|
|
||||||||




,
,1
* Center for Experimental Therapeutics,
Department of Anesthesiology, Brigham and Womens Hospital, Harvard Medical School, Boston, Massachusetts, USA;
Department of Anesthesiology and Intensive Care Medicine, Tübingen University Hospital, Tübingen, Germany; and
Mucosal Inflammation Program, University of Colorado Health Sciences Center, Denver, Colorado USA
1Correspondence: Mucosal Inflammation Program, University of Colorado Health Sciences Center, BRB702, Denver, CO 80262, USA; E-mail: sean.colgan{at}uchsc.edu
| ABSTRACT |
|---|
|
|
|---|
DNA binding and HIF-1
gain and loss of function confirmed strong dependence of A2BR induction by HIF-1
in vitro and in vivo mouse models. Additional studies in endothelia overexpressing full-length A2BR revealed functional phenotypes of increased barrier function and enhanced angiogenesis. Taken together, these results demonstrate transcriptional coordination of A2BR by HIF-1
and amplified adenosine signaling during hypoxia. These findings may provide an important link between hypoxia and metabolic conditions associated with inflammation and angiogenesis.Kong, T., Westerman, K. A., Faigle, M., Eltzschig, H. K., Colgan, S. P. HIF-dependent induction of adenosine A2B receptor in hypoxia.
Key Words: hypoxia-inducible factor endothelium chromatin angiogenesis
| INTRODUCTION |
|---|
|
|
|---|
Recent studies have suggested that Ado receptors (AdoR) are tightly regulated and that functional aspects of Ado responses may be determined by surface AdoR expression profiles (8)
. As an example, microarray analyses of cDNA derived from endothelial cells subjected to various periods of hypoxia revealed significant changes in the AdoR profile, wherein the prominent phenotypic change favored A2BR expression, with concomitant down-regulation of AdoA1R and AdoA3R (8)
. Much recent attention has been focused on A2BR, whereby therapeutics have been implicated in asthma (10)
and an A2BR single nucleotide polymorphism has been associated with cystic fibrosis (11)
.
In the present study, we sought to gain molecular insight into hypoxia-controlled A2BR expression and function. For these purposes, endothelial and epithelial models were utilized to define these principles. Studies of the cloned A2BR promoter revealed a prominent role for HIF-1
, and functional studies identified HIF-1
-regulated A2BR expression as an important link to barrier function and angiogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning of A2B promoter
A2B promoter (1087 bp) was isolated from Hela cell genomic DNA using standard PCR with Pfu DNA polymerase (forward: 5'-AGGCTCAGGGTGTCGGCAAAC 3', reverse: 5'- CTA CCGAAGGCGCGCCGGG 3'), and then was cloned into PGL-3 basic luciferase expression vector (Promega, Madison, WI, USA). Homology to published sequence was determined by sequencing through the Brigham and Womens Hospital Genomics core sequencing facility (the complete sequence was deposited in Genbank with accession DQ435607). Individual deletion/truncation of promoter constructs were generated by use of PCR with different primer sets (467 bp, forward: 5'-TGGAGAACAGCGCTGAGCCTC-3', reverse: 5'-CCACTCGCCCGAGCCCAAAG-3'; 685 bp, forward: 5'- TGGAGAACAGCGCTGAGCCTC 3', reverse: 5'-CTACCGAAGGCGCGCCGGG-3'; 891 bp, forward: AGG CTCAGGGTGTCGGCAAAC-3', reverse: 5'-CCACTCGCCCGAGCCCAAAG-3'). All of the deleted mutants were cloned into PGL-3 basic luciferase expression vector.
Reporter assays were performed using HMEC cells transfected with the indicated promoter constructs and exposed to normoxia or hypoxia as described previously (39)
. All activity was normalized with respect to a constitutive expressed Renilla reporter. Where indicated, mutations were performed as described previously (39)
. For the mutation of the HIF site, the original sequence ACGTG was altered into AATCG.
Isolation of A2BR cDNA and generation of stable cells
The full-length A2B cDNA (995 bp) was cloned from HMEC-1 cell RNA by use of RT-polymerase chain reaction (RT-PCR) with primers, forward: 5'-GCCACCATGCTGCTGGAGACACAGGAC-3', reverse: 5'-TCACTTGTCATCGTCATCCTTGTAATCGCCCCCGCCTAGGCCCACACCGAGAGCAG-3'. The cDNA with Flag epitope at 3' end was cloned into pcDNA3.1-zeo (Invitrogen). Homology to published sequence was determined by sequencing through the Brigham and Womens Hospital Genomics core sequencing facility. The plasmid was transfected into HMEC-1 cells using FuGENE 6 (Roche Biochemicals). The stable cells were selected with 30 µg/ml of zeocin (Invitrogen) for 6 wk. The stable clones were verified by use of Western blotting through use of anti-Flag polyclonal antibody (pAb) (Sigma). The vector-transfected cells were used for negative control.
Chromatin immunoprecipitation (CHIP) assay
Chromatin immunoprecipitation was performed as described previously (40)
. HIF binding to A2B promoter DNA was quantified by standard PCR using primers (forward:5'-ACCAACTACTTCCTGGTGTCC-3' and reverse: 5'-GCAGCTTTCATTCGTGGTTCC-3') designed to amplify a 374 bp region of the A2B promoter. Chromatin incubated with beads mouse IgG were used to control for nonspecific binding of DNA.
Lentiviral vector design, production and transduction in HMEC-1
The HIV-1 lentiviral vector used was based on a vector previously described in detail (41)
. In short, the
ODD variant of HIF-1alpha (containing a proline
alanine substitution at position 564) (20)
was cloned into the Bam H1/ClaI sites of the lentiviral vector. Virus was produced and stable cell lines were generated as described before (27)
.
Stable repression of HIF-1
by siRNA
With the help of the siRNA Wizard (http://www.sirnawizard.com) a sequence was chosen within the coding region of the gene of interest. The chosen hairpin primer with the sequence 5'-ACCTCGCTGACCAGTTATGATTGTGATCAAGAGTCACAATCATAACTGGTCAGCTT-3' and 5'-CAAAAAGCTGACCAGTTATGATTGTGACTCTTGATCACAATCATAAC-TGGTCAGCG-3'correspond to position 26662685 of the hif1a gene. Primers were annealed for 2 min at 80°C to create the hairpin structure and ligated into the Bbs1/Bbs1 digested psiRNA-hH1neo G2 vector. After transformation using the Lyocomp GT116 E. coli strain, cells were spread on a Kan Xgal agar plate with the advantage of white/blue selection. A recombinant white clone was grown, DNA was extracted and HMEC-1 cells were transfected using electroporation procedure. Two days after transfection, cells were selected with G418 (1 mg/ml) and stable transfectants were individualized after 23 wk. The control cell line was transfected with empty psiRNA-hH1 neoscr plasmid.
Murine models
In subsets of experiments, colonic mucosal scrapings (enriched in epithelial cells) were obtained from 68 wk old C57/BL6 mice subjected to TNBS-induced colitis (22)
or from 68 wk old conditional Hif1
mutant mice or littermate controls, as described before (22)
. Scrapings were homogenized in RNAlater (Qiagen) using a 22-gauge syringe (Becton Dickinson) and Qiashredder column (Qiagen). RNA extraction, including DNase digestion was performed using the RNeasy kit (Qiagen). Reverse-transcription was done using the iScript cDNA Synthesis Kit (Bio-Rad). RT-PCR analysis was performed using the gene-specific primers for murine A2BR (forward 5-GCTGTCCTGAGCCCGACACT-3' and reverse 5'-CAAGCTGATGGTGATGGCAAAG-3) and murine ß-actin forward: 5'-CTAGGCACCAGGGTGTGAT-3' and reverse: 5'-TGCCAGATCTTCTCCATGTC-3'. These protocols were in accordance with NIH guidelines for use of live animals and were approved by the Institutional Animal Care and Use Committee at Brigham and Womens Hospital.
Paracellular permeability assays
Permeability assays to 70 kDa FITC-dextran and calculations of flux rates were performed exactly as described previously (23)
.
Endothelial tube formation assay
Wells on 24-well plates were coated with 100 µl Matrigel (Becton Dickenson) according to manufacturers recommendation. HMEC-1 vector control and A2B stable cells were seeded at a density of 5 x 104 cells/well and exposed to normoxia or hypoxia (6 or 18 h as indicated) in the presence of the A2BR antagonist MRS1754 (Sigma, final concentration 40 nM) or an equivalent dilution of DMSO vehicle. Tube formation was inspected at 6 and 18 h under phase-contrast light (Nikon Eclipse E600) microscope equipped with a digital camera. Tube length was quantified from digitized pictures as described elsewhere (42)
.
Data analysis
Data were compared by two-factor ANOVA or by Students t test where appropriate. Values are expressed as the mean ± SEM from at least three separate experiments.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
Other studies were performed to define if A2BR induction by hypoxia required transcription. To do this, HMEC-1 cells were subjected to normoxia or hypoxia (12 h) in the presence or absence of the transcriptional inhibitor 5,6-dichlorobenzimidazole riboside (DRB, 3 µM final concentration) and assessed for changes in A2BR expression by real-time PCR. Preincubation of HMEC-1 cells with DRB inhibited the hypoxia-dependent induction of A2BR by 79 ± 8.1% (data not shown). Consequently, hypoxia-mediated induction of A2BR requires transcriptional activity.
Cloning and studies of the A2BR promoter
In view of the likelihood of a transcription-mediated induction of A2BR during hypoxia, attention was directed at the 5'-region of the A2BR gene for potential hypoxia regulated transcription factor sequences. Available public databases (17)
and analysis of full-length cDNA [Genbank Accession NM_000676 (18)
] identified the transcription start site of A2BR at position 333 relative to the first codon (ATG, see Fig. 2
A). Based on these reports, we cloned genomic fragments extending from positions 784 to +303 (termed A2b-1087), from 813 to +78 (termed A2b-891), from 382 to +303 (termed A2b-685) and from 389 to +78 (termed A2b-467) into pGL3 luciferase reporter vector and examined transcriptional activity following transient transfection in HMEC-1 cells. This analysis revealed a minimal contribution of the 5' region extending beyond position 382, with an approximate 35% loss of promoter activity (see Fig. 2A
). In addition, this analysis revealed no significant contribution of sequence extending 3' beyond the transcription start site (P =not significant), including at least one Sp1 binding site (see Fig. 2A
).
|
We next utilized these four promoter constructs to examine whether hypoxia regulates A2BR promoter activity. As shown in Fig. 2B
, analysis of luciferase reporter activity revealed that in constructs containing the 5' promoter region spanning positions 1107 to 355 hypoxia induced A2BR promoter activity by 5.3 ± 1.1 and 6.3 ± 0.9 for constructs A2b-891 and A2b-1087, respectively (both P<0.01). Truncation of the 5' region extending beyond position 382 (constructs A2b-467 and A2b-685) resulted in a complete loss of hypoxia-inducibility (Fig. 2B
, P=not significant), thereby implicating the region spanning positions 382 to 784 for hypoxia inducibility.
Role of HIF-1 in hypoxia-inducible A2BR
Analysis of our cloned region of A2BR revealed the existence of a potential binding site for HIF-1
(core sequence 5'-CACGTGG-3') at position 561 to 555 relative to the transcription start site and a HIF-1 ancillary sequence (5'-CGGGAG-3') (18)
located 9 base pairs in the 3' direction (nucleotides 546 to 541, (Fig. 3
A). Based on these findings, and known endothelial expression of HIF-1
(19)
, we determined whether HIF-1
would bind the A2BR promoter. For these purposes, we utilized ChIP analysis to examine binding of HIF-1
to the A2BR promoter spanning the putative HIF-1
binding site in intact cells. As shown in Fig. 3B
, this analysis revealed a prominent band of 374 bp in nuclei derived from hypoxic, but not normoxic cells. No bands were evident in the beads-only control, and preimmunoprecipitation samples revealed equivalent DNA input.
|
To rule out the possibility that the loss of hypoxia inducibility with truncations at the 5' end of the A2BR promoter simply reflect the deletion of a large DNA segment (see Fig. 2A
), a HIF-1
binding site mutation was introduced in the hypoxia inducible full-length promoter construct (A2b-1087, see Fig. 2
), and as shown in Fig. 3C
a three nucleotide mutation (A2b-1087
HIF consensus motif 5'-CACGTGG-3' mutated to 5'- CAATCGG 3' within HIF-1 site) resulted in a 69 ± 5% decrease in luciferase activity under hypoxic conditions (P<0.01). HMEC-1 cells were then transfected with wild-type (WT) and A2BR-1087
HIF and exposed to hypoxia. These results demonstrate that disruption of the HIF-1
binding site largely obliterates the A2BR inducible response to hypoxia.
To further probe the role of HIF-1
in A2BR regulation in hypoxia, we generated a HMEC-1 line expressing oxygen-stable HIF-1
(HMEC
ODD) (20)
via lentiviral transduction (Fig. 4
). As shown in Fig. 4A
, using this lentiviral vector expressing GFP, greater than 90% of HMEC-1 were stably transduced by this method. Analysis of the HMEC
ODD by Western blot (Fig. 4B
) and by HRE luciferase (Fig. 4C
) revealed increased HIF function and activity during both normoxia and hypoxia, relative to the control HMEC-GFP cell line. The further increase of HIF function and activity with hypoxia most likely reflects the combination of oxygen-stable and oxygen-unstable HIF-1
. Using the HMEC
ODD cell line, we addressed whether AdoA2BR expression was differentially regulated. As shown in Fig. 4D
, AdoA2B mRNA expression in normoxia was increased by >80% in the HMEC
ODD relative to the control HMEC-GFP cell line (P<0.01). Likewise, enhanced expression of AdoA2B was observed in HMEC-1
ODD compared with control HMEC-GFP cells at 6, and 18 h hypoxia (P<0.025 for each). Such findings support the hypothesis that AdoA2B induction in hypoxia is proportional to HIF-1
activity.
|
We next examined the influence of targeted HIF-1
repression on A2BR expression. For these purposes, we generated a stable HMEC-1 cell line expressing shRNA directed against HIF-1
. As shown in Fig. 5A, the designed shRNA repressed HIF-1
protein by >80% on exposure of HMEC-1 to hypoxia. Control shRNA did not influence HIF-1
expression compared with control HMEC-1 cells (data not shown). Examination of A2BR expression in this cell line revealed no significant induction of A2BR by hypoxia in cells HIF-1
repressed HMEC-1 (P=not significant by ANOVA, see Fig. 5B
) but significant hypoxia-inducible A2BR expression in the control cell line (P<0.025 by ANOVA, Fig. 5B
). Such results strongly implicate HIF-1
in hypoxia-inducible A2BR.
|
A2BR regulation by HIF-1
in vivo
In the course of these experiments it was revealed that A2BR expression was hypoxia-inducible in epithelial cells, similar to that of endothelial cells (Fig. 5)
. Indeed, examination of A2BR expression in T84 intestinal epithelial cells, a cell line known to express A2BR (21)
, revealed prominent hypoxia inducibility at the mRNA level (Fig. 5C
). We extended these findings in epithelial cells to examine HIF-1
-dependent regulation of A2BR in murine models. As shown in Fig. 5D
, colonic epithelial cells derived from mice subjected conditions know activate HIF-1
(colitis) (22)
revealed prominent induction of A2BR mRNA, thereby serving as a functional correlate for HIF-dependent induction of A2BR in vivo.
To directly examine the role of HIF-1
in A2BR expression in vivo, we extended these findings into a genetic in vivo model. Here, we examined A2BR mRNA levels in intestinal epithelia derived from conditional hif1a knockout mice, a mouse line in which intestinal epithelia from these mice lack detectable HIF-1
expression in >70% of cells (22)
. As show in Fig. 5E
, and consistent with our hypothesis that HIF-1
transcriptionally induces A2BR, PCR analysis revealed a prominent decrease in intestinal epithelial A2BR expression in hif1
mutant animals (65±12% decrease by densitometry, P<0.025). Taken together, such findings support our in vitro findings and indicate the likelihood that HIF-1
directly regulates murine A2BR expression.
Functional sequellae of A2BR in endothelial cells overexpressing A2BR
To gain insight into functional sequellae of increased A2BR expression in endothelia, we generated an HMEC-1 line stably overexpressing epitope-tagged, full-length A2BR (termed A2b-Flag). As shown in Fig. 6A, PCR analysis revealed that A2b-Flag HMEC-1 significantly overexpress A2BR (by densitometry 7.2±1.5-fold increase over vector controls, P<0.01). This expression pattern was specific for A2BR, inasmuch as no differences were observed in expression of other AdoR (e.g., see AdoA1R in Fig 6A
). Analysis of epitope-tagged A2BR-Flag by Western blot using anti-Flag polyclonal antibody (Ab) revealed a prominent band at the appropriate molecular mass in A2b-Flag (Fig. 6B
), but not in vector controls.
|
We utilized A2b-Flag cells to study the role of A2BR overexpression in endothelial cells. For these purposes, we examined two well-established functions attributable to Ado signaling, namely endothelial tube formation in Matrigel substrates (15)
and barrier function (8
, 23)
. To address endothelial tube formation, A2b-Flag and HMEC-Vector control cells were plated on Matrigel and exposed to either normoxia or hypoxia in the presence and absence of the selective A2BR antagonist MRS1754 (24)
. As depicted in Fig. 6C
, exposure of HMEC-Vector cells to hypoxia (6 or 18 h) resulted in significant tube formation, as revealed by the organization of cultured cells into linear clusters of tubes. Quantitation of such tube formation by measurement of tube length revealed a hypoxia time-dependent increase in tube length (by ANOVA, P<0.01). Such tube formation was nearly abolished by the addition of MRS1754 (by comparison to vehicle controls, P<0.001). By contrast, A2b-Flag endothelial cells exposed to similar conditions revealed a much more prominent increase in tube formation in normoxia (P<0.001 when compared to HMEC-vector cells), suggesting that directed overexpression of A2BR drives endothelial tube formation. Like that in control cells, hypoxia increased tube formation in A2b-Flag cells (by ANOVA, P<0.05), and was inhibited by addition of MRS1754 (P<0.001). These observations extend previous work indicating that hypoxia is associated with A2BR induction, and that such induction drives angiogenic responses (15
, 25)
.
Previous studies have implicated the A2BR in barrier resealing following neutrophil transmigration, and that such functional responses can be recapitulated with native Ado (23)
. As shown in Fig. 6D
, Ado-triggered increases in endothelial barrier function (i.e., decreased paracellular permeability) were significantly more pronounced in A2b-Flag HMEC relative to either WT HMEC-1 (by ANOVA, P<0.025) or A2b-Vector cells (by ANOVA, P<0.025). Consistent with previous studies (8)
, such findings of increased barrier function were inhibited by >85% by addition of MRS1754 (data not shown), thereby strongly implicating increased A2BR in barrier protection during hypoxia.
These new findings contribute significantly to current understanding of Ado signaling in hypoxia. In this regard, multiple lines of evidence now significantly implicate HIF in metabolism of adenine nucleotides to Ado as well as amplification of signaling through the A2BR. First, the terminal enzyme in the generation of extracellular Ado (CD73) is induced by hypoxia in a HIF-dependent manner (9
, 22)
, and studies in cd73/ mice have revealed an important role for CD73 in vascular adaptation to hypoxia (26)
. Second, clearance mechanisms of Ado, such as those involving equilibrative nucleoside transporters (ENT), are repressed during hypoxia through HIF-1-dependent mechanisms, thereby lengthening the apparent half-life of extracellular Ado (27)
. Third, the present studies support a prominent role for HIF-1-regulated A2BR as a mechanism to amplify Ado signaling under such circumstances. HIF-1-dependence was shown at the A2BR promoter level, through direct mutagenesis of the HIF-1
binding site, by DNA binding of HIF-1
in vivo and by loss and gain of HIF-1
function in endothelial cells. Additional studies in intestinal epithelial cells, which express readily demonstrable A2BR (21
, 28)
, identified a role for HIF-1
in vivo. Indeed, conditional deletion of hif1a in colonic epithelial cells (22)
revealed attenuated A2BR expression, thereby genetically confirming our original hypothesis that HIF-1
is central to regulation of A2BR regulation by hypoxia. Notably, these studies in vivo also revealed that A2BR is induced in epithelia derived from a murine colitis model. Such findings support previous work in humans and murine models identifying a prominent hypoxia response, with concomitant HIF activation, at the level of the epithelium in inflammatory bowel diseases (22
, 29)
. In this regard, recent work revealed that the selective A2AR agonist ATL-146e attenuates intestinal inflammation associated with murine colitis models (30)
, thereby suggesting that adenosine receptors may be interesting targets for colitis.
Notable is the observation that overexpression of A2BR promotes an angiogenic phenotype, as measured by endothelial tube formation. Both hypoxia and overexpression of A2BR enhanced the kinetics of this response, and this response was nearly completely abolished by addition of MRS1754. Such observations are consistent with A2BR-dependent regulation of vascular endothelial growth factor (VEGF) (15
, 25)
, and as inferred from recent work profiling of various tumor types, A2BR was consistently overexpressed in a number of tumors (3)
. Given that HIF is commonly overexpressed in a number of tumors (31)
, this A2BR-dependent angiogenic response may contribute to tumor progression. Also notable is significant previous work implicating A2AR in angiogenic factor regulation and functional angiogenesis in vitro, in vivo, and on various cell types (e.g., endothelial cells and macrophages) (32
33
34
35
36)
. Our studies in HMEC-1 nicely correlate with adenosine receptor profiles in other endothelial cells (e.g., human umbilical vein endothelia) (37)
, an while we did not observe a significant regulation of A2AR in hypoxia in HMEC-1, A2AR are present and widely expressed on various vascular bed endothelial cells, and therefore could likely contribute to our findings here.
| ACKNOWLEDGMENTS |
|---|
Received for publication April 26, 2006. Accepted for publication June 19, 2006.
| REFERENCES |
|---|
|
|
|---|
is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc. Nat. Acad. Sci. (U. S. A.) 95,7987-7992This article has been cited by other articles:
![]() |
A. Ahmad, S. Ahmad, L. Glover, S. M. Miller, J. M. Shannon, X. Guo, W. A. Franklin, J. P. Bridges, J. B. Schaack, S. P. Colgan, et al. Adenosine A2A receptor is a unique angiogenic target of HIF-2{alpha} in pulmonary endothelial cells PNAS, June 30, 2009; 106(26): 10684 - 10689. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Frick, C. F. MacManus, M. Scully, L. E. Glover, H. K. Eltzschig, and S. P. Colgan Contribution of Adenosine A2B Receptors to Inflammatory Parameters of Experimental Colitis J. Immunol., April 15, 2009; 182(8): 4957 - 4964. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Hart, B. Jacobi, J. Schittenhelm, M. Henn, and H. K. Eltzschig Cutting Edge: A2B Adenosine Receptor Signaling Provides Potent Protection during Intestinal Ischemia/Reperfusion Injury J. Immunol., April 1, 2009; 182(7): 3965 - 3968. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Sitkovsky, J. Kjaergaard, D. Lukashev, and A. Ohta Hypoxia-Adenosinergic Immunosuppression: Tumor Protection by T Regulatory Cells and Cancerous Tissue Hypoxia Clin. Cancer Res., October 1, 2008; 14(19): 5947 - 5952. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eckle, D. Kohler, R. Lehmann, K. C. El Kasmi, and H. K. Eltzschig Hypoxia-Inducible Factor-1 Is Central to Cardioprotection: A New Paradigm for Ischemic Preconditioning Circulation, July 8, 2008; 118(2): 166 - 175. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Morote-Garcia, P. Rosenberger, J. Kuhlicke, and H. K. Eltzschig HIF-1-dependent repression of adenosine kinase attenuates hypoxia-induced vascular leak Blood, June 15, 2008; 111(12): 5571 - 5580. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eckle, M. Faigle, A. Grenz, S. Laucher, L. F. Thompson, and H. K. Eltzschig A2B adenosine receptor dampens hypoxia-induced vascular leak Blood, February 15, 2008; 111(4): 2024 - 2035. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. De Ponti, R. Carini, E. Alchera, M. P. Nitti, M. Locati, E. Albano, G. Cairo, and L. Tacchini Adenosine A2a receptor-mediated, normoxic induction of HIF-1 through PKC and PI-3K-dependent pathways in macrophages J. Leukoc. Biol., August 1, 2007; 82(2): 392 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rosenberger, J. Khoury, T. Kong, T. Weissmuller, A. M. Robinson, and S. P. Colgan Identification of vasodilator-stimulated phosphoprotein (VASP) as an HIF-regulated tissue permeability factor during hypoxia FASEB J, August 1, 2007; 21(10): 2613 - 2621. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eckle, L. Fullbier, M. Wehrmann, J. Khoury, M. Mittelbronn, J. Ibla, P. Rosenberger, and H. K. Eltzschig Identification of Ectonucleotidases CD39 and CD73 in Innate Protection during Acute Lung Injury J. Immunol., June 15, 2007; 178(12): 8127 - 8137. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Loffler, J. C. Morote-Garcia, S. A. Eltzschig, I. R. Coe, and H. K. Eltzschig Physiological Roles of Vascular Nucleoside Transporters Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 1004 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Eckle, T. Krahn, A. Grenz, D. Kohler, M. Mittelbronn, C. Ledent, M. A. Jacobson, H. Osswald, L. F. Thompson, K. Unertl, et al. Cardioprotection by Ecto-5'-Nucleotidase (CD73) and A2B Adenosine Receptors Circulation, March 27, 2007; 115(12): 1581 - 1590. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |