom, K., Lowenberg, B., Maccarrone, M., Delwel, R. (2004) The peripheral cannabinoid receptor Cb2, frequently expressed on AML blasts, either induces a neutrophilic differentiation block or confers abnormal migration properties in a ligand-dependent manner. Blood 104,526-534[Abstract/Free Full Text]
  31. Santarelli, L., Saxe, M., Gross, C., Surget, A., Battaglia, F., Dulawa, S., Weisstaub, N., Lee, J., Duman, R., Arancio, O., et al (2003) Requirement of hippocampal neurogenesis for the behavioral effects of antidepressants. Science 301,805-809[Abstract/Free Full Text]
  32. Nakatomi, H., Kuriu, T., Okabe, S., Yamamoto, S., Hatano, O., Kawahara, N., Tamura, A., Kirino, T., Nakafuku, M. (2002) Regeneration of hippocampal pyramidal neurons after ischemic brain injury by recruitment of endogenous neural progenitors. Cell 110,429-441[CrossRef][Medline]
  33. Bernard, C., Milh, M., Morozov, Y. M., Ben-Ari, Y., Freund, T. F., Gozlan, H. (2005) Altering cannabinoid signaling during development disrupts neuronal activity. Proc. Natl. Acad. Sci. U. S. A. 102,9388-9393[Abstract/Free Full Text]
  34. Berghuis, P., Dobsay, M. B., Wang, X., Spano, S., Ledda, F., Sousa, K. M., Schulte, G., Ernforns, P., Mackie, K., Paratcha, G., et al (2005) Endocannabinoids regulate interneuron migration and morphogenesis by transactivating the TrkB receptor. Proc. Natl. Acad. Sci. U. S. A. 102,19115-19120[Abstract/Free Full Text]
  35. Bilkei-Gorzo, A., Racz, I., Valverde, O., Otto, M., Michel, K., Sarstre, M., Zimmer, A. (2005) Early age-related cognitive impairment in mice lacking cannabinoid CB1 receptors. Proc. Natl. Acad. Sci. U. S. A. 102,15670-15675[Abstract/Free Full Text]
  36. Jiang, W., Zhang, Y., Xiao, L., Van Cleemput, J., Ji, S., Bai, G., Zhang, Z. (2005) Cannabinoids promote embryonic and adult hippocampus neurogenesis and produce anxiolytic- and antidepressant-like effects. J. Clin. Invest. 115,3104-3116[CrossRef][Medline]
  37. Calignano, A., La Rana, G., Giuffrida, A., Piomelli, D. (1998) Control of pain initiation by endogenous cannabinoids. Nature 394,277-281[CrossRef][Medline]
  38. Ibrahim, M. M., Porreca, F., Lai, J., Albrecht, P. J., Rice, F. L., Khodorova, A., Davar, G., Makriyannis, A., Vanderah, T. W., Mata, H. P., Malan, T. P., Jr (2005) CB2 cannabinoid receptor activation produces antinociception by stimulating peripheral release of endogenous opioids. Proc. Natl. Acad. Sci. U. S. A. 102,3093-3098[Abstract/Free Full Text]
  39. Ramírez, B. G., Blázquez, C., Gómez del Pulgar, T., Guzmán, M., de Ceballos, M. L. (2005) Prevention of Alzheimer’s disease pathology by cannabinoids: neuroprotection mediated by blockade of microglial activation. J. Neurosci. 25,1904-1913[Abstract/Free Full Text]
  40. Eljaschewitsch, E., Witting, A., Mawrin, C., Lee, T., Schmidt, P. M., Wolf, S., Hoertnagl, H., Raine, C. S., Schneider-Stock, R., Nitsch, R., Ullrich, O. (2006) The endocannabinoid anandamide protects neurons during CNS inflammation by induction of MKP-1 in microglial cells. Neuron 49,67-79[CrossRef][Medline]



This article has been cited by other articles:


Home page
BrainHome page
J. Palazuelos, T. Aguado, M. R. Pazos, B. Julien, C. Carrasco, E. Resel, O. Sagredo, C. Benito, J. Romero, I. Azcoitia, et al.
Microglial CB2 cannabinoid receptors are neuroprotective in Huntington's disease excitotoxicity
Brain, November 1, 2009; 132(11): 3152 - 3164.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Palazuelos, N. Davoust, B. Julien, E. Hatterer, T. Aguado, R. Mechoulam, C. Benito, J. Romero, A. Silva, M. Guzman, et al.
The CB2 Cannabinoid Receptor Controls Myeloid Progenitor Trafficking: INVOLVEMENT IN THE PATHOGENESIS OF AN ANIMAL MODEL OF MULTIPLE SCLEROSIS
J. Biol. Chem., May 9, 2008; 283(19): 13320 - 13329.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Aguado, E. Romero, K. Monory, J. Palazuelos, M. Sendtner, G. Marsicano, B. Lutz, M. Guzman, and I. Galve-Roperh
The CB1 Cannabinoid Receptor Mediates Excitotoxicity-induced Neural Progenitor Proliferation and Neurogenesis
J. Biol. Chem., August 17, 2007; 282(33): 23892 - 23898.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
I. Galve-Roperh, T. Aguado, J. Palazuelos, and M. Guzman
The Endocannabinoid System and Neurogenesis in Health and Disease
Neuroscientist, April 1, 2007; 13(2): 109 - 114.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-6164fjev1
20/13/2405    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palazuelos, J.
Right arrow Articles by Galve-Roperh, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palazuelos, J.
Right arrow Articles by Galve-Roperh, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS