| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,1,2
* Department of Physiology,
¶ Department of Pathology, Catholic University of Daegu School of Medicine, Daegu, Korea;
Division of Applied Life Science, GyeongSang National University, Jinju, Korea;
Department of Animal Science and Biotechnology, Jinju National University, Jinju, Korea;
Animal Resources Research Center, Konkuk University, Seoul, Korea; and
|| National Livestock Research Institute, RDA, Suwon, Korea
3Correspondence: Department of Physiology, Catholic University of Daegu School of Medicine, Daegu, Korea. E-mail: takim{at}cu.ac.kr
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: Moloney murine leukemia virus
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Second, as a highly efficient bioreactor producing valuable pharmaceutical proteins, transgenic chickens have been considered as a replacement for the mammary gland-based bioreactor. Since the pioneering success in transgenic animal production in the early 1980s (2
3
4)
, the mammary gland of mammals with its large milk production capacity has been considered a major candidate organ for a bioreactor. Although progress has been slower than predicted, some pharmaceutical proteins were successfully produced in the milk of several species of transgenic farm animals. For example, recombinant human antithrombin III protein purified from the milk of transgenic goats (GTC Biotherapeutics) and recombinant C1 inhibitor (Pharming Group NV) produced in the milk of transgenic rabbits have recently completed or entered phase III clinical trials, respectively (5)
. However, critical disadvantages of the mammary gland as a bioreactor include long generation times for domestic mammals and difficulties in purifying recombinant proteins due to the biochemical complexity of milk protein and fat. Use of hen eggs can circumvent these problems and has other advantages, including shorter generation times, lower expense, and fecundity (6)
. Most important, purification of recombinant proteins is predicted to be much easier because egg white protein is less biochemically complex. Moreover, the glycosylation patterns of some chicken proteins are reported to be more similar to those of humans than to other mammals (7)
. Despite their possible usefulness, however, production of transgenic avian species has been hampered by the unusual features of avian reproductive biology. The ovum is fertilized within 1 h of ovulation, then surrounded by several grams of albumin and eggshell. Early embryonic development is initiated in the reproductive organ of the female, resulting in an embryo that consists of 
60,000 morphologically undifferentiated pluripotent cells at the time the egg is laid (8)
. Targeting blastodermal cells at this stage, stage X (9)
, using retrovirus-mediated gene transfer, is the most common method for producing transgenic chickens
The important features of retroviruses for their use as vectors are technical ease and effectiveness of gene transfer (10
, 11)
. This is due to their infectivity for certain target cells resulting in gene transfer. With all the high potency of the retrovirus vector system in gene transfer, however, this method has not been widely used in transgenic mammal production. Over the last 20 years, direct foreign DNA microinjection into a pronucleus of an embryo has been the most widely applied method in the generation of transgenic mammals (12)
. It was not until recent progress of the retrovirus vector system that high efficiency of this gene delivery system was demonstrated in the production of transgenic pigs, cattle, and primates (13
14
15
16)
. In the case of laboratory animals such as mice, due to accumulated knowledge on mouse leukemia virus, significant numbers of transgenic mice by means of retrovirus-mediated gene transfer system have been reported, but the number of transgenic mice produced by retrovirus-mediated gene transfer is far fewer than that produced by pronuclear DNA microinjection. In transgenic chicken production, however, application of direct DNA microinjection method is almost impossible due to the high cell number of freshly laid eggs as mentioned above. Recently, the use of embryonic stem (ES) cells in transgenic chicken production has seemed as promising as in mammals, but germline transmission of the transgene remains to be demonstrated (17)
.
To facilitate basic research on the method of production of transgenic chickens, in the present study we attempted to generate stable germline transgenic chickens expressing the eGFP gene and to identify the chromosomal location of the transgene. Compared with other marker genes such as E. coli LacZ (18)
and ß-lactamase (19)
, eGFP has the advantage of affording simple visual confirmation of gene expression without compromising sample viability. For delivery of the eGFP transgene to blastodermal cells, we chose a Moloney murine leukemia virus (MoMLV) -based pseudotyped retroviral vector system in which the recombinant viruses are packaged with vesicular stomatitis virus G glycoprotein (VSV-G) (20)
.
Recently, several reports have demonstrated significant progress in germline transmission in transgenic chickens expressing foreign proteins (18
, 19
, 21
22
23
24
25)
. Remarkably, using vectors derived from MoMLV, no germline transgenic chicken expressing the eGFP gene has been reported. Although some reports have found disadvantages in using this MoMLV-derived vector in transgenic animal production (26
, 27
, 28)
, we chose the MoMLV-based retrovirus vector because this system is most widely used due to its simple and thoroughly characterized structure. Using the MoMLV-based retrovirus vector, we could identify the exact chromosomal insertion site of the transgene as well as generate transgenic chickens that stably maintained expression of the eGFP gene after germline transmission. The significance of this study stems from the fact that it is the first successful report on the MoMLV vector-mediated generation of a new line of transgenic chicken characterized by high expression of the eGFP gene whose chromosomal integration site was identified.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
with a fragment containing the Rous sarcoma virus (RSV) promoter, the eGFP gene, and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence. The RSV promoter and the eGFP gene were derived from pLXRN and pEGFP-N1, respectively, which were purchased from Clontech (Palo Alto, CA, USA). The WPRE sequence from woodchuck hepatitis virus 2 genomic DNA (GenBank accession number M11082) was introduced following the strategy of Zufferey et al. (30)
. A schematic representation of pLNRGW is shown in Fig. 1
.
|
Retrovirus-producing cells were constructed following the procedure described by Kim (11)
. Briefly, PG13 packaging cells (31)
were transiently transfected with pLNRGW, and LNRGW viruses were subsequently harvested and added to the culture of GP2–293 cells (purchased from Clontech). PG13 cells are retrovirus packaging cells characterized by expression of the Gibbon ape leukemia virus envelope gene whereas GP2–293 cells have been designed to express the gag and pol genes of the MoMLV. The GP2–293 cells infected with LNRGW were selected with G418 (800 µg/ml) for 2 wk and the resultant G418R (or Neomycin-resistant) cells were transfected with pVSV-G (purchased from Clontech) to express VSV-G-protein. Viruses were harvested 48 h post-transfection. All cells, including virus-producing cells, were grown at 37°C in a 5% CO2 atmosphere in Dulbecco’s modified Eagle medium (DMEM) containing 4.5 g/L of glucose (Glc) (Gibco BRL, 12800) and supplemented with fetal calf serum (10%), penicillin (100 µg/ml), and streptomycin (100 µg/ml). The virus-containing medium harvested from the virus-producing cells was centrifugally concentrated to 1/1000 of the original volume and filtered through a 0.45 µm pore-sized filter. The virus titer of the concentrated stock was >1 x 109 NeoR cfu/ml (neomycin-resistant colony-forming unit/ml) on both NIH 3T3 cells and primary cultures of chicken fetal fibroblast cells (data not shown).
Microinjection of retrovirus vector
Fertilized eggs (stage X embryo according to the classification of Eyal-Giladi and Kochav) (9)
were obtained from ISA brown laying hens that were artificially inseminated once a week with semen from ISA brown males. Only eggs weighing 60 ± 3 g and of normal shape were used in the experiments. These eggs were positioned with their sides facing upwards for 8 h at room temperature in order to fix the blastoderm position. After swabbing the shell with 70% alcohol, a 4.5 x 4.5 mm2 sized window was made in the equatorial plane of the eggshell using a fine drill, followed by removal of the small shell membrane inside the window with fine forceps and a surgical blade. DMEM containing concentrated virus (5 µl) was injected into the central part of the subgerminal cavity using a microinjection pipette. To increase infectivity, polybrene (10 µg/ml) was added to the virus-containing medium. The injection pipette was drawn from a Pyrex glass tube with an inner diameter at the tip of 80 µm. After injection, the window was sealed with Parafilm.
Egg incubation
After microinjection, the sealed eggs were incubated at 37.5°C and 60% relative humidity with a rocking motion every 2 h through a 90° angle for 18 days, after which they were further incubated at 37°C and 70% relative humidity without rocking until hatching.
PCR analysis
Genomic DNA was extracted from chicken tissue using a genomic DNA purification kit (Promega, Madison, WI, USA). For PCR analysis, a primer set was designed for the eGFP gene based on the nucleotide sequence of pEGFP-N1 (GenBank accession number U55762). The upstream (5'-AGCAAGGGCGAGGAGCTGTT-3') and downstream (5'-TACTTGTACAGCTCGTCCATGCC-3') primer pair for the detection of the eGFP gene corresponds to the pEGFP-N1 nucleotide sequences at 685–704 and 1375–1397, respectively, to predict an amplified DNA fragment of 713 base pair fragment. Each reaction mixture contained 1 µg of genomic DNA extract, 50 pmol of each primer, 5 µl 10 x PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP, 2.5 U of Taq polymerase (Promega), and the reaction volume was 50 µl. Initial denaturation was performed at 94°C for 5 min followed by 35 cycles of PCR amplification. The amplification profile consisted of: 94°C for 30 s (denaturation), 54°C for 30 s (annealing), and 72°C for 30 s (extension). After 35 amplification cycles, the samples were retained at 72°C for 7 min to ensure complete strand extension.
Western blot analysis
Tissues of heart, skeletal muscle, intestine, gizzard, liver, kidney, oviduct, and testis were snap-frozen, ground, and a total protein extract was prepared by sonication. Blood cells separated from plasma proteins by centrifugation (9000 g, 10 min) were sonicated to extract protein. The concentration of protein was determined by the Bradford assay. For Western blot analyses, each sample (0.5 or 2.5 µg) was loaded onto a 12% SDS-polyacrylamide gel, electrophoresed, and transferred to a nitrocellulose membrane using a Semi-Dry Elctrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA). After a blocking step in 5% skim milk in TBS with 0.03% Tween-20 (MTBST) for 1 h, the membrane was incubated for 16 h in MTBST containing a mouse monoclonal anti-eGFP (Clontech) (1/5000 dilution). The membrane was washed three times with TBST alone and incubated in MTBST containing HRP-conjugated goat anti-mouse IgG (Pierce, Rockford, IL, USA) (1/1000 dilution) for 1 h. The membrane was washed three more times with TBST, and West Dura Extended Duration substrate (Pierce) was added to detect chemiluminescence. Quantitative analysis of band density was performed using the PowerLook scanner (Umax, Taiwan) equipped with ImageQuant TL program (Amersham Biosciences, Arlington Heights, IL, USA). Several different amounts of purified recombinant eGFP (purchased from Clontech) were electrophoresed and blotted with sample proteins to use as references in obtaining a standard curve (correlation coefficient=0.98). The experiments were performed three times. The data were analyzed by 1-way ANOVA and Duncan’s multiple range test (
=0.05) using General Linear Model (GLM) procedure in Statistical Analysis System (SAS Institute Inc., Cary, NC, USA).
DNA sequencing of genomic regions flanking the provirus
The genomic region 5' to the LNRGW provirus was amplified using DNA walking (DW) PCR technology (see Fig. 6
). The main feature of this approach is application of annealing control primer (ACP) system (32
, 33)
. The ACP consists of three parts: 1) a nontargeting universal nucleotide sequence at 5' end, 2) a 3' end region of target core nucleotide sequence that complements the template target sequence, and 3) a polydeoxyinosine [poly (dI)] linker bridging the 3' and 5' end sequences.
|
DW PCR was performed with three successive rounds of PCR reactions, and the primer set for each reaction was DW-ACP-1, -2, -3, or -4/target specific primer 1 (TSP1) for the 1st round reaction; DW-ACP-N/TSP2 for the 2nd round reaction; and universal primer/TSP2 or universal primer/universal primer for the 3rd round reaction. The main feature of DW-ACP-14 is the sequence of 5'NGGTC3'at 3' end region. Because the sequence of GGTC appears every 12 kb of genomic DNA, DW-ASP-14 are used as primers that can hybridize unknown target sequence. DW-ACP-N is characterized by its specific sequence targeting DW-ACP14. Universal primer is the DW-ACP without poly (dI) and 3'end region. DW-ACP (-1, -2, -3, -4, and -N) and universal primers were obtained by purchasing Walking SpeedUpTM kit (Seegene, Seoul, South Korea). The sequences of all TSPs corresponding to the LNRGW provirus nucleotide sequence between 
site and U3 of 5'long terminal repeat were 5'CAAAGTCCCTGGGACGTCTCCCAGGGTTGC3' for TSP1, 5'GTCAGTTCCACCACGGGTCCGCCAGATACAGAGCTA3' for TSP2, and 5'ATAAGGCACAGGGTCATTTCAG3' for TSP3.
Compositions of three reaction mixtures were 1) for the 1st round DW PCR, genomic DNA purified from a G1 transgenic chicken blood (0.1 µg), DW-ACP (-1, -2, -3, or -4) primer (20 pmol), TSP1 primer (10 pmol), 2 x master mix (25 µl) of Walking SpeedUpTM kit, and water to bring the total reaction volume to 50 µl; 2) for the 2nd round DW PCR, purified 1st PCR product (1 µl), DW-ACP-N and TSP2 primers (5 pmol each), 2 x master mix (10 µl), and water to make the total reaction volume to 20 µl; 3) for the 3rd round DW PCR, purified 2nd PCR product (1 µl), upstream and downstream primers (5 pmol each), 2 x master mix (10 µl), and water to adjust total reaction volume to 20 µl. The amplification profiles of three rounds of DW PCR were as follows: 1) For the 1st round DW PCR, after one cycle at 94°C for 5 min, 42°C for 1 min, and 72°C for 2 min, 30 cycles were carried out at 94°C for 30 s, 55°C for 30 s, and 72°C for 100 s, followed by primer extension at 72°C for 5 min. 2) For the 2nd round DW PCR, after an initial hot start at 94°C for 3 min, 35 cycles were carried out at 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s, followed by primer extension at 72°C for 5 min. 3) For the 3rd round DW PCR, after an initial hot start at 94°C for 3 min, 30 cycles were carried out at 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s, followed by primer extension at 72°C for 5 min. The products of the final round DW PCR were extracted from the agarose gel and purified with the GENCLEAN® II Kit (Q-BIO gene, Carlsbad, CA, USA), then directly cloned into a TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The cloned plasmids were sequenced in ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
After DW PCR and sequencing of the small genomic region 5' to the LNRGW provirus, two additional reactions of general PCR were performed to sequence more nucleotides of flanking regions. Each reaction mixture contained G1 transgenic chicken blood genomic DNA (0.1 µg), upstream and downstream primers (10 pmol each), 2 x master mix (10 µl), and water to bring the total reaction volume to 20 µl. The reaction profile of this general PCR consists of preheating (94°C for 3 min), 35 cycles of amplification (94°C for 30 s, 60°C for 30 s, and 72°C for 60 s), and primer extension (72°C for 5 min).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
solution was injected into the subgerminal cavity of the chicken blastoderm. The titer of the virus solution was 1 x 109 cfu/ml (colony-forming unit/ml). Given that the blastoderm consists of 60,000 cells, the number of infectious virus particles in the 5 µl volume injected corresponds to 80 viruses per cell. Of 129 injected eggs, 13 chicks (10.1%), 6 females and 7 males, hatched and all survived. All of the hatched chicks expressed eGFP even though the expression pattern of the transgene was mosaic, as expected (Fig. 2
).
|
To select a rooster carrying the transgene in sperm, semen samples were collected from four matured roosters and analyzed for the presence of the transgene by PCR (Fig. 2)
. Although three of the four roosters were eGFP positive, only one rooster (rooster KATH-0–2) passed the eGFP+ phenotype onto its offspring when mated to wild-type (WT) hens. Of 343 offspring sired by the rooster, two (0.6%) were scored as eGFP+. One of the two G1 chicks died just before hatching, and the remaining cockerel (KATH-1–1) survived to adulthood without showing any abnormality except the green-colored morphology (Fig. 3
). The G1 transgenic rooster (KATH-1–1) was crossed to WT hens to analyze the transmission frequency to the G2 generation. Illumination of UV showed that 44% (51/116) of the G2 birds expressed eGFP. As shown in Fig. 3
, there was no difference in transgene expression levels between G1 chicken and its G2 offspring.
|
Expression of the eGFP gene in the transgenic chicken
The G1 male transgenic chicken and nearly 50% of its progeny showed a completely green-colored external appearance (Fig. 3)
. In eGFP+ G2 birds, green fluorescence was detected in almost all organs tested, including skeletal muscle, gastrointestinal track organs, liver, testis, ovary, oviduct, and heart (Fig. 4
I). Even the total protein extracted from muscle showed bright green fluorescence (Fig. 4I-H
). Histological analysis (Fig. 4II
) of eGFP expression at the tissue level was also performed. As observed previously at the organ level, eGFP expression was detected in all tissue samples including intestine, gizzard, heart, muscle, oviduct, and pancreas. Further analysis by Western blot showed strong eGFP bands from samples prepared from heart, skeletal muscle, intestine, gizzard, liver, kidney, oviduct, testis, and blood cells (Fig. 5
). However, no eGFP band was detected from blood serum. Densitometric quantitation of the Western blot showed that the amount of eGFP/mg total protein was highest in the gizzard (100 µg/mg), followed by skeletal muscle (57 µg/mg), heart (56 µg/mg), intestine (55 µg/mg), liver (40 µg/mg), blood cell (10 µg/mg), kidney (6 µg/mg), and oviduct (3 µg/mg). In the case of the testis sample, the band density of Western blot was too weak to estimate the amount of eGFP protein.
|
|
Chromosomal analysis of the transgene
To identify the exact chromosomal location of the transgene, we carried out sequencing of flanking regions of the provirus applying DW PCR technology (Fig. 6
). Sequencing of one DNA fragment after three rounds of DW PCR identified 25 bp sequence (5' GTGGGTTTGGAAAGGGGTGGCCGTG3') flanking 5'long terminal repeat of the provirus. Search of this 25 bp sequence using basic local alignment search tool (BLAST) at Ensembl (http://www.ensembl.org/Gallus_gallus) indicated insertion of provirus in reverse orientation between the nucleotides of 55890–55891 on chromosome 26. Based on this result, PCR amplifications of further 5' and 3' flanking regions of the provirus were performed. BLAST analysis of 283 and 591 nucleotides flanking 3' long terminal repeat (LTR) and 5 LTR, respectively, resulted in 100% match to the sequences of database (Fig. 7
).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
reported germline transgenic chickens expressing eGFP using the equine lentivirus vector. Using the HIV-1 lentivirus vector, two studies (24
, 25)
reported transgenic chickens and expression of eGFP in the progeny. Compared with these reports, a major difference in our results is use of the MoMLV-based retrovirus vector. Taxonomically, lentivirus and retrovirus (more specifically, oncoretrovirus) both belong to the family of Retroviridae (34)
. Advantages of retrovirus vector over the vector derived from lentivirus are simple structure, easy manipulation, and proven reliability in terms of biosafety due to old development history. More important, most people are reluctant to use lentivirus vector because HIV belongs to the lentivirus genus. Meanwhile, a critical disadvantage of the MoMLV-based retrovirus vector is silencing of expression during early embryo development due to inactivation of the LTR promoter by de novo methylation of cytosine residues (26
, 27)
. There might be two solutions for this problem: 1) use of an LTR promoter that is active in embryonic cell, and 2) introduction of a second promoter in the virus vector sequence. Kamihira et al. (23)
used a modified retrovirus vector, of which LTR promoter was MoMLV-derived mouse stem cell virus (MSCV), but did not provide evidence of expression of the eGFP gene under the control of the MSCV promoter in the transgenic chicken. In this study, we chose the retrovirus vector with intact MoMLV LTR and internal RSV promoter to drive eGFP expression.
Injection of 129 eggs with concentrated MoMLV-based retrovirus vector resulted in the production of 13 Go chickens. Compared with other recent reports, it is hard to evaluate whether the 10% hatchability of this study is low or high because the hatchability described in other reports ranges from 27% to 4% (19
, 22
, 24
, 25)
. There are many factors affecting hatchability, including type of virus vector, injection volume, and the kind of exogenous gene being expressed. In addition, the injection skill of the experimenter and the sophistication of the laboratory facilities must be taken into account, although it is hard to gain insight into this from just a perusal of the published literature. Regarding methodology, it has been reported that high hatchability could be achieved by preventing the air from entering the egg during shell windowing (35)
and by applying an ex ovo culture system (8)
. We tested both methods and observed an increase in hatchability by application of the latter (data not shown).
Analysis of 13 Go chickens under UV light confirmed 100% transgenesis, but the expression pattern was mosaic, as expected (Fig. 2)
. Although only 30 cells of 60,000 blastodermal cells at stage X are destined to primordial germ cells (36)
, PCR analysis of sperm showed the presence of vector sequence in three of four (75%) Go roosters. This high rate of germline incorporation might be due to injection of the highly concentrated virus stock. The three Go roosters (KATH-0–1, KATH-0–2, KATH-0–4) that carried eGFP+ sperm were outbred, but only rooster KATH-0–2 gave rise to progeny expressing eGFP. No germline transmission from roosters already identified as carrying the transgene has been reported in other studies (19
, 24
, 25)
. The lack of eGFP+ progeny from the other two Go roosters (KATH-0–1 and KATH-0–4) might be due to low progeny number and/or integration of the provirus at an unfavorable chromosomal site resulting in silencing of the transgene in the progeny.
Among 343 G1 chickens produced from the mating of a mosaic Go transgenic rooster (KATH-0–2) with nontransgenic hens, only two chickens (0.6%) emitted green fluorescence The low germline transmission rate has often been referred to in recent transgenic chicken studies (19
, 24)
, and is suggested to be caused by the presence of the very small number of sperm cells carrying the transgene in the G0 founder roosters. Injection of more viruses into the egg by increasing the concentration or injection volume of the virus solution is the most straightforward solution, but this approach may reduce hatchability (23)
. There are several other studies that suggest other solutions to increase the rate of germline transmission between the G0 and G1 generation. McGrew et al. (22)
and Scott and Lois (25)
reported significant increases in these rates by using lentiviruses of equine (445%) or human (833%) origin. In other studies, a frequency of 3.3% was reported by injecting the virus solution into the heart of developing embryos after 50 to 60 h of incubation (23)
. The drawbacks of these approaches are the reluctance of researchers to use lentivirus as a vector and the need for highly elaborate skills in manipulating the eggs 50 to 60 h postincubation.
Subsequent crossbreeding of one G1 hemizygous male chicken to WT hens resulted in the production of green-colored G2 chickens at the rate of 44%. The level of eGFP expression was conserved after germline transmission since there was no difference in transgene expression levels between G1 chicken and its G2 offspring (Fig. 3)
. Examination of dissected G2 chickens confirmed emission of green fluorescent light from all organs and tissues tested (Fig. 4)
, and subsequent Western blot analysis showed relatively higher expression of eGFP in the heart, muscle, intestine, and gizzard (Fig. 5)
corresponding to the reported muscle-specific propensity of the RSV promoter (27)
. Remarkably, eGFP expression was also detected in blood cells, although the expression level was relatively low. The only sample from which we could not detect eGFP was blood serum, and we assume this is due to the absence of an appropriate signal peptide enabling eGFP to be secreted into the extracellular fluid. Densitometric quantitation of the Western blot showed that as much as 100 µg of eGFP could be extracted per 1 mg of gizzard tissue protein. Introduction of a WPRE sequence (30)
in the retrovirus vector might contribute the high level of eGFP expression.
2 analysis of 51 green-colored chickens among the 116 G2 progeny from the mating of a G1 transgenic rooster and four nontransgenic hens confirmed that the ratio of germ line transmission from G1 to G2 generations was not significantly different from the 50% expected Mendelian ratio (2 value=0.284, P value=0.963). We recently produced nine G3 generation chicks from mating of female and male G2 heterozygous birds (Fig. 8
). Seven of them under UV illumination were green-colored and the 78% (7/9) ratio of transgenesis was also close to the 75% expected Mendelian gene transmission ratio. It is encouraging to note that expression of the eGFP gene does not seem to be deleterious to chicken embryo development because expression of the same transgene under the control of RSV promoter begins at an early stage of chicken embryo development (37)
, and the gene transmission ratio of this study corresponds to the expected Mendelian ratio. In mammals, a deleterious effect of eGFP expression during early embryo development has been reported (38)
.
|
In a genomic analysis, by using DW PCR technology we could identify the chromosomal integration of the provirus in reverse orientation between the nucleotides of 55890–55891 on chromosome 26 based on chicken genome database (Fig. 7)
. No detailed information is available on the genes near the integration site of chromosome 26. This kind of study with transgenic chickens was first reported by Mozdziak and colleagues (18)
. Applying invert PCR technology, they identified the flanking sequences of the provirus insertion and clearly demonstrated the location of the E. coli LacZ transgene on chromosome 11 within the predicted gene for neurotactin/fractalkine (CX3CL1).
In conclusion, this work is the first report of the successful production of germline transgenic chickens expressing the eGFP gene using a replication-defective MoMLV-derived retrovirus vector that was considered an ineffective gene transfer system for transgenic animal production. In addition, we identified the exact chromosomal integration site of the provirus on chromosome 26. These transgenic chickens will help supplement the first draft of the chicken genome as well as provide embryonic cells visually marked with eGFP in basic development biology studies. In studies aimed at generating transgenic chickens as bioreactors producing pharmaceuticals, use of an eGFP marker gene along with the gene encoding a valuable protein of interest would be advantageous because it could greatly facilitate screening of progeny.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Current address: Animal Resources Research Center, Konkuk University, Seoul, Korea.
Received for publication February 14, 2006. Accepted for publication June 19, 2006.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  E. Harel-Markowitz, M. Gurevich, L. S. Shore, A. Katz, Y. Stram, and M. Shemesh Use of Sperm Plasmid DNA Lipofection Combined with REMI (Restriction Enzyme-Mediated Insertion) for Production of Transgenic Chickens Expressing eGFP (Enhanced Green Fluorescent Protein) or Human Follicle-Stimulating Hormone Biol Reprod, May 1, 2009; 80(5): 1046 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. Shin, T. M. Kim, S. Y. Kim, T. W. Kim, H. W. Seo, S. K. Lee, S. C. Kwon, G. S. Lee, H. Kim, J. M. Lim, et al. Generation of transgenic quail through germ cell-mediated germline transmission FASEB J, July 1, 2008; 22(7): 2435 - 2444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. J. Yin, H. S. Lee, X. F. Yu, E. Choi, B. C. Koo, M. S. Kwon, Y. S. Lee, S. J. Cho, G. Z. Jin, L. H. Kim, et al. Generation of Cloned Transgenic Cats Expressing Red Fluorescence Protein Biol Reprod, March 1, 2008; 78(3): 425 - 431. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
