FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, T.
Right arrow Articles by Colgan, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, T.
Right arrow Articles by Colgan, S. P.
(The FASEB Journal. 2006;20:2242-2250.)
© 2006 FASEB

HIF-dependent induction of adenosine A2B receptor in hypoxia

Tianqing Kong*,{dagger}, Karen A. Westerman{dagger}, Marion Faigle{ddagger}, Holger K. Eltzschig{ddagger} and Sean P. Colgan*,{dagger},§,1

* Center for Experimental Therapeutics,

{dagger} Department of Anesthesiology, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA;

{ddagger} Department of Anesthesiology and Intensive Care Medicine, Tübingen University Hospital, Tübingen, Germany; and

§ Mucosal Inflammation Program, University of Colorado Health Sciences Center, Denver, Colorado USA

1Correspondence: Mucosal Inflammation Program, University of Colorado Health Sciences Center, BRB702, Denver, CO 80262, USA; E-mail: sean.colgan{at}uchsc.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Adenosine has been widely associated with hypoxia of many origins, including those associated with inflammation and tumorogenesis. A number of recent studies have implicated metabolic control of adenosine generation at sites of tissue hypoxia. Here, we examine adenosine receptor control and amplification of signaling through transcriptional regulation of endothelial and epithelial adenosine receptors. Initial studies confirmed previous findings indicating selective induction of human adenosine A2B receptor (A2BR) by hypoxia. Analysis of the cloned human A2BR promoter identified a functional hypoxia-responsive region, including a functional binding site for hypoxia-inducible factor (HIF) within the A2BR promoter. Further studies examining HIF-1{alpha} DNA binding and HIF-1{alpha} gain and loss of function confirmed strong dependence of A2BR induction by HIF-1{alpha} in vitro and in vivo mouse models. Additional studies in endothelia overexpressing full-length A2BR revealed functional phenotypes of increased barrier function and enhanced angiogenesis. Taken together, these results demonstrate transcriptional coordination of A2BR by HIF-1{alpha} and amplified adenosine signaling during hypoxia. These findings may provide an important link between hypoxia and metabolic conditions associated with inflammation and angiogenesis.—Kong, T., Westerman, K. A., Faigle, M., Eltzschig, H. K., Colgan, S. P. HIF-dependent induction of adenosine A2B receptor in hypoxia.


Key Words: hypoxia-inducible factor • endothelium • chromatin • angiogenesis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
 
PHYSIOLOGICAL ADAPTATION TO hypoxia is an area of intense investigation. In this regard, it is widely accepted that adenosine (Ado) is a critical mediator during ischemia and hypoxia (1) and contributes to diseases as diverse as inflammation and carcinogenesis (2 3 4 5 6) . While the source of interstitial Ado in hypoxic tissue has been the basis of much debate, it is now appreciated that inhibition of adenosine kinase and the dephosphorylation of ATP and AMP by surface apyrases (e.g., CD39) and ecto-5'-nucleotidase (CD73), respectively, represent the major pathways of extracellular Ado liberation during oxygen supply imbalances (7 8 9) . Once liberated in the extracellular space, Ado is either recycled (e.g., through dipyridamole-sensitive carriers) or interacts with cell surface Ado receptors (4) . Presently, four subtypes of G protein-coupled Ado receptors exist, designated A1, A2A, A2B, or A3 and are classified according to utilization of pertussis toxin-sensitive pathways (A1 and A3) or adenylate cyclase (A2A and A2B) (4) .

Recent studies have suggested that Ado receptors (AdoR) are tightly regulated and that functional aspects of Ado responses may be determined by surface AdoR expression profiles (8) . As an example, microarray analyses of cDNA derived from endothelial cells subjected to various periods of hypoxia revealed significant changes in the AdoR profile, wherein the prominent phenotypic change favored A2BR expression, with concomitant down-regulation of AdoA1R and AdoA3R (8) . Much recent attention has been focused on A2BR, whereby therapeutics have been implicated in asthma (10) and an A2BR single nucleotide polymorphism has been associated with cystic fibrosis (11) .

In the present study, we sought to gain molecular insight into hypoxia-controlled A2BR expression and function. For these purposes, endothelial and epithelial models were utilized to define these principles. Studies of the cloned A2BR promoter revealed a prominent role for HIF-1{alpha}, and functional studies identified HIF-1{alpha}-regulated A2BR expression as an important link to barrier function and angiogenesis.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Cell culture and hypoxia
Human microvascular endothelial cells (HMEC-1) were obtained and cultured as described previously (8) . T84 intestinal epithelial cells were cultured and passaged as described previously (38) . Where indicated, hypoxia was defined as pO2 20 torr and pCO2 35 torr with the balance made up with N2 and water vapor as described previously (8 , 38) .

Cloning of A2B promoter
A2B promoter (1087 bp) was isolated from Hela cell genomic DNA using standard PCR with Pfu DNA polymerase (forward: 5'-AGGCTCAGGGTGTCGGCAAAC –3', reverse: 5'- CTA CCGAAGGCGCGCCGGG –3'), and then was cloned into PGL-3 basic luciferase expression vector (Promega, Madison, WI, USA). Homology to published sequence was determined by sequencing through the Brigham and Women’s Hospital Genomics core sequencing facility (the complete sequence was deposited in Genbank with accession DQ435607). Individual deletion/truncation of promoter constructs were generated by use of PCR with different primer sets (467 bp, forward: 5'-TGGAGAACAGCGCTGAGCCTC-3', reverse: 5'-CCACTCGCCCGAGCCCAAAG-3'; 685 bp, forward: 5'- TGGAGAACAGCGCTGAGCCTC –3', reverse: 5'-CTACCGAAGGCGCGCCGGG-3'; 891 bp, forward: AGG CTCAGGGTGTCGGCAAAC-3', reverse: 5'-CCACTCGCCCGAGCCCAAAG-3'). All of the deleted mutants were cloned into PGL-3 basic luciferase expression vector.

Reporter assays were performed using HMEC cells transfected with the indicated promoter constructs and exposed to normoxia or hypoxia as described previously (39) . All activity was normalized with respect to a constitutive expressed Renilla reporter. Where indicated, mutations were performed as described previously (39) . For the mutation of the HIF site, the original sequence ACGTG was altered into AATCG.

Isolation of A2BR cDNA and generation of stable cells
The full-length A2B cDNA (995 bp) was cloned from HMEC-1 cell RNA by use of RT-polymerase chain reaction (RT-PCR) with primers, forward: 5'-GCCACCATGCTGCTGGAGACACAGGAC-3', reverse: 5'-TCACTTGTCATCGTCATCCTTGTAATCGCCCCCGCCTAGGCCCACACCGAGAGCAG-3'. The cDNA with Flag epitope at 3' end was cloned into pcDNA3.1-zeo (Invitrogen). Homology to published sequence was determined by sequencing through the Brigham and Women’s Hospital Genomics core sequencing facility. The plasmid was transfected into HMEC-1 cells using FuGENE 6 (Roche Biochemicals). The stable cells were selected with 30 µg/ml of zeocin (Invitrogen) for 6 wk. The stable clones were verified by use of Western blotting through use of anti-Flag polyclonal antibody (pAb) (Sigma). The vector-transfected cells were used for negative control.

Chromatin immunoprecipitation (CHIP) assay
Chromatin immunoprecipitation was performed as described previously (40) . HIF binding to A2B promoter DNA was quantified by standard PCR using primers (forward:5'-ACCAACTACTTCCTGGTGTCC-3' and reverse: 5'-GCAGCTTTCATTCGTGGTTCC-3') designed to amplify a 374 bp region of the A2B promoter. Chromatin incubated with beads mouse IgG were used to control for nonspecific binding of DNA.

Lentiviral vector design, production and transduction in HMEC-1
The HIV-1 lentiviral vector used was based on a vector previously described in detail (41) . In short, the {Delta}ODD variant of HIF-1alpha (containing a proline -> alanine substitution at position 564) (20) was cloned into the Bam H1/ClaI sites of the lentiviral vector. Virus was produced and stable cell lines were generated as described before (27) .

Stable repression of HIF-1{alpha} by siRNA
With the help of the siRNA Wizard (http://www.sirnawizard.com) a sequence was chosen within the coding region of the gene of interest. The chosen hairpin primer with the sequence 5'-ACCTCGCTGACCAGTTATGATTGTGATCAAGAGTCACAATCATAACTGGTCAGCTT-3' and 5'-CAAAAAGCTGACCAGTTATGATTGTGACTCTTGATCACAATCATAAC-TGGTCAGCG-3'correspond to position 2666–2685 of the hif1a gene. Primers were annealed for 2 min at 80°C to create the hairpin structure and ligated into the Bbs1/Bbs1 digested psiRNA-hH1neo G2 vector. After transformation using the Lyocomp GT116 E. coli strain, cells were spread on a Kan Xgal agar plate with the advantage of white/blue selection. A recombinant white clone was grown, DNA was extracted and HMEC-1 cells were transfected using electroporation procedure. Two days after transfection, cells were selected with G418 (1 mg/ml) and stable transfectants were individualized after 2–3 wk. The control cell line was transfected with empty psiRNA-hH1 neoscr plasmid.

Murine models
In subsets of experiments, colonic mucosal scrapings (enriched in epithelial cells) were obtained from 6–8 wk old C57/BL6 mice subjected to TNBS-induced colitis (22) or from 6–8 wk old conditional Hif1{alpha} mutant mice or littermate controls, as described before (22) . Scrapings were homogenized in RNAlater (Qiagen) using a 22-gauge syringe (Becton Dickinson) and Qiashredder column (Qiagen). RNA extraction, including DNase digestion was performed using the RNeasy kit (Qiagen). Reverse-transcription was done using the iScript cDNA Synthesis Kit (Bio-Rad). RT-PCR analysis was performed using the gene-specific primers for murine A2BR (forward 5-GCTGTCCTGAGCCCGACACT-3' and reverse 5'-CAAGCTGATGGTGATGGCAAAG-3) and murine ß-actin forward: 5'-CTAGGCACCAGGGTGTGAT-3' and reverse: 5'-TGCCAGATCTTCTCCATGTC-3'. These protocols were in accordance with NIH guidelines for use of live animals and were approved by the Institutional Animal Care and Use Committee at Brigham and Women’s Hospital.

Paracellular permeability assays
Permeability assays to 70 kDa FITC-dextran and calculations of flux rates were performed exactly as described previously (23) .

Endothelial tube formation assay
Wells on 24-well plates were coated with 100 µl Matrigel (Becton Dickenson) according to manufacturer’s recommendation. HMEC-1 vector control and A2B stable cells were seeded at a density of 5 x 104 cells/well and exposed to normoxia or hypoxia (6 or 18 h as indicated) in the presence of the A2BR antagonist MRS1754 (Sigma, final concentration 40 nM) or an equivalent dilution of DMSO vehicle. Tube formation was inspected at 6 and 18 h under phase-contrast light (Nikon Eclipse E600) microscope equipped with a digital camera. Tube length was quantified from digitized pictures as described elsewhere (42) .

Data analysis
Data were compared by two-factor ANOVA or by Student’s t test where appropriate. Values are expressed as the mean ± SEM from at least three separate experiments.


   RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
 
Adenosine A2b receptor induction by hypoxia
For a number of reasons, we sought to understand details of A2BR regulation by hypoxia. First, Ado is widely associated with hypoxia (6) , and such studies have demonstrated that hypoxia promotes Ado signaling both in vitro and in vivo, primarily through Ado A2 receptors (12 , 13) . Second, our previous microarray studies have revealed selective induction of A2BR by hypoxia (8) . Third, recent work suggested that the various tumors, which are known to be hypoxic (14) , overexpress A2BR (3) . Based on these observations, we sought to examine mechanism(s) of A2BR regulation by hypoxia. As shown in Fig. 1A, analysis of endothelial mRNA by real-time polymerase chain reaction (PCR) revealed a time-dependent induction of A2BR by hypoxia (P<0.01 by ANOVA), with maximal changes of 4.4 ± 0.8-fold increase at 16 h (P<0.01). Extensions of these findings at the protein level by Western blot revealed that total levels of A2BR, like that of mRNA, were increased in a time-dependent manner by hypoxia (Fig. 1B ). Densitometric analysis (relative to ß-actin) revealed a maximal increase at 48 h, with a 6 ± 1.2-fold over normoxia (P<0.01). Such findings confirm previous studies that hypoxia prominently induces both A2BR mRNA and protein (8 , 15 , 16) .


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Induction of A2BR mRNA and protein expression by hypoxia. A) HMEC-1 were exposed to normoxia or hypoxia for indicated time. Total RNA was isolated, and A2BR mRNA levels were determined by real-time PCR. Data were calculated relative to ß-actin and expressed as fold change relative to normoxia ± SEM Results are derived from three experiments (*Different from normoxia, P<0.01). B) Induction of endothelial A2BR protein by hypoxia. Shown here is a representative Western blot of A2BR following incubation for indicated periods of hypoixia, with ß-actin as a control.

Other studies were performed to define if A2BR induction by hypoxia required transcription. To do this, HMEC-1 cells were subjected to normoxia or hypoxia (12 h) in the presence or absence of the transcriptional inhibitor 5,6-dichlorobenzimidazole riboside (DRB, 3 µM final concentration) and assessed for changes in A2BR expression by real-time PCR. Preincubation of HMEC-1 cells with DRB inhibited the hypoxia-dependent induction of A2BR by 79 ± 8.1% (data not shown). Consequently, hypoxia-mediated induction of A2BR requires transcriptional activity.

Cloning and studies of the A2BR promoter
In view of the likelihood of a transcription-mediated induction of A2BR during hypoxia, attention was directed at the 5'-region of the A2BR gene for potential hypoxia regulated transcription factor sequences. Available public databases (17) and analysis of full-length cDNA [Genbank Accession NM_000676 (18) ] identified the transcription start site of A2BR at position –333 relative to the first codon (ATG, see Fig. 2 A). Based on these reports, we cloned genomic fragments extending from positions –784 to +303 (termed A2b-1087), from –813 to +78 (termed A2b-891), from –382 to +303 (termed A2b-685) and from –389 to +78 (termed A2b-467) into pGL3 luciferase reporter vector and examined transcriptional activity following transient transfection in HMEC-1 cells. This analysis revealed a minimal contribution of the 5' region extending beyond position –382, with an approximate 35% loss of promoter activity (see Fig. 2A ). In addition, this analysis revealed no significant contribution of sequence extending 3' beyond the transcription start site (P =not significant), including at least one Sp1 binding site (see Fig. 2A ).


Figure 2
View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Cloning and analysis of the A2BR promoter. A) Map of cloned A2BR and luciferase constructs utilized here. Relative positions of each clone are annotated, as well as the transcription start site (TSS) and the first translated codon (ATG). Putative Sp1 binding sites (Sp1) are also shown. In transfection assays, the relative luciferase expression levels are shown adjacent to each individual clone. Data are expressed as mean ± SEM relative luciferase activity for three individual experiments. B) HMEC-1 monolayers were transfected with plasmids expressing sequence corresponding to full length A2BR (A2b-1087) or indicated 5' truncations: A2b-891, A2b-685, A2b-467, as well as empty vector (pGL3) and a positive control plasmid encoding the HRE from the erythropoietin gene. Transfected cells were exposed to hypoxia or normoxia for 24 h and assessed for luciferase activity. Data are mean ± SEM from three separate experiments (*different from normoxia, P<0.01).

We next utilized these four promoter constructs to examine whether hypoxia regulates A2BR promoter activity. As shown in Fig. 2B , analysis of luciferase reporter activity revealed that in constructs containing the 5' promoter region spanning positions –1107 to –355 hypoxia induced A2BR promoter activity by 5.3 ± 1.1 and 6.3 ± 0.9 for constructs A2b-891 and A2b-1087, respectively (both P<0.01). Truncation of the 5' region extending beyond position –382 (constructs A2b-467 and A2b-685) resulted in a complete loss of hypoxia-inducibility (Fig. 2B , P=not significant), thereby implicating the region spanning positions –382 to –784 for hypoxia inducibility.

Role of HIF-1 in hypoxia-inducible A2BR
Analysis of our cloned region of A2BR revealed the existence of a potential binding site for HIF-1{alpha} (core sequence 5'-CACGTGG-3') at position –561 to –555 relative to the transcription start site and a HIF-1 ancillary sequence (5'-CGGGAG-3') (18) located 9 base pairs in the 3' direction (nucleotides –546 to –541, (Fig. 3 A). Based on these findings, and known endothelial expression of HIF-1{alpha} (19) , we determined whether HIF-1{alpha} would bind the A2BR promoter. For these purposes, we utilized ChIP analysis to examine binding of HIF-1{alpha} to the A2BR promoter spanning the putative HIF-1{alpha} binding site in intact cells. As shown in Fig. 3B , this analysis revealed a prominent band of 374 bp in nuclei derived from hypoxic, but not normoxic cells. No bands were evident in the beads-only control, and preimmunoprecipitation samples revealed equivalent DNA input.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. Functional HIF binding to the A2BR in hypoxia. A) Map of cloned A2BR HRE. Positions of the HIF binding site (HBS) and the HIF ancillary site (HAS) relative to the TSS are shown. B) ChIP was utilized to examine HIF-1{alpha} binding to the A2BR promoter in normoxic and hypoxic HMEC-1 cells. Reaction controls included immunoprecipitations using a nonspecific IgG monoclonal antibody (mAb) and PCR performed using HMEC-1 DNA (Input). An example of three experiments is shown. C) HMEC-1 monolayers were transfected with plasmids expressing full length A2BR (A2b-1087) or HIF site mutant (A2b-1087{Delta}HIF), as well as empty vector (pGL3), and exposed to hypoxia or normoxia for 24 h and assessed for luciferase activity. Data are mean ± SEM from three experiments (*different from WT A2BR, P<0.01).

To rule out the possibility that the loss of hypoxia inducibility with truncations at the 5' end of the A2BR promoter simply reflect the deletion of a large DNA segment (see Fig. 2A ), a HIF-1{alpha} binding site mutation was introduced in the hypoxia inducible full-length promoter construct (A2b-1087, see Fig. 2 ), and as shown in Fig. 3C a three nucleotide mutation (A2b-1087{Delta}HIF consensus motif 5'-CACGTGG-3' mutated to 5'- CAATCGG –3' within HIF-1 site) resulted in a 69 ± 5% decrease in luciferase activity under hypoxic conditions (P<0.01). HMEC-1 cells were then transfected with wild-type (WT) and A2BR-1087{Delta}HIF and exposed to hypoxia. These results demonstrate that disruption of the HIF-1{alpha} binding site largely obliterates the A2BR inducible response to hypoxia.

To further probe the role of HIF-1{alpha} in A2BR regulation in hypoxia, we generated a HMEC-1 line expressing oxygen-stable HIF-1{alpha} (HMEC{Delta}ODD) (20) via lentiviral transduction (Fig. 4 ). As shown in Fig. 4A , using this lentiviral vector expressing GFP, greater than 90% of HMEC-1 were stably transduced by this method. Analysis of the HMEC{Delta}ODD by Western blot (Fig. 4B ) and by HRE luciferase (Fig. 4C ) revealed increased HIF function and activity during both normoxia and hypoxia, relative to the control HMEC-GFP cell line. The further increase of HIF function and activity with hypoxia most likely reflects the combination of oxygen-stable and oxygen-unstable HIF-1{alpha}. Using the HMEC{Delta}ODD cell line, we addressed whether AdoA2BR expression was differentially regulated. As shown in Fig. 4D , AdoA2B mRNA expression in normoxia was increased by >80% in the HMEC{Delta}ODD relative to the control HMEC-GFP cell line (P<0.01). Likewise, enhanced expression of AdoA2B was observed in HMEC-1{Delta}ODD compared with control HMEC-GFP cells at 6, and 18 h hypoxia (P<0.025 for each). Such findings support the hypothesis that AdoA2B induction in hypoxia is proportional to HIF-1{alpha} activity.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Characterization of endotheliall cell line expressing oxygen-stable HIF-1{alpha}. A) Imaging of HMEC-1 cells stably transduced with a control lentivirus encoding GFP. For comparison, the phase contrast image is also shown. B) HMEC transduced with control GFP lentivirus (HMEC-GFP) or {Delta}ODD lentivirus (HMEC-HIF), exposed to normoxia or hypoxia (6 h), and nuclear HIF-1{alpha} expression was examined by Western blot (ß-actin controls are also shown). C) HMEC-GFP and HMEC-HIF cells were transiently transfected with the HIF reporter HRE-luciferase plasmid, and exposed to hypoxia or normoxia (24 h). Relative HIF activity was assessed by luciferase relative to empty vector (pGL3). D) HMEC-GFP or HMEC-HIF cells were exposed to normoxia or hypoxia and examined for expression of A2BR protein by Western blot, with actin as a control.

We next examined the influence of targeted HIF-1{alpha} repression on A2BR expression. For these purposes, we generated a stable HMEC-1 cell line expressing shRNA directed against HIF-1{alpha}. As shown in Fig. 5A, the designed shRNA repressed HIF-1{alpha} protein by >80% on exposure of HMEC-1 to hypoxia. Control shRNA did not influence HIF-1{alpha} expression compared with control HMEC-1 cells (data not shown). Examination of A2BR expression in this cell line revealed no significant induction of A2BR by hypoxia in cells HIF-1{alpha} repressed HMEC-1 (P=not significant by ANOVA, see Fig. 5B ) but significant hypoxia-inducible A2BR expression in the control cell line (P<0.025 by ANOVA, Fig. 5B ). Such results strongly implicate HIF-1{alpha} in hypoxia-inducible A2BR.


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
Figure 5. Role of HIF-1{alpha} in hypoxia-induced A2BR expression. A) Generation of an endothelial cell line stably expressing HIF-1{alpha} siRNA. Cells were stably transfected with a plasmid expressing HIF-1{alpha} siRNA (HIF1a) or empty plasmid (Empty). Cells were exposed to hypoxia (pO2 20 torr, 4 h) and probed for HIF-1{alpha} expression by Western blot. Representative blot from n = 3. B) A2BR induction by hypoxia in HMEC-1 expressing HIF-1{alpha} siRNA or empty siRNA. Shown here is real-time PCR analysis of A2BR expression following exposure of cells to indicated periods of hypoxia (pO2 20 torr, 4 h). Data are pooled from three experiments (*different from HIF1a siRNA, P<0.025). RT-PCR analysis of A2BR induction by hypoxia in T84 intestinal epithelial cells (C), mouse colon in colitis (D), and in the colon of hif1a mice (E). Shown is a representative experiment of three performed.

A2BR regulation by HIF-1{alpha} in vivo
In the course of these experiments it was revealed that A2BR expression was hypoxia-inducible in epithelial cells, similar to that of endothelial cells (Fig. 5) . Indeed, examination of A2BR expression in T84 intestinal epithelial cells, a cell line known to express A2BR (21) , revealed prominent hypoxia inducibility at the mRNA level (Fig. 5C ). We extended these findings in epithelial cells to examine HIF-1{alpha}-dependent regulation of A2BR in murine models. As shown in Fig. 5D , colonic epithelial cells derived from mice subjected conditions know activate HIF-1{alpha} (colitis) (22) revealed prominent induction of A2BR mRNA, thereby serving as a functional correlate for HIF-dependent induction of A2BR in vivo.

To directly examine the role of HIF-1{alpha} in A2BR expression in vivo, we extended these findings into a genetic in vivo model. Here, we examined A2BR mRNA levels in intestinal epithelia derived from conditional hif1a knockout mice, a mouse line in which intestinal epithelia from these mice lack detectable HIF-1{alpha} expression in >70% of cells (22) . As show in Fig. 5E , and consistent with our hypothesis that HIF-1{alpha} transcriptionally induces A2BR, PCR analysis revealed a prominent decrease in intestinal epithelial A2BR expression in hif1{alpha} mutant animals (65±12% decrease by densitometry, P<0.025). Taken together, such findings support our in vitro findings and indicate the likelihood that HIF-1{alpha} directly regulates murine A2BR expression.

Functional sequellae of A2BR in endothelial cells overexpressing A2BR
To gain insight into functional sequellae of increased A2BR expression in endothelia, we generated an HMEC-1 line stably overexpressing epitope-tagged, full-length A2BR (termed A2b-Flag). As shown in Fig. 6A, PCR analysis revealed that A2b-Flag HMEC-1 significantly overexpress A2BR (by densitometry 7.2±1.5-fold increase over vector controls, P<0.01). This expression pattern was specific for A2BR, inasmuch as no differences were observed in expression of other AdoR (e.g., see AdoA1R in Fig 6A ). Analysis of epitope-tagged A2BR-Flag by Western blot using anti-Flag polyclonal antibody (Ab) revealed a prominent band at the appropriate molecular mass in A2b-Flag (Fig. 6B ), but not in vector controls.


Figure 6
View larger version (51K):
[in this window]
[in a new window]
 
Figure 6. Functional influence of A2BR overexpression. A) Generation of an endothelial cell line stably expressing Flag-A2BR (connotated A2b-Flag). Shown here is PCR-based expression of A2BR relative to adenosine A1 receptor (A1R) in A2b-Flag and vector transfected controls (Vector). Actin is shown as a control for the PCRT reaction. B) Western blot analysis of for epitope-tagged (Flag) A2BR relative to Vector controls. C) Influence of A2BR on endothelial tube formation in Matrigel substrates. Images of a representative experiment assessing tube formation at 6 of hypoxia or normoxia in the presence and absence of the A2BR antagonist MRS1754 (40 nM). Lower panels depict quantification of tube length (units±SEM) at 0, 6, and 18 h of hypoxia for A2b-Vector (left) and A2b-Flag in the presence (white bars) and absence (black bars) of MRS1754. Data are pooled from three experiments (*different from normoxia, P < 0.01; #different from A2b-Vector, P <0.001). D) Influence of A2BR on Ado-stimulated endothelial permeability. HMEC-1, A2b-Vector, or A2BR-Flag endothelia were plated to on permeable supports, exposed to indicated concentrations of Ado, and permeability to FITC-dextran was quantified. Data are from 9 monolayers in each condition and expressed as mean ± SEM (*significantly different from HMEC-1 and A2b-Vector (P<0.025).

We utilized A2b-Flag cells to study the role of A2BR overexpression in endothelial cells. For these purposes, we examined two well-established functions attributable to Ado signaling, namely endothelial tube formation in Matrigel substrates (15) and barrier function (8 , 23) . To address endothelial tube formation, A2b-Flag and HMEC-Vector control cells were plated on Matrigel and exposed to either normoxia or hypoxia in the presence and absence of the selective A2BR antagonist MRS1754 (24) . As depicted in Fig. 6C , exposure of HMEC-Vector cells to hypoxia (6 or 18 h) resulted in significant tube formation, as revealed by the organization of cultured cells into linear clusters of tubes. Quantitation of such tube formation by measurement of tube length revealed a hypoxia time-dependent increase in tube length (by ANOVA, P<0.01). Such tube formation was nearly abolished by the addition of MRS1754 (by comparison to vehicle controls, P<0.001). By contrast, A2b-Flag endothelial cells exposed to similar conditions revealed a much more prominent increase in tube formation in normoxia (P<0.001 when compared to HMEC-vector cells), suggesting that directed overexpression of A2BR drives endothelial tube formation. Like that in control cells, hypoxia increased tube formation in A2b-Flag cells (by ANOVA, P<0.05), and was inhibited by addition of MRS1754 (P<0.001). These observations extend previous work indicating that hypoxia is associated with A2BR induction, and that such induction drives angiogenic responses (15 , 25) .

Previous studies have implicated the A2BR in barrier resealing following neutrophil transmigration, and that such functional responses can be recapitulated with native Ado (23) . As shown in Fig. 6D , Ado-triggered increases in endothelial barrier function (i.e., decreased paracellular permeability) were significantly more pronounced in A2b-Flag HMEC relative to either WT HMEC-1 (by ANOVA, P<0.025) or A2b-Vector cells (by ANOVA, P<0.025). Consistent with previous studies (8) , such findings of increased barrier function were inhibited by >85% by addition of MRS1754 (data not shown), thereby strongly implicating increased A2BR in barrier protection during hypoxia.

These new findings contribute significantly to current understanding of Ado signaling in hypoxia. In this regard, multiple lines of evidence now significantly implicate HIF in metabolism of adenine nucleotides to Ado as well as amplification of signaling through the A2BR. First, the terminal enzyme in the generation of extracellular Ado (CD73) is induced by hypoxia in a HIF-dependent manner (9 , 22) , and studies in cd73–/– mice have revealed an important role for CD73 in vascular adaptation to hypoxia (26) . Second, clearance mechanisms of Ado, such as those involving equilibrative nucleoside transporters (ENT), are repressed during hypoxia through HIF-1-dependent mechanisms, thereby lengthening the apparent half-life of extracellular Ado (27) . Third, the present studies support a prominent role for HIF-1-regulated A2BR as a mechanism to amplify Ado signaling under such circumstances. HIF-1-dependence was shown at the A2BR promoter level, through direct mutagenesis of the HIF-1{alpha} binding site, by DNA binding of HIF-1{alpha} in vivo and by loss and gain of HIF-1{alpha} function in endothelial cells. Additional studies in intestinal epithelial cells, which express readily demonstrable A2BR (21 , 28) , identified a role for HIF-1{alpha} in vivo. Indeed, conditional deletion of hif1a in colonic epithelial cells (22) revealed attenuated A2BR expression, thereby genetically confirming our original hypothesis that HIF-1{alpha} is central to regulation of A2BR regulation by hypoxia. Notably, these studies in vivo also revealed that A2BR is induced in epithelia derived from a murine colitis model. Such findings support previous work in humans and murine models identifying a prominent hypoxia response, with concomitant HIF activation, at the level of the epithelium in inflammatory bowel diseases (22 , 29) . In this regard, recent work revealed that the selective A2AR agonist ATL-146e attenuates intestinal inflammation associated with murine colitis models (30) , thereby suggesting that adenosine receptors may be interesting targets for colitis.

Notable is the observation that overexpression of A2BR promotes an angiogenic phenotype, as measured by endothelial tube formation. Both hypoxia and overexpression of A2BR enhanced the kinetics of this response, and this response was nearly completely abolished by addition of MRS1754. Such observations are consistent with A2BR-dependent regulation of vascular endothelial growth factor (VEGF) (15 , 25) , and as inferred from recent work profiling of various tumor types, A2BR was consistently overexpressed in a number of tumors (3) . Given that HIF is commonly overexpressed in a number of tumors (31) , this A2BR-dependent angiogenic response may contribute to tumor progression. Also notable is significant previous work implicating A2AR in angiogenic factor regulation and functional angiogenesis in vitro, in vivo, and on various cell types (e.g., endothelial cells and macrophages) (32 33 34 35 36) . Our studies in HMEC-1 nicely correlate with adenosine receptor profiles in other endothelial cells (e.g., human umbilical vein endothelia) (37) , an while we did not observe a significant regulation of A2AR in hypoxia in HMEC-1, A2AR are present and widely expressed on various vascular bed endothelial cells, and therefore could likely contribute to our findings here.


   ACKNOWLEDGMENTS
 
The authors wish to acknowledge Dionne Daniels for technical assistance. This work was supported by NIH grants HL60569, DE016191, DK50189, and DFG grant EL274/2–2.

Received for publication April 26, 2006. Accepted for publication June 19, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
 

  1. Ohta, A., Sitkovsky, M. (2001) Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414,916-920[CrossRef][Medline]
  2. Fishman, P., Bar-Yehuda, S., Madi, L., Cohn, I. (2002) A3 adenosine receptor as a target for cancer therapy. Anticancer Drugs 13,437-443[CrossRef][Medline]
  3. Li, S., Huang, S., Peng, S. B. (2005) Overexpression of G protein-coupled receptors in cancer cells: involvement in tumor progression. Int. J. Oncol. 27,1329-1339[Medline]
  4. Linden, J. (2001) Molecular approach to adenosine receptors: receptor-mediated mechanisms of tissue protection. Annu. Rev. Pharmacol. Toxicol. 41,775-787[CrossRef][Medline]
  5. Merighi, S., Mirandola, P., Varani, K., Gessi, S., Leung, E., Baraldi, P. G., Tabrizi, M. A., Borea, P. A. (2003) A glance at adenosine receptors: novel target for antitumor therapy. Pharmacol. Ther. 100,31-48[CrossRef][Medline]
  6. Sitkovsky, M., Lukashev, D. (2005) Regulation of immune cells by local-tissue oxygen tension: HIF1 alpha and adenosine receptors. Nat. Rev. Immunol. 5,712-721[CrossRef][Medline]
  7. Decking, U. K., Schlieper, G., Kroll, K., Schrader, J. (1997) Hypoxia-induced inhibition of adenosine kinase potentiates cardiac adenosine release. Circ. Res. 81,154-164[Abstract/Free Full Text]
  8. Eltzschig, H. K., Ibla, J. C., Furuta, G. T., Leonard, M. O., Jacobson, K. A., Enjyoji, K., Robson, S. C., Colgan, S. P. (2003) Coordinated adenine nucleotide phosphohydrolysis and nucleoside signaling in posthypoxic endothelium: role of ectonucleotidases and adenosine A2B receptors. J. Ex. Med. 198,783-796[Abstract/Free Full Text]
  9. Synnestvedt, K., Furuta, G. T., Comerford, K. M., Louis, N., Karhausen, J., Eltzschig, H. K., Hansen, K. R., Thompson, L. F., Colgan, S. P. (2002) Ecto-5'-nucleotidase (CD73) regulation by hypoxia-inducible factor-1 (HIF-1) mediates permeability changes in intestinal epithelia. J. Clin. Invest. 110,993-1002[CrossRef][Medline]
  10. Holgate, S. T. (2005) The Quintiles Prize Lecture 2004. The identification of the adenosine A2B receptor as a novel therapeutic target in asthma. Br. J. Pharmacol. 145,1009-1015[CrossRef][Medline]
  11. Tang, C. M., Hoerning, A., Buscher, R., O’Connor, D. T., Ratjen, F., Grasemann, H., Insel, P. A. (2005) Human adenosine 2B receptor: SNP discovery and evaluation of expression in patients with cystic fibrosis. Pharmacogenet. Genomics 15,321-327[Medline]
  12. Sitkovsky, M. V., Lukashev, D., Apasov, S., Kojima, H., Koshiba, M., Caldwell, C., Ohta, A., Thiel, M. (2004) Physiological control of immune response and inflammatory tissue damage by hypoxia-inducible factors and adenosine A2A receptors. Annu. Rev. Immunol. 22,657-682[CrossRef][Medline]
  13. Weissmueller, T., Eltzschig, H. K., Colgan, S. P. (2005) Dynamic purine signalling and metabolism during neutrophil-endothelial interactions. Purinergic Signal 1,229-239[Medline]
  14. Pugh, C. W., Ratcliffe, P. J. (2002) The von Hippel-Lindau tumor suppressor, hypoxia-inducible factor-1 (HIF- 1) degradation, and cancer pathogenesis. Semin. Cancer Biol. 13,83-89
  15. Feoktistov, I., Ryzhov, S., Zhong, H., Goldstein, A. E., Matafonov, A., Zeng, D., Biaggioni, I. (2004) Hypoxia modulates adenosine receptors in human endothelial and smooth muscle cells toward an A2B angiogenic phenotype. Hypertension 44,649-654Epub 2004 Sep 2027[Abstract/Free Full Text]
  16. Zhong, H., Belardinelli, L., Maa, T., Zeng, D. (2005) Synergy between A2B adenosine receptors and hypoxia in activating human lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 32,2-8Epub 2004 Oct 2007[Abstract/Free Full Text]
  17. Yamashita, R., Suzuki, Y., Wakaguri, H., Tsuitani, K., Nakai, K., Sugano, S. (2006) DBTSS: DataBase of human transcription start sites, progress report 2007. Large-scale collection and characterization of promoters of human and mouse genes 5'-end SAGE for the analysis of transcriptional start sites. Nucleic Acids Res. 34,D86-D89[Abstract/Free Full Text]
  18. Kimura, H., Weisz, A., Ogura, T., Hitomi, Y., Kurashima, Y., Hashimoto, K., D’Acquisto, F., Makuuchi, M., Esumi, H. (2001) Identification of hypoxia-inducible factor 1 ancillary sequence and its function in vascular endothelial growth factor gene induction by hypoxia and nitric oxide. J. Biol. Chem. 276,2292-2298[Abstract/Free Full Text]
  19. Karhausen, J., Haase, V. H., Colgan, S. P. (2005) Inflammatory hypoxia: role of hypoxia-inducible factor. Cell Cycle 4,256-258[Medline]
  20. Huang, L. E., Gu, J., Schau, M., Bunn, H. F. (1998) Regulation of hypoxia-inducible factor 1{alpha} is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc. Nat. Acad. Sci. (U. S. A.) 95,7987-7992[Abstract/Free Full Text]
  21. Strohmeier, G. R., Reppert, S. M., Lencer, W. I., Madara, J. L. (1995) The A2b adenosine receptor mediates cAMP responses to adenosine receptor agonists in human intestinal epithelia. J. Biol. Chem. 270,2387-2394[Abstract/Free Full Text]
  22. Karhausen, J. O., Furuta, G. T., Tomaszewski, J. E., Johnson, R. S., Colgan, S. P., Haase, V. H. (2004) Epithelial hypoxia-inducible factor-1 is protective in murine experimental colitis. J. Clin. Invest. 114,1098-1106[CrossRef][Medline]
  23. Lennon, P. F., Taylor, C. T., Stahl, G. L., Colgan, S. P. (1998) Neutrophil-derived 5'-adenosine monophosphate promotes endothelial barrier function via CD73-mediated conversion to adenosine and endothelial A2B receptor activation. J. Exp. Med. 188,1433-1443[Abstract/Free Full Text]
  24. Ji, X., Kim, Y. C., Ahern, D. G., Linden, J., Jacobson, K. A. (2001) [3H]MRS 1754, a selective antagonist radioligand for A(2B) adenosine receptors. Biochem. Pharmacol. 61,657-663[CrossRef][Medline]
  25. Feoktistov, I., Goldstein, A. E., Ryzhov, S., Zeng, D., Belardinelli, L., Voyno-Yasenetskaya, T., Biaggioni, I. (2002) Differential expression of adenosine receptors in human endothelial cells: role of A2B receptors in angiogenic factor regulation. Circ. Res. 90,531-538[Abstract/Free Full Text]
  26. Thompson, L. F., Eltzschig, H. K., Ibla, J. C., Van De Wiele, C. J., Resta, R., Morote-Garcia, J. C., Colgan, S. P. (2004) Crucial role for ecto-5'-nucleotidase (CD73) in vascular leak during hypoxia. J. Exp. Med. 200,1395-1405[Abstract/Free Full Text]
  27. Eltzschig, H. K., Abdulla, P., Hoffman, E., Hamilton, K. E., Daniels, D., Schonfeld, C., Loffler, M., Reyes, G., Duszenko, M., Karhausen, J., et al (2005) HIF-1-dependent repression of equilibrative nucleoside transporter (ENT) in hypoxia. J. Exp. Med. 202,1493-1505[Abstract/Free Full Text]
  28. Sitaraman, S. V., Merlin, D., Wang, L., Wong, M., Gewirtz, A. T., Si-Tahar, M., Madara, J. L. (2001) Neutrophil-epithelial crosstalk at the intestinal lumenal surface mediated by reciprocal secretion of adenosine and IL-6. J. Clin. Invest. 107,861-869[CrossRef][Medline]
  29. Giatromanolaki, A., Sivridis, E., Maltezos, E., Papazoglou, D., Simopoulos, C., Gatter, K. C., Harris, A. L., Koukourakis, M. I. (2003) Hypoxia inducible factor 1alpha and 2alpha overexpression in inflammatory bowel disease. J. Clin. Pathol. 56,209-213[Abstract/Free Full Text]
  30. Odashima, M., Bamias, G., Rivera-Nieves, J., Linden, J., Nast, C. C., Moskaluk, C. A., Marini, M., Sugawara, K., Kozaiwa, K., Otaka, M., et al (2005) Activation of A2A adenosine receptor attenuates intestinal inflammation in animal models of inflammatory bowel disease. Gastroenterology 129,26-33[CrossRef][Medline]
  31. Maxwell, P. H. (2005) The HIF pathway in cancer. Semin. Cell Dev. Biol. 16,523-530Epub 2005 Apr 2022[CrossRef][Medline]
  32. Desai, A., Victor-Vega, C., Gadangi, S., Montesinos, M. C., Chu, C. C., Cronstein, B. N. (2005) Adenosine A2A receptor stimulation increases angiogenesis by down-regulating production of the antiangiogenic matrix protein thrombospondin 1. Mol. Pharmacol. 67,1406-1413Epub 2005 Jan 1426[Abstract/Free Full Text]
  33. Leibovich, S. J., Chen, J. F., Pinhal-Enfield, G., Belem, P. C., Elson, G., Rosania, A., Ramanathan, M., Montesinos, C., Jacobson, M., Schwarzschild, M. A., et al (2002) Synergistic up-regulation of vascular endothelial growth factor expression in murine macrophages by adenosine A(2A) receptor agonists and endotoxin. Am. J. Pathol. 160,2231-2244[Abstract/Free Full Text]
  34. Montesinos, M. C., Desai, A., Chen, J. F., Yee, H., Schwarzschild, M. A., Fink, J. S., Cronstein, B. N. (2002) Adenosine promotes wound healing and mediates angiogenesis in response to tissue injury via occupancy of A(2A) receptors. Am. J. Pathol. 160,2009-2018[Abstract/Free Full Text]
  35. Montesinos, M. C., Shaw, J. P., Yee, H., Shamamian, P., Cronstein, B. N. (2004) Adenosine A(2A) receptor activation promotes wound neovascularization by stimulating angiogenesis and vasculogenesis. Am. J. Pathol. 164,1887-1892[Abstract/Free Full Text]
  36. Pinhal-Enfield, G., Ramanathan, M., Hasko, G., Vogel, S. N., Salzman, A. L., Boons, G. J., Leibovich, S. J. (2003) An angiogenic switch in macrophages involving synergy between Toll-like receptors 2, 4, 7, and 9 and adenosine A(2A) receptors. Am. J. Pathol. 163,711-721[Abstract/Free Full Text]
  37. Montesinos, M. C., Gadangi, P., Longaker, M., Sung, J., Levine, J., Nilsen, D., Reibman, J., Li, M., Jiang, C. K., Hirschhorn, R., Recht, P. A., et al (1997) Wound healing is accelerated by agonists of adenosine A2 (G alpha s-linked) receptors. J. Exp. Med. 186,1615-1620[Abstract/Free Full Text]
  38. Furuta, G. T., Turner, J. R., Taylor, C. T., Hershberg, R. M., Comerford, K. M., Narravula, S., Podolsky, D. K., Colgan, S. P. (2001) Hypoxia-inducible factor 1-dependent induction of intestinal trefoil factor protects barrier function during hypoxia. J. Ex. Med. 193,1027-1034[Abstract/Free Full Text]
  39. Louis, N. A., Hamilton, K. E., Kong, T., Colgan, S. P. (2005) HIF-dependent induction of apical CD55 coordinates epithelial clearance of neutrophils. FASEB J. ,2287-2293In press
  40. Kong, T., Eltzschig, H. K., Karhausen, J., Colgan, S. P., Shelley, C. S. (2004) Leukocyte adhesion during hypoxia is mediated by HIF-1-dependent induction of beta2 integrin gene expression. Proc. Natl. Acad. Sci. U. S. A. 101,10440-10445[Abstract/Free Full Text]
  41. Pawliuk, R., Westerman, K. A., Fabry, M. E., Payen, E., Tighe, R., Bouhassira, E. E., Acharya, S. A., Ellis, J., London, I. M., Eaves, C. J., et al (2001) Correction of sickle cell disease in transgenic mouse models by gene therapy. Science 294,2368-2371[Abstract/Free Full Text]
  42. Kiosses, W. B., Hood, J., Yang, S., Gerritsen, M. E., Cheresh, D. A., Alderson, N., Schwartz, M. A. (2002) A dominant-negative p65 PAK peptide inhibits angiogenesis. Circ. Res. 90,697-702[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Ahmad, S. Ahmad, L. Glover, S. M. Miller, J. M. Shannon, X. Guo, W. A. Franklin, J. P. Bridges, J. B. Schaack, S. P. Colgan, et al.
Adenosine A2A receptor is a unique angiogenic target of HIF-2{alpha} in pulmonary endothelial cells
PNAS, June 30, 2009; 106(26): 10684 - 10689.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-S. Frick, C. F. MacManus, M. Scully, L. E. Glover, H. K. Eltzschig, and S. P. Colgan
Contribution of Adenosine A2B Receptors to Inflammatory Parameters of Experimental Colitis
J. Immunol., April 15, 2009; 182(8): 4957 - 4964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. L. Hart, B. Jacobi, J. Schittenhelm, M. Henn, and H. K. Eltzschig
Cutting Edge: A2B Adenosine Receptor Signaling Provides Potent Protection during Intestinal Ischemia/Reperfusion Injury
J. Immunol., April 1, 2009; 182(7): 3965 - 3968.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. V. Sitkovsky, J. Kjaergaard, D. Lukashev, and A. Ohta
Hypoxia-Adenosinergic Immunosuppression: Tumor Protection by T Regulatory Cells and Cancerous Tissue Hypoxia
Clin. Cancer Res., October 1, 2008; 14(19): 5947 - 5952.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Eckle, D. Kohler, R. Lehmann, K. C. El Kasmi, and H. K. Eltzschig
Hypoxia-Inducible Factor-1 Is Central to Cardioprotection: A New Paradigm for Ischemic Preconditioning
Circulation, July 8, 2008; 118(2): 166 - 175.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. C. Morote-Garcia, P. Rosenberger, J. Kuhlicke, and H. K. Eltzschig
HIF-1-dependent repression of adenosine kinase attenuates hypoxia-induced vascular leak
Blood, June 15, 2008; 111(12): 5571 - 5580.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Eckle, M. Faigle, A. Grenz, S. Laucher, L. F. Thompson, and H. K. Eltzschig
A2B adenosine receptor dampens hypoxia-induced vascular leak
Blood, February 15, 2008; 111(4): 2024 - 2035.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. De Ponti, R. Carini, E. Alchera, M. P. Nitti, M. Locati, E. Albano, G. Cairo, and L. Tacchini
Adenosine A2a receptor-mediated, normoxic induction of HIF-1 through PKC and PI-3K-dependent pathways in macrophages
J. Leukoc. Biol., August 1, 2007; 82(2): 392 - 402.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. Rosenberger, J. Khoury, T. Kong, T. Weissmuller, A. M. Robinson, and S. P. Colgan
Identification of vasodilator-stimulated phosphoprotein (VASP) as an HIF-regulated tissue permeability factor during hypoxia
FASEB J, August 1, 2007; 21(10): 2613 - 2621.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Eckle, L. Fullbier, M. Wehrmann, J. Khoury, M. Mittelbronn, J. Ibla, P. Rosenberger, and H. K. Eltzschig
Identification of Ectonucleotidases CD39 and CD73 in Innate Protection during Acute Lung Injury
J. Immunol., June 15, 2007; 178(12): 8127 - 8137.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Loffler, J. C. Morote-Garcia, S. A. Eltzschig, I. R. Coe, and H. K. Eltzschig
Physiological Roles of Vascular Nucleoside Transporters
Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 1004 - 1013.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Eckle, T. Krahn, A. Grenz, D. Kohler, M. Mittelbronn, C. Ledent, M. A. Jacobson, H. Osswald, L. F. Thompson, K. Unertl, et al.
Cardioprotection by Ecto-5'-Nucleotidase (CD73) and A2B Adenosine Receptors
Circulation, March 27, 2007; 115(12): 1581 - 1590.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, T.
Right arrow Articles by Colgan, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, T.
Right arrow Articles by Colgan, S. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS