FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.06-5668fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-5668fjev1
20/12/2156    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Lee, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Lee, P. J.
(The FASEB Journal. 2006;20:2156-2158.)
© 2006 FASEB

Endothelial STAT3 is essential for the protective effects of HO-1 in oxidant-induced lung injury

Xuchen Zhang*, Peiying Shan*, Ge Jiang*, Samuel S-M. Zhang§, Leo E. Otterbein{ddagger}, Xin-Yuan Fu{dagger} and Patty J. Lee*,1

* Section of Pulmonary and Critical Care Medicine,

{dagger} Department of Ophthalmology and Visual Science, Yale University School of Medicine, New Haven, Connecticut, USA;

{ddagger} Department of Surgery, Beth Israel Deaconess Medical Center, Harvard University Medical School, Boston, Massachusetts, USA; and the

§ Microbiology and Immunology Department, Indiana University, Indianapolis, Indiana, USA

1Correspondence: Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, P.O. Box 208057, New Haven, CT 06520-8057, USA. E-mail: patty.lee{at}yale.edu

ABSTRACT

Administering high levels of inspired oxygen, or hyperoxia, is commonly used as a life-sustaining measure in critically ill patients. Unfortunately, the oxidant stress generated by prolonged hyperoxia can lead to respiratory failure, multiorgan failure, and death. Although the endothelial cell is known to be a target for hyperoxia-induced injury, its precise role is unclear. Heme oxygenase-1 (HO-1) and "signal transducer and activator of transcription 3" (STAT3) have been found to confer protection against endothelial cell injury. We sought to elucidate the specific roles of HO-1 and STAT3 in hyperoxic lung and endothelial cell injury. Mice or murine lung endothelial cells (MLEC) administered HO-1 siRNA exhibited marked injury and death compared with nonspecific siRNA. Overexpression of either HO-1 or STAT3 confers protection. However, HO-1 and its reaction product carbon monoxide (CO) lose their protective effects in the presence of STAT3 siRNA in MLEC or in endothelial-specific, STAT3-deficient mice. STAT3 overexpression is able to partially rescue HO-1-deficient MLEC from hyperoxia-induced cell death. Our results demonstrate 1) the importance of the endothelium in lethal hyperoxic injury, 2) HO-1 and CO require endothelial STAT3 for their protective effects, and 3) STAT3 confers endothelial cell protection via both HO-1-dependent and independent mechanisms.—Zhang, X., Shan, P., Jiang, G., Zhang, S. S-M., Otterbein, L. E., Fu, X-Y., Lee, P. J. Endothelial STAT3 is essential for the protective effects of HO-1 in oxidant-induced lung injury.


Key Words: signal transduction • oxygen

OXYGEN THERAPY IS a necessary and life-saving component in the treatment of critically ill patients, but prolonged oxygen therapy has been shown to exacerbate respiratory failure and lead to increased mortality (1) . Recently, levels of inspired oxygen previously considered safe in patients have been found to exacerbate lung injury, making the study of protective mechanisms during hyperoxia imperative (2) . Hyperoxia leads to the accumulation of reactive oxidants that initiate endothelial and epithelial cell injury, increase pulmonary capillary permeability, inflammation, and respiratory failure.

We and others have demonstrated that heme oxygenase-1 (HO-1) and its reaction products confer protection against a variety of injuries (3) . HO is the rate-limiting enzyme that degrades heme into bilirubin, free iron, and carbon monoxide. Three isoforms of HO exist: HO-2 and -3 are constitutively expressed, and HO-1 is the inducible isoform that is regulated primarily at the level of gene transcription (4) . STAT proteins (signal transducer and activator of transcription) comprise a family of seven related polypeptides that participate in signaling pathways mediating a wide variety of cellular and organ responses to cytokines and growth factors (5) . STAT3 has been shown to mediate HO-1 induction by interleukin 10 (IL-10) and IL-6 (6 , 7) . Our laboratory has shown that STATs are involved in HO-1 gene activation during hyperoxia (8) . The signaling mechanisms whereby HO-1 exerts its protective effects are unclear. Despite evidence for the protective roles of HO-1 and STAT3 during hyperoxia, nothing is known about the functional links between STAT3 and HO-1. Even though the importance of epithelial STAT3 in hyperoxia has been examined, the role of the endothelium remains poorly defined. This is surprising given that early studies revealed that lung endothelium is a primary target of hyperoxic injury with pathological changes that precede that of the epithelium (1 , 9) . A dreaded consequence of acute respiratory failure is multiorgan failure, in which specific therapies do not exist and mortality exceeds 70%. Recent clinical evidence has emerged that endothelial protective strategies can prevent multiorgan failure and death (10) .

We sought to address the role of endothelial STAT3 in hyperoxia as well as in mediating the cytoprotective effects of the stress response protein HO-1. We first demonstrated the beneficial effects of exogenous HO-1 and the deleterious effects of HO-1 siRNA in vivo and in murine lung endothelial cells (MLEC) during hyperoxia. We then examined the ability of exogenous HO-1 to rescue endothelial cell-specific STAT3–/– mice (STAT3E–/–) and MLEC transfected with STAT3 siRNA from hyperoxia-induced injury and death. Our results show that in the absence of endothelial STAT3, HO-1, and its reaction product carbon monoxide (CO) lose their ability to protect against hyperoxic injury and death. However, STAT3 overexpression can partially rescue HO-1-deficient MLEC from hyperoxia, indicating that STAT3 mediates protection via both HO-1-dependent and independent mechanisms. Potential mechanistic explanations include the dependence of HO-1-derived carbon monoxide on STAT3 to exert an antiapoptotic effect as well as the ability of HO-1 to up-regulate survival proteins such as phospho-Akt, Bcl-2, and Bcl-xL in endothelial cells. Furthermore, our data indicate that a positive feedback system exists in which STAT3 activation increases HO-1 expression, and vice versa. The presence of this feedback system likely ensures optimal activation of two important protective pathways mediated by HO-1 and STAT3.

MATERIALS AND METHODS

Isolation of primary MLEC and hyperoxia exposures
Murine lung endothelial cells (MLEC) from wild-type (WT), HO-1–/–, and STAT3E–/– mice were isolated with a modification of the methods (see Supplemental materials) described by Kuhlencordt et al. (11) . Briefly, lungs were extracted, minced, and digested for 1 h at 37°C with 0.1% collagenase (Roche, Nutley, NJ, USA) in RPMI 1640 with 100 U/ml penicillin G, and 100 µg/ml streptomycin. The digest was passed through a 100 µm cell strainer to remove undigested tissue fragments. Cells were pelleted at 200 g for 5 min, resuspended in MLEC medium containing 20% FBS, 40% Dulbecco’s modified Eagle medium (DMEM), 40% F-12 with 100 U/ml penicillin G and 100 µg/ml streptomycin, then plated onto 0.1% gelatin-coated T75 flasks. Cells were washed after 24 h and cultured for 2–4 days. Cells were trypsinized with 2 ml trypsin/EDTA, PBS was added, and spun for 5 min at 200 g to remove the supernatant. Cells were resuspended in 2% FBS containing 10 µl biotin-labeled rat anti-mouse CD31 (PECAM-1) antibody (Ab) (BD PharMingen, San Diego, CA, USA). After incubation on ice for 30 min, the cells were washed with streptavidin magnetic beads (New England Biolabs, Ipswich, MA, USA). Cells were washed with 2% FBS, resuspended in 5 ml of 2% FBS, and incubated on ice for 30 min. The cells were then placed on the magnet for 5 min and unbound cells were removed; bound cells were resuspended in medium and plated onto a 0.1% gelatin-coated T25 flask. We confirmed with CD31 staining and flow cytometry that >95% of the cells were endothelial cells. Cells were maintained in 40% DMEM and 40% F12 tissue culture medium (TCM) supplemented with 20% FBS. Hyperoxic conditions have been described (12) .

Animal hyperoxia exposures
Adult 6- to 8-wk-old C57BL/6J mice were obtained from Jackson Laboratories (Bar Harbor, ME, USA). Conditional endothelial-targeted STAT3-deficient mice (STAT3E–/–) and their WT littermate controls have been described (13) . Mice were exposed to 100% O2 in a Plexiglass exposure chamber and permitted food and water ad libitum. Control mice were exposed to room air. To measure markers of lung injury, separate groups of mice were removed from the chamber after 72 h of hyperoxia (O2) exposure and sacrificed after anesthesia. Lung specimens were obtained for histology, RNA and protein extraction, apoptosis, and immunohistochemistry analyses. All protocols were reviewed and approved by the Animal Care and Use Committee at Yale University.

Measurement of lung injury markers
Mice were removed from the exposure chamber and killed after 72 h O2. Bronchoalveolar lavage (BAL) was performed twice with 1 ml PBS (pH 7.4). Cell pellets were pooled, resuspended in PBS, and counted. The supernatant was used for BAL protein determination. The protein concentration in each sample was determined by the bicinchoninic acid protein assay (Pierce, Rockford, IL, USA) using BSA as the standard.

siRNA design and preparation
HO-1 siRNAs were synthesized in 2'-deprotected, duplexed, desalted, and purified form by Dharmacon, Inc. (Lafayette, CO, USA) and have been described as sequences 4 and 5 (14) . The sense and antisense strands of mouse HO-1 siRNA were sequence 1: sense: 5'-GCCGAGAAUGCUGAGUUCA-3', antisense: 5'-UGAACUCAGCAUUCUCGGC-3'; sequence 2: sense: 5'-GCCACACAGCACUAUGUAA-3', antisense: 5'-UUACAUAGUGCUGUGUGGC-3'. The sense and antisense strands of mouse STAT3 siRNA were: sense: 5'-ACAUGGAGGAGUCUAACAA-3', antisense: 5'-UUGUUAGACUCCUCCAUGU-3'; Nonspecific siRNA scrambled duplex (sense: 5'-GCGCGCUUUGUAGGAUUCG-3', antisense: 5'-CGAAUCCUACAAAGCGCGC-3') were also synthesized by Dharmacon, Inc.

Delivery of siRNA duplexes in vitro and in vivo
MLEC were seeded into 6- or 12-well plates 1 day before transfection using 40% DMEM and 40% F12 TCM supplemented with 20% FBS, without antibiotics. At the time of transfection with HO-1 or STAT3 siRNA, the cells were 50–60% confluent. Oligofectamine Reagent (Invitrogen, Carlsbad, CA, USA) was used as the transfection agent, then cells were incubated for 6 h. Next, FBS was added to reach a final concentration of 20% FBS in the wells. For in vivo studies, each mouse was anesthetized with methoxyflurane, then given intranasal, unmodified HO-1 siRNA (2 mg/kg body wt) or equivalent doses of nonspecific control siRNA duplex in a volume of 50 µl, as described previously (14) . Intranasal HO-1 siRNA was given 16 h before hyperoxia, on the day of hyperoxia, and 24 h after initiation of hyperoxia.

Generation of stable MLEC cell line overexpressing human HO-1. The human HO-1-expressing replication-deficient retrovirus vector LSN-HHO-1 has been described (15 , 14) . PA317 cells were infected with LSN-HHO-1 or the empty viral control cells, LXSN, grown to subconfluence, and the supernatants were used to infect MLEC. Stably transfected MLEC were selected with G418 treatment.

Overexpression of STAT3 and HO-1 in MLEC
A replication-deficient adenoviral vector encoding STAT3-C (constitutively active form of STAT3, AxCAS3-C) was provided by Dr. Kaikobad Irani (Johns Hopkins University) and has been described (16) . Ad-HO-1 has been described (17) . Ad-null, an adenovirus empty vector, was used as a control. Ad-null, Ad-HO-1, or AxCAS3-C were transfected at 2.5 MOI (multiplicity of infection: the average number of phage particles that infect a single cell) 48 h before hyperoxia exposure.

Apoptosis assays
Terminal deoxynucleotidyltransferase dUTP nick end-labeling (TUNEL) and flow cytometry assays were used as described (14) .

Western blot analysis
Protein was extracted from cell or lung tissue lysates, electrotransferred, then immunoblotted with monoclonal HO-1 Ab (StressGen, San Diego, CA, USA), rabbit phospho-STAT3 Ab or STAT3 Ab (Cell Signaling, Danvers, MA, USA), rabbit-Bcl-2, mouse-Bcl-xL, rabbit-Bad, rabbit-Bax, and rabbit caspase 3 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Detection was performed with Phototope-HRP Western detection system (Cell Signaling). Equivalent sample loading was confirmed by stripping membranes with Blot Restore Membrane rejuvenation solution (Chemicon, El Segundo, CA, USA) and reprobed with anti-ß-tubulin Ab.

Intranasal administration of recombinant adenovirus containing HO-1 cDNA
The recombinant adenovirus containing rat HO-1 cDNA and empty vector has been described (17) . Mice were anesthetized with methoxyflurane, then 5 x 108 plaque-forming units of Ad-HO-1 or Ad-null were administered intranasally to each mouse in a volume of 50 µl.

Total RNA isolation and RT-polymerase chain reaction (RT-PCR) amplification
Total RNA from lung tissue was extracted by using Trizol reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s instructions. Primers used for mouse HO-1 were sense: TCCCAGACACCGCTCCTCCAG; antisense: GGATTTGGGGCTGCTGGTTTC; for mouse TNF-{alpha} were sense: CTCCAGCTGGAAGACTCCTCCCAG; antisense: AAAGCATGATCCGCGACGTGGAA. For mouse IL-1ß, sense: TCACAGCAGCACATCAACAA; antisense: TCCATTGAGGTGGAGAGCTT, and for mouse ß-actin, sense: GTGGGCCGCTCTAGGCACCAA; antisense: CTCTTTGATGTCACGCACGATTTC. RT-PCR was performed using RT-PCR Master Mix (USB). Conditions for RT-PCR were 1 cycle at 42°C for 30 min, 1 cycle at 95°C for 3 min; 30 cycles at 95°C for 30 s, 60°C for 1 min, and 68°C for 1 min 30 s; and 1 cycle at 68°C for 5 min. Each reaction product (10 µl) was then separated on a 1% agarose gel containing 0.5 µg/ml of ethidium bromide.

Statistics
Data are expressed as mean ± SE and analyzed by Student’s t test. Significant difference was accepted at P < 0.05. Survival studies were evaluated using {chi}2 tests and significant difference was accepted at P < 0.05.

RESULTS

Hyperoxia induces HO-1 production in mouse lung and in MLEC
We first confirmed that hyperoxia modulates mRNA and protein levels of HO-1. Hyperoxia significantly increased steady-state levels of HO-1 mRNA and protein in the lung lysates of mice exposed to O2 (Fig. 1 A, B). MLEC also exhibited significantly increased HO-1 protein during O2 (Fig. 1C ).


Figure 1
View larger version (49K):
[in this window]
[in a new window]

  		Figure 1. HO-1 siRNA inhibits hyperoxia-induced HO-1 protein expression in vivo and in vitro. A) HO-1 mRNA expression in lung lysates was measured by RT-PCR after hyperoxia (O2). B) HO-1 protein expression in lung lysates was measured by Western blot after O2. C) HO-1 protein expression was measured by Western blot in MLEC after O2. RA, room air control. D) MLEC were transfected with different doses (200, 400, 600 nM) of two different sequences (1 and 2) of HO-1 siRNA, then exposed to 16 h O2. HO-1 protein expression was measured by Western blot. E) Mice were administered intranasal HO-1 or nonspecific (NS) siRNA (2 mg/kg body wt) and HO-1 protein expression was detected in lung lysates by Western blot after 72 h O2. ß-tubulin was used as loading control. Results are representative of 3 independent experiments.

HO-1 siRNA inhibits hyperoxia-induced HO-1 protein expression in MLEC and in mouse lung
We sought to knock down HO-1 induction using siRNA. In MLEC, we tested two HO-1 siRNA sequences and determined that sequence 2 was the most effective in inhibiting hyperoxia-induced HO-1 protein expression (Fig. 1D ). All subsequent in vitro and in vivo studies utilize sequence 2 HO-1 siRNA. We earlier demonstrated lung specificity and the effectiveness of HO-1 siRNA (2 mg/kg) delivered intranasally (14) . We confirmed effective knockdown of hyperoxia-induced HO-1 protein expression in mouse lung after intranasal siRNA administration. HO-1 siRNA significantly inhibited hyperoxia-induced HO-1 protein expression in mouse lung lysates whereas nonspecific siRNA administration had no effect (Fig. 1E ).

HO-1 siRNA enhances hyperoxia-induced mortality and lung injury
To determine the functional role of hyperoxia-induced HO-1 expression, we administered HO-1 siRNA before hyperoxia exposure and found significantly increased mortality compared with mice given nonspecific siRNA. After 100 h of continuous exposure, 81% of mice given nonspecific siRNA (n=11) remained alive whereas only 45% of mice given HO-1 siRNA were alive (n=11, P<0.05) (Fig. 2 A). The range of survival for mice given HO-1 siRNA was 96–120 h, and the range for mice given nonspecific siRNA was 99–132 h. These differences in mortality correlated with increased lung injury parameters after 72 h O2 exposure. We had previously determined peak lung injury to occur at 72 h O2; therefore 72 h was used as a representative time point to assess injury. Mice administered HO-1 siRNA exhibited higher concentrations of bronchoalveolar lavage (BAL) protein (an indication of increased lung permeability) and BAL leukocytes than mice administered nonspecific siRNA (Fig. 2B and C , respectively). Expression of both TNF-{alpha} and IL-1ß mRNA, important markers of inflammation during hyperoxia, were also increased in mice administered HO-1 siRNA compared with nonspecific siRNA (Fig. 2D ). We examined lung sections for TUNEL staining and found that various lung cell types, including endothelial cells, undergo apoptosis in response to hyperoxia (Fig. 2E, F ). The total number of TUNEL-positive cells was significantly higher in the presence of HO-1 siRNA than were nonspecific siRNA controls (Fig. 2G ). Taken together, these studies indicate that endogenous HO-1 induction in vivo serves as an important response to lethal hyperoxic injury.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

  		Figure 2. HO-1 siRNA enhances hyperoxia-induced mortality and lung injury in vivo. A) Percent survival of mice administered nonspecific (NS) siRNA (n=11) or HO-1 siRNA (n=11), then exposed to continuous O2 (P<0.05, NS siRNA vs. HO-1 siRNA). B) Lung permeability was assessed by bronchoalveolar lavage (BAL) protein content in naive mice, mice administered NS siRNA or HO-1 siRNA, then exposed to 72 h O2 (n=3). C) Lung inflammation was detected by BAL cell counts in naive mice, mice administered NS siRNA or HO-1 siRNA, then exposed to 72 h O2 (n=3). BAL protein and cell counts are shown as mean ± SE. *P < 0.05 compared with NS siRNA mice. D) TNF-{alpha} and IL-1ß mRNA expression were assayed by RT-PCR in lung lysates after mice were administered NS siRNA or HO-1 siRNA, then exposed to 72 h O2. ß-actin was used as a loading control. Results are representative of 3 independent experiments. E) Representative TUNEL staining of lung sections (20x original magnification) taken from mice after NS siRNA (O2/NS siRNA) or HO-1 siRNA (O2/HO-1 siRNA) administration, then 72 h O2 exposure. Arrows indicate representative TUNEL-positive cells. F) Representative TUNEL staining of lung endothelial cells (40x original magnification) in mice administered NS siRNA, then exposed to 72 h O2. G) Graphical quantitation of TUNEL-positive cells expressed as % of total cells in lung sections (n=3). Data are shown as mean ± SE. *P < 0.05 compared with O2/NS siRNA.

HO-1 siRNA enhances hyperoxia-induced endothelial cell injury and death
Given the importance of the endothelial cell in maintaining the integrity of normal air-blood interfaces in the lung, we examined the effect of HO-1 siRNA on MLEC exposed to hyperoxia. Cells transfected with HO-1 siRNA showed a marked increase in hyperoxia-induced apoptosis compared with cells transfected with nonspecific siRNA (Fig. 3 A, B). This correlated with increased LDH activity, a marker of cell injury, after 72 h O2 compared with WT and nonspecific siRNA-treated cells (Fig. 3C ).


Figure 3
View larger version (49K):
[in this window]
[in a new window]

  		Figure 3. HO-1 siRNA enhances hyperoxia-induced endothelial cell death and injury. A) Representative flow cytometry analysis of apoptosis after MLEC were transfected with 200 nM HO-1 or NS siRNA, then exposed to room air (RA) or 72 h O2. The data are representative of 3 independent experiments. The y axis represents degree of propidium iodide binding and the x axis represents degree of annexin V-FITC binding. B) Graphical quantitation of the mean ± SE. in MLEC during hyperoxia. C) MLEC transfected with 200 nM HO-1 or NS siRNA were exposed to 72 h O2 and LDH activity was determined. LDH and apoptosis data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with HO-1 siRNA 72 h O2.

HO-1 overexpression abrogates hyperoxia-induced lung and endothelial cell injury/death
After 72 h O2, mice administered Ad-HO-1 displayed lower BAL protein and leukocyte counts than mice administered Ad-null (Fig. 4 A, B). Ad-HO-1 also decreased hyperoxia-induced TNF-{alpha} and IL-1ß expression in the lung (Fig. 4C ), revealing additional evidence of the anti-inflammatory effect of HO-1. The attenuation of lung injury and inflammation in the presence of Ad-HO-1 correlated with decreased lung apoptosis, as assessed by TUNEL quantitation (Fig. 4D ). Stable cell lines of MLEC transfected with retrovirus HO-1 (LSN/HO-1) showed increased HO-1 protein expression compared with empty vector (LXSN) controls (Fig. 4E ). HO-1 overexpressors showed markedly less LDH activity (Fig. 4F ) and apoptosis (Fig. 4G ) than did empty vector controls after 72 h hyperoxia. Our studies in MLEC so far demonstrate that lung endothelial cells strongly express HO-1 and are responsive to the protection provided by exogenous HO-1 during hyperoxia. Therefore, we postulated that endothelial cell-dependent mechanisms were critical to the protective effects of HO-1.


Figure 4
View larger version (35K):
[in this window]
[in a new window]

  		Figure 4. HO-1 overexpression abrogates hyperoxia-induced lung injury in vivo and in vitro. Mice were administered intranasal adenoviral rat HO-1 (Ad-HO-1) or adenoviral empty vector (Ad-null), then exposed to 72 h O2. A) Lung permeability was assessed by BAL protein content in naive, Ad-null, or Ad-HO-1 mice (n=3–5). B) Lung inflammation was detected by BAL total cell counts in naive mice, Ad-null, or Ad-HO-1 mice (n=3–5). BAL protein and cell counts are shown as mean ± SE. *P < 0.05 compared with Ad-null mice. C) TNF-{alpha} and IL-1ß mRNA expression by RT-PCR in naive, Ad-null, or Ad-HO-1 mice. The data are representative of 3 independent experiments. D) TUNEL quantitation expressed as % of total cells in lung sections from naive, Ad-null, or Ad-HO-1 mice (n=3–5). Data are shown as mean ± SE. *P < 0.05 compared with Ad-null mice. E) Cell lysates from MLEC stably transfected with the human HO-1 gene in a replication-deficient retroviral vector (LSN/HO-1) or empty vector (LXSN) were immunoblotted against HO-1 or ß-tubulin (loading control). The data are representative of 3 independent experiments. F) MLEC stably transfected with LSN/HO-1 or LXSN were exposed to 72 h O2 and LDH activity was determined. G) MLEC stably transfected with LSN/HO-1 or LXSN were exposed to 72 h O2 and apoptosis was quantitated by flow cytometry analysis. LDH and apoptosis data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with WT 72 h O2 and LSXN 72 h O2.

Hyperoxia induces STAT3 activation and the absence of endothelial STAT3 enhances hyperoxia-induced lung injury and cell death
First, we demonstrated hyperoxia-induced STAT3 activation by detecting phosphorylated STAT3 protein in nuclear extracts from WT mouse lungs and MLEC during hyperoxia. STAT3 was activated in mouse lungs (Fig. 5 A) and MLEC (Fig. 5B ). We then examined the role of endothelial STAT3 during hyperoxia by exposing endothelial cell-specific STAT3–/– (STAT3E–/–) mice and their WT littermate controls (STAT3 WT) to hyperoxia. To confirm that endogenous HO-1 induction in response to hyperoxia is not impaired in STAT3E–/– mice, we assessed HO-1 mRNA levels and found that STAT3E–/– mice significantly induce HO-1 expression (Fig. 5C ). Although there was no difference in survival (data not shown), STAT3E–/– had significantly greater lung injury than STAT3 WT control mice during hyperoxia. BAL protein concentration was significantly higher in STAT3E–/– mice than in STAT3 WT after 72 h exposure (Fig. 5D ). BAL leukocyte counts were also greater in STAT3E–/– mice than in STAT3 WT mice (Fig. 5E ). We designed STAT3 siRNA to specifically inhibit activated as well as total STAT3 in MLEC (Fig. 5F ). MLEC transfected with STAT3 siRNA were more susceptible to hyperoxia-induced cell injury, as assessed by LDH release (Fig. 5G ) and apoptosis (Fig. 5H ). As expected, transfection of nonspecific STAT3 siRNA had no effect on STAT3 expression, cell injury, or death in MLEC. These data indicate that endothelial STAT3 plays an important role in minimizing lung injury and endothelial cell death in response to hyperoxia.


Figure 5
View larger version (42K):
[in this window]
[in a new window]

  		Figure 5. Hyperoxia induces STAT3 activation and targeted disruption of endothelial STAT3 enhances hyperoxia-induced injury in vivo and in vitro. A) Nuclear proteins were extracted from the WT mouse lungs after O2, then immunoblotted against phosphorylated (p)-STAT3 and total STAT3. The data are representative of 3 independent experiments. B) Nuclear proteins were extracted from MLEC after O2, then immunoblotted against p-STAT3 and STAT3. The data are representative of 3 independent experiments. C) HO-1 mRNA expression in STAT3E–/– lung lysates was measured by RT-PCR after 72 h O2. D) Lung permeability was assessed by BAL protein content in WT (STAT3 WT) and endothelial-targeted STAT3-deficient (STAT3E–/–) mice exposed to 72 h O2 (n=3–5). E) Lung inflammation was detected by BAL cell counts in STAT3 WT and STAT3E–/– mice exposed to 72 h O2 (n=3–5). Data are shown as mean ± SE. *P < 0.05 compared with corresponding 72 h O2 mice; **P < 0.05 compared with STAT3E–/– WT 72 h O2 mice. F) MLEC transfected with 100 nM STAT3 or NS siRNA were exposed to 4 h O2 and nuclear proteins were immunoblotted against p-STAT3, STAT3, and ß-tubulin (loading control). The data are representative of 3 independent experiments. G) MLEC transfected with 100 nM STAT3 or NS siRNA were exposed to 72 h O2 and LDH activity was determined. H) MLEC transfected with 100 nM STAT3 or NS siRNA were exposed to 72 h O2 and apoptosis was quantitated by flow cytometry analysis. LDH and apoptosis data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with STAT3 siRNA 72 h O2.

The protective effect of HO-1 is dependent on endothelial cell STAT3 in vivo and in vitro
We next posed the question, Is there a relationship between the protective effects of HO-1 and endothelial STAT3 in vivo during hyperoxia? We first overexpressed HO-1 by using Ad-HO-1 intranasal administration in STAT3E–/– and confirmed HO-1 induction in the lungs 48 h after in room air (Fig. 6 A) as well as after 72 h O2 (Fig. 6B ). Exogenous Ad-HO-1 delivery to WT mouse lung significantly increased survival during hyperoxia compared with Ad-null in WT, STAT3 WT mice. After 115 h of continuous exposure, 56% of STAT3 WT mice given Ad-HO-1 (n=9) remained alive whereas only 8% of mice given Ad-null were still living (n=12, P<0.05) (Fig. 6C ). However, STAT3E–/– mice, even with high levels of HO-1 expression after Ad-HO-1 administration (Fig. 5C ), showed survival rates that were indistinguishable from control mice given Ad-null (Fig. 6C ). This difference in survival correlated with levels of lung injury, as assessed by BAL total protein concentration and cell counts after 72 h O2. STAT3E–/– mice given Ad-Ho-1 showed similar BAL total protein concentrations (Fig. 6D ) and cell counts (Fig. 6E ) to STAT3E–/– mice administered the Ad-null construct. Furthermore, STAT3E–/– mice administered Ad-Ho-1 showed similar levels of lung apoptosis to STAT3E–/– mice administered the Ad-null construct (Fig. 6F ). Consistent with our in vivo findings, we found that HO-1 overexpression with the LSN/HO-1 retroviral vector could not rescue MLEC transfected with STAT3 siRNA from hyperoxia-induced cell injury, as assessed by LDH activity, or apoptosis (Fig. 7 A, B). LSN/HO-1 cells transfected with nonspecific siRNA showed similar low levels of LDH activity compared with LSN/HO-1 cells, indicating that we were detecting a STAT3-specific effect. Consistent with the LDH activity, LSN/HO-1 cells showed less apoptosis than WT cells after 72 h O2, but when LSN/HO-1 cells were transfected with STAT3 siRNA, the resistance to hyperoxia-induced apoptosis was lost (Fig. 7B ). LSN/HO-1 cells transfected with nonspecific siRNA showed similar levels of apoptosis to LSN/HO-1 cells. We next explored a potential mechanism of HO-1-mediated protection and found that CO, an HO-1 reaction product, can rescue endothelial cells from hyperoxia-induced injury and apoptosis (Fig. 7C, D ). However, in the presence of STAT3 siRNA, CO had a decreased ability to ameliorate endothelial cell LDH activity and apoptosis (Fig. 7C, D ). These data indicate that HO-1 and its reaction product CO both depend on endothelial STAT3 to exert their protective effects during hyperoxia.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

  		Figure 6. The protective effect of HO-1 during hyperoxia is dependent on endothelial STAT3 in vivo. A) Endothelial-targeted STAT3-deficient (STAT3E–/–) mice were administered intranasal rat HO-1 gene in an adenoviral vector (Ad-HO-1, 5x108 plaque forming units), and lung lysates were obtained after 48 h administration. The lung lysates were immunoblotted against HO-1 or ß-tubulin. B) STAT3E–/–mice were exposed to 72 h O2 after 48 h intranasal administration of intranasal Ad-HO-1 (5x108 plaque forming units). The lung lysates were immunoblotted against HO-1 or ß-tubulin. C) Percent survival of STAT3 WT and STAT3E–/–mice administered Ad-null or Ad-HO-1, then exposed to continuous O2 (n=8–15). *P<0.05 compared with STAT3 WT Ad-HO-1 O2. D) Lung permeability was assessed by BAL protein content in naive STAT3E–/– and STAT3E–/– mice administered Ad-null or Ad-HO-1, then exposed to 72 h O2 (n=3–5). Data are shown as mean ± SE. *P < 0.05 compared with Ad-null/O2 and Ad-HO-1/O2 mice. E) Lung inflammation was detected by BAL cell counts in naive STAT3E–/– and STAT3E–/– mice administered Ad-null or Ad-HO-1, then exposed to 72 h O2 (n=3–5). Data are shown as mean ± SE. *P < 0.05 compared with Ad-null/O2 and Ad-HO-1/O2 mice. F) TUNEL quantitation was expressed as % of total cells in lung sections from naive STAT3E–/– and STAT3E–/– mice administered Ad-null or Ad-HO-1, then exposed to 72 h O2 (n=3–5). Data are shown as mean ± SE. *P < 0.05 compared with Ad-null/O2 and Ad-HO-1/O2.


Figure 7
View larger version (28K):
[in this window]
[in a new window]

  		Figure 7. The protective effects of HO-1 and its reaction product CO during hyperoxia are dependent on STAT3 in endothelial cells. MLEC overexpressing HO-1 (LSN/HO-1) were transfected with 100 nM STAT3 or NS siRNA, exposed to 72 h O2, then A) LDH activity and B) apoptosis were quantitated. The data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with LSN/HO-1 72 h O2. MLEC were transfected with 100 nM STAT3 or NS siRNA, then exposed to 72 h O2 in the presence or absence of CO (15 ppm), then C) LDH activity and D) apoptosis were quantitated. The data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with STAT3 siRNA 72 h O2.

The protective effect of STAT3 during hyperoxia is dependent in part on HO-1 in endothelial cells
We next sought to determine whether the protective effects of STAT3 were dependent on HO-1 expression. We overexpressed STAT3 in MLEC using adenoviral delivery of the constitutively activated form of STAT3 (Ad-STAT3) (Fig. 8 A). WT MLEC transfected with Ad-STAT3 exhibited significantly less cell injury and apoptosis than cells transfected with Ad-null (Fig. 8B, C ). Lung endothelial cells isolated from HO-1–/– mice had significantly greater injury and death than WT cells but retained the ability to respond to STAT3 overexpression. Ad-STAT3 transfection in HO-1–/– endothelial cells led to a marked decrease in LDH activity and apoptosis, although not to the low levels achieved by WT cells overexpressing STAT3 (Fig. 8B, C ). There was still a statistically significant increase in LDH activity and apoptosis in HO-1–/– given Ad-STAT3 compared with WT endothelial cells given Ad-STAT3. These data indicate that STAT3 is partially dependent on HO-1 to exert its protective effects in endothelial cells, but alternative protective pathways also exist. To investigate potential alternative pathways, we examined the expression levels of specific protective proteins in response to STAT3 overexpression. WT MLEC transfected with Ad-STAT3 had increased levels not only of HO-1 but also the antiapoptotic proteins p-Akt, Bcl-2, and Bcl-xL (Fig. 8D ). Levels of proapoptotic proteins Bad and Bax were unchanged with Ad-STAT3. We confirmed the ability of STAT3 to specifically modulate these antiapoptotic proteins in vivo by delivering adenoviral STAT3 to STAT3E–/– mice, then isolating the lung endothelial cells (Fig. 8E ). This allowed us to test two questions simultaneously: 1) does intranasal adenoviral gene delivery to the mouse result in effective gene expression in the lung endothelium? and 2) does STAT3 regulate our proteins of interest in vivo? We show that intranasal adenoviral STAT3 effectively restored phosphorylated and total STAT3 protein in STAT3E–/– lung endothelial cells (Fig. 8E ). Concomitant with the restoration of endothelial STAT3 was increased endothelial HO-1, p-Akt, Bcl-2, and Bcl-xL protein expression, which was consistent with our in vitro endothelial cell findings (Fig. 8D ). Next, we demonstrated a functional role for STAT3 in regulating antiapoptotic proteins during hyperoxia using a siRNA approach (Fig. 8F ). MLEC transfected with STAT3 siRNA showed a decreased ability to up-regulate HO-1, p-Akt, Bcl-2, and Bcl-xL with increased cleaved caspase 3 expression in response to hyperoxia compared with WT or nonspecific siRNA MLEC (Fig. 8F ). STAT3 siRNA had no effect on Bad or Bax expression during hyperoxia. We investigated the presence of a positive feedback system between STAT3 and HO-1 by overexpressing HO-1 in mouse lung and MLEC and by overexpressing STAT3 in HO-1-deficient cells. HO-1 overexpression in mouse lung and MLEC led to increased phospho-STAT3, Bcl-xL, and Bcl-2 expression (Fig. 8G and H , respectively), indicating that STAT3, Bcl-xL, and Bcl-2 are downstream targets of HO-1. However, Akt, Bcl-2, and Bcl-xL are dependent on HO-1 rather than STAT3 because HO-1-deficient endothelial cells do not show increased Akt, Bcl-2, and Bcl-xL expression in the presence of adenoviral STAT3 (Fig. 8I ). Taken together, our data indicate that STAT3 can activate HO-1 and vice versa, but Akt, Bcl-2, and Bcl-xL are likely directly downstream of HO-1 and not dependent on STAT3.


Figure 8
View larger version (88K):
[in this window]
[in a new window]

  		Figure 8. The protective effect of STAT3 during hyperoxia is dependent in part on HO-1 in endothelial cells. A) MLEC transfected with adenoviral STAT3 (Ad-STAT3) or empty vector (Ad-null) were immunoblotted against p-STAT3, STAT3, and ß-tubulin (loading control). B) MLEC isolated from HO-1-deficient (HO-1–/–) and WT mice were transfected with Ad-STAT3 or Ad-null, and LDH activity was determined after 72 h O2. The data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with corresponding Ad-STAT3 72 h O2, #P < 0.05 compared with HO-1–/– Ad-STAT3 72 h O2. C) HO-1–/– and WT MLEC were transfected with Ad-STAT3 or Ad-null and apoptosis was quantitated by flow cytometry analysis. Data are representative of 3 independent experiments. *P < 0.05 compared with corresponding 72 h O2; **P < 0.05 compared with corresponding Ad-STAT3 72 h O2, #P < 0.05 compared with HO-1–/– Ad-STAT3 72 h O2. D) Cell lysates from MLEC transfected with Ad-STAT3 or Ad-null were immunoblotted against HO-1, p-Akt, Bcl-2, Bcl-xL, Bad, Bax, and ß-tubulin. Data are representative of 3 independent experiments. E) STAT3E–/– mice were administered intranasal Ad-STAT3, sacrificed, and MLEC was isolated to detect p-STAT3, STAT3, and proteins as listed in Fig. 8D. F) MLEC were transfected with 100 nM STAT3 or NS siRNA, then exposed to 8 h O2. Cell lysates were immunoblotted against HO-1, p-Akt, Bcl-2, Bcl-xL, Bad, Bax, cleaved caspase 3, and ß-tubulin. The data are representative of 3 independent experiments. G) WT mice were administered Ad-HO-1 or Ad-null, sacrificed after 48 h, and lung lysates were immunoblotted against HO-1, p-STAT3, STAT3, Bcl-2, Bcl-xL, Bad, Bax, and ß-tubulin. Data are representative of 3 independent experiments. H) WT MLEC were transfected with Ad-HO-1 or Ad-null and cell lysates were immunoblotted against HO-1, p-STAT3, STAT3, Bcl-2, Bcl-xL, Bad, Bax, and ß-tubulin. Data are representative of 3 independent experiments. I) HO-1–/– MLEC were transfected with Ad-STAT3 or Ad-null and cell lysates were immunoblotted against p-STAT3, STAT3, p-Akt, Bcl-2, Bcl-xL, Bad, Bax, and ß-tubulin. The data are representative of 3 independent experiments.

DISCUSSION

Oxygen toxicity damages lung endothelium and epithelium, thereby increasing pulmonary vascular permeability and leading to lung edema with a loss of effective gas exchange. Early morphometric studies of rodent lungs exposed to 100% O2 implicated lung endothelium to be the initial site of injury (18) . Endothelial cells account for 46% of all lung cells, and oxygen toxicity led to the destruction of 44% of the endothelial cells, with a corresponding decrease in capillary surface area (18) . Although the generation of injurious oxidant species is an early event in lethal hyperoxia, exuberant tissue inflammation and cell death (necrosis and apoptosis) are also cardinal pathogenetic features of hyperoxia (19 , 20) . Antioxidant strategies have had limited success in inhibiting lethal hyperoxic injury (21 , 22) , indicating the need for multifaceted therapies that incorporate anti-inflammatory, antiapoptotic, as well as antioxidant approaches.

The HO-1 system is one such candidate protective pathway. HO-1 and its gaseous reaction product, CO, have been shown to exert significant anti-inflammatory and antiapoptotic effects during oxidant-induced injuries such as hyperoxia (23) , ischemia-reperfusion (24 25 26) , bleomycin (27) , and transplantation (28 , 29) . Bilirubin and biliverdin are also recognized as important mediators of the antioxidant and cytoprotective function of HO-1 during injury (30 31 32 33 34) . Future studies addressing the relative contributions of CO, bilirubin, and biliverdin to the protective effects of HO-1 induction during hyperoxic injury will be important to our understanding of the HO system as a whole.

Previous studies examining the consequences of HO-1 inhibition or deficiency have been limited by the lack of a specific HO-1 inhibitor and by the difficulties in generating extensive numbers of HO-1-deficient mice, which appear to have fertility and developmental issues. In addition, interpreting data from HO-1-deficient mice exposed to hyperoxia during adulthood is perplexing because HO-1 deficiency likely triggers compensatory responses that are probably present before birth. For example, HO-1-deficient mice have increased basal levels of other antioxidants, which may alter their responses to oxidant injury (35) . In the current studies we were able to study the function of postnatal HO-1 induction in a highly specific manner using HO-1 siRNA. In the presence of HO-1 siRNA, the mice exhibit increased mortality, injury, and endothelial cell apoptosis compared with nonspecific siRNA administration (Figs. 2 and 3) . However, HO-1 overexpression using viral delivery systems successfully rescued WT mice and endothelial cells from hyperoxia-induced injury and apoptosis (Fig. 4) . As expected from earlier reports, exogenous CO significantly decreased endothelial cell injury and apoptosis during hyperoxia (Fig. 7C, D ).

Despite the recognized cytoprotective effects of HO-1 and CO, the molecular pathways mediating the protective effects are still not well defined. We recently described the importance of STAT3 in mediating the antiapoptotic effects of CO during anoxia-reoxygenation injury (36) and investigated the role of STAT3 during hyperoxia. Given that the endothelial cell is an early and important target of oxygen toxicity (18 , 37) , we utilized mice deficient in endothelial cell STAT3 (STAT3E–/–). Endothelial STAT3 is not essential for survival during hyperoxia, as evidenced by survival rates that are comparable to WT mice, but the absence of endothelial STAT3 significantly worsens lung permeability, inflammation, and endothelial cell apoptosis (Fig. 5) . STAT3E–/– mice may not exhibit increased mortality due to the ability of intact epithelial STAT3 to compensate, indicating that the endothelium is one of many important cell types involved in hyperoxia responses (38) .

A striking observation was that HO-1 appears to be dependent on the presence of endothelial STAT3 in order to decrease hyperoxia-induced mortality and injury (Fig. 6) . We confirmed that STAT3E–/– mice retained the ability to induce endogenous HO-1 in response to hyperoxia as well as to appropriately overexpress HO-1 after Ad-HO-1 administration (Fig. 5C , Fig. 6A, B ). STAT3, however, is only partially dependent on the presence of HO-1, indicating the presence of both HO-1-dependent and independent mechanisms of STAT3-mediated protection during hyperoxia (Fig. 8B, C ). STAT3 overexpression still has significant antiapoptotic effects despite the absence of HO-1. This is likely due to the multiple downstream protective pathways modulated by STAT3, of which HO-1 is only one. STAT3 has been shown to be cytoprotective in cardiomyocytes subjected to ischemia, toxic stress, or endotoxin (13 , 39 40 41) . STAT3 protected cardiomyocytes against hypoxia/reoxygenation-induced oxidant stress by up-regulating manganese superoxide dismutase (SOD) (39) . Molecules important for cell growth and survival are also directly regulated by STAT3, such as heat shock proteins and growth factors (41 , 42) . STAT3 exerts important anti-inflammatory properties because STAT3-deficient mice have exaggerated inflammatory responses as well as increased cardiac apoptosis after LPS challenge (43) . Patients with severe heart failure have increased levels of circulating endotoxin and cytokines with reduced cardiac STAT3 protein levels, suggesting a potential clinical correlation (44) .

The functional link between STAT3 and HO-1 appears to be a complex one in which STAT3 functions both upstream and downstream of HO-1. We have shown that STAT proteins, at least in part, mediate HO-1 gene transcription during hyperoxia in vitro (8) . In the current studies, STAT3 overexpression leads to increased HO-1 expression in lung with subsequent induction of phospho-Akt, Bcl-2, and Bcl-xL (Fig. 8D, E ). Similarly, HO-1 overexpression leads to increased phospho-STAT3 (Fig. 8G, H ). We recently showed that CO has the ability to induce STAT3 activation in endothelial cells (36) . These results suggest the presence of a positive feedback system in which STAT3 activates HO-1, leading to reaction products such as CO, which can then potentiate STAT3 activation. Akt, Bcl-2, and Bcl-xL activation, however, appear to be directly related to HO-1, as seen in the inability of HO-1-deficient endothelial cells to induce phospho-Akt, Bcl-2, and Bcl-xL expression despite STAT3 overexpression (Fig. 8I ). Akt has been shown to confer resistance to hyperoxia in vivo and in vitro (45 46 47) , and may be one of many pathways modulated by HO-1. Both STAT3 and HO-1 appear to act as pleiotropic molecules with the ability to modulate various downstream targets, which may or may not overlap, but ultimately result in significant protection against noxious stimuli. We would speculate that the presence of a positive feedback system between two protective molecules such as HO-1 and STAT3 optimizes defense against lethal injury. These studies serve to delineate a previously unappreciated interdependence between HO-1 and STAT3 in vivo and in vitro and potentially enhance our understanding of lung protective strategies.

ACKNOWLEDGMENTS

P.J.L. is supported by National Institutes of Health (NIH) RO1 HL071595, American Heart Association Heritage Affiliate Grant, and American Lung Association Career Investigator Award. X.Y.F. is supported by NIH RO1 AI034522. The authors have no conflicting financial interests.

Received for publication January 13, 2006. Accepted for publication May 15, 2006.

REFERENCES

  1. Fisher, A. B. (1980) Oxygen therapy. Side effects and toxicity. Am. Rev. Respir. Dis. 122,61-69[Medline]
  2. Thiel, M., Chouker, A., Ohta, A., Jackson, E., Caldwell, C., Smith, P., Lukashev, D., Bittmann, I., Sitkovsky, M. V. (2005) Oxygenation inhibits the physiological tissue-protecting mechanism and thereby exacerbates acute inflammatory lung injury. PLoS. Biol. 3,e174[CrossRef][Medline]
  3. Lee, P. J. (2005) Heme oxygenase-1: linking signal transduction to function. Otterbein, L. E. Zuckerbraun, B. eds. Heme Oxygenase: The Elegant Orchestration of its Products in Medicine Nova Publishers New York.
  4. Alam, J. (2002) Heme oxygenase-1: past, present, and future. Antioxid. Redox. Signal. 4,559-562[CrossRef][Medline]
  5. Calo, V., Migliavacca, M., Bazan, V., Macaluso, M., Buscemi, M., Gebbia, N., Russo, A. (2003) STAT proteins: from normal control of cellular events to tumorigenesis. J. Cell. Physiol. 197,157-168[CrossRef][Medline]
  6. Deramaudt, T. B., da Silva, J. L., Remy, P., Kappas, A., Abraham, N. G. (1999) Negative regulation of human heme oxygenase in microvessel endothelial cells by dexamethasone. Proc. Soc. Exp. Biol. Med. 222,185-193[Abstract/Free Full Text]
  7. Ricchetti, G. A., Williams, L. M., Foxwell, B. M. (2004) Heme oxygenase 1 expression induced by IL-10 requires STAT-3 and phosphoinositol-3 kinase and is inhibited by lipopolysaccharide. J. Leukoc. Biol. 76,719-726[Abstract/Free Full Text]
  8. Lee, P. J., Camhi, S. L., Chin, B. Y., Alam, J., Choi, A. M. K. (2000) AP-1 and STAT mediate hyperoxia-induced gene transcription of heme oxygenase-1. Am. J. Physiol. 279,L175-L182
  9. Adamson, I. Y., Bowden, D. H., Wyatt, J. P. (1970) Oxygen poisoning in mice. Ultrastructural and surfactant studies during exposure and recovery. Arch. Pathol. 90,463-472[Medline]
  10. Langouche, L., Vanhorebeek, I., Vlasselaers, D., Vander Perre, S., Wouters, P. J., Skogstrand, K., Hansen, T. K., Van den Berghe, G. (2005) Intensive insulin therapy protects the endothelium of critically ill patients. J. Clin. Invest. 115,2277-2286[CrossRef][Medline]
  11. Kuhlencordt, P. J., Rosel, E., Gerszten, R. E., Morales-Ruiz, M., Dombkowski, D., Atkinson, W. J., Han, F., Preffer, F., Rosenzweig, A., Sessa,, et al (2004) Role of endothelial nitric oxide synthase in endothelial activation: insights from eNOS knockout endothelial cells. Am. J. Physiol. 286,C1195-C1202
  12. Zhang, X., Shan, P., Sasidhar, M., Choi, A. M. K., Lee, P. J. (2003) Reactive oxygen species and ERK-mitogen activated protein kinase mediate hyperoxia-induced apoptosis in lung epithelium. Am. J. Resp. Cell Mol. Biol. 28,305-315[Abstract/Free Full Text]
  13. Kano, A., Wolfgang, M. J., Gao, Q., Jacoby, J., Chai, G. X., Hansen, W., Iwamoto, Y., Pober, J. S., Flavell, R. A., Fu, X. Y. (2003) Endothelial cells require STAT3 for protection against endotoxin-induced inflammation. J. Exp. Med. 198,1517-1525[Abstract/Free Full Text]
  14. Zhang, X., Shan, P., Jiang, D., Noble, P. W., Abraham, N. G., Kappas, A., Lee, P. J. (2004) Small interfering RNA targeting heme oxygenase-1 enhances ischemia-reperfusion-induced lung apoptosis. J. Biol. Chem. 279,10677-10684[Abstract/Free Full Text]
  15. Quan, S., Yang, L., Shenouda, S., Jiang, H., Balazy, M., Schwartzman, M. L., Shibahara, I., Shinohara, K., Abraham, N. G. (2002) Functional expression of human heme oxygenase-1 (HO-1) driven by HO-1 promoter in vitro and in vivo. J. Cell. Biochem. 85,410-421[CrossRef][Medline]
  16. Haga, S., Terui, K., Zhang, H. Q., Enosawa, S., Ogawa, W., Inoue, H., Okuyama, T., Takeda, K., Akira, S., Ogino, T., et al (2003) Stat3 protects against Fas-induced liver injury by redox-dependent and -independent mechanisms. J. Clin. Invest. 112,989-998[CrossRef][Medline]
  17. Otterbein, L. E., Kolls, J. K., Mantell, L. L., Cook, J. L., Alam, J., Choi, A. M. K. (1999) Exogenous administration of heme oxygenase-1 by gene transfer provides protection against hyperoxia-induced lung injury. J. Clin. Invest. 103,1047-1054[Medline]
  18. Crapo, J. D., Barry, B. E., Foscue, H. A., Shelburne, J. (1980) Structural and biochemical changes in rat lungs occurring during exposures to lethal and adaptive doses of oxygen. Am. Rev. Respir. Dis. 122,123-143[Medline]
  19. Barazzone, C., White, C. W. (2000) Mechanisms of cell injury and death in hyperoxia: role of cytokines and Bcl-2 family proteins. Am. J. Respir. Cell Mol. Biol. 22,517-519[Free Full Text]
  20. Mantell, L. L., Lee, P. J. (2000) Signal transduction pathways in hyperoxia-induced lung cell death. Mol. Genet. Metab. 71,359-370[CrossRef][Medline]
  21. Tsan, M. F. (2001) Superoxide dismutase and pulmonary oxygen toxicity: lessons from transgenic and knockout mice (review). Int. J. Mol. Med. 7,13-19[Medline]
  22. Van Klaveren, R. J., Dinsdale, D., Pype, J. L., Demedts, M., Nemery, B. (1997) N-acetylcysteine does not protect against type II cell injury after prolonged exposure to hyperoxia in rats. Am. J. Physiol. 273,L548-L555[Medline]
  23. Otterbein, L. E., Mantell, L. L., Choi, A. M. (1999) Carbon monoxide provides protection against hyperoxic lung injury. Am. J. Physiol. 276,L688-L694[Medline]
  24. Kaizu, T., Nakao, A., Tsung, A., Toyokawa, H., Sahai, R., Geller, D. A., Murase, N. (2005) Carbon monoxide inhalation ameliorates cold ischemia/reperfusion injury after rat liver transplantation. Surgery 138,229-235[CrossRef][Medline]
  25. Zhang, X., Shan, P., Otterbein, L. E., Alam, J., Flavell, R. A., Davis, R. J., Choi, A. M., Lee, P. J. (2003) Carbon monoxide inhibition of apoptosis during ischemia-reperfusion lung injury is dependent on the p38 mitogen-activated protein kinase pathway and involves caspase 3. J. Biol. Chem. 278,1248-1258[Abstract/Free Full Text]
  26. Nakao, A., Kimizuka, K., Stolz, D. B., Neto, J. S., Kaizu, T., Choi, A. M., Uchiyama, T., Zuckerbraun, B. S., Nalesnik, M. A., Otterbein, L. E., Murase, N. (2003) Carbon monoxide inhalation protects rat intestinal grafts from ischemia/reperfusion injury. Am. J. Pathol. 163,1587-1598[Abstract/Free Full Text]
  27. Zhou, Z., Song, R., Fattman, C. L., Greenhill, S., Alber, S., Oury, T. D., Choi, A. M., Morse, D. (2005) Carbon monoxide suppresses bleomycin-induced lung fibrosis. Am. J. Pathol. 166,27-37[Abstract/Free Full Text]
  28. Neto, J. S., Nakao, A., Toyokawa, H., Nalesnik, M. A., Romanosky, A. J., Kimizuka, K., Kaizu, T., Hashimoto, N., Azhipa, O., Stolz, D. B., et al (2006) Low-dose carbon monoxide inhalation prevents development of chronic allograft nephropathy. Am. J. Physiol. 290,F324-F334
  29. Song, R., Kubo, M., Morse, D., Zhou, Z., Zhang, X., Dauber, J. H., Fabisiak, J., Alber, S. M., Watkins, S. C., Zuckerbraun, B. S., Otterbein, L. E., Ning, W., Oury, T. D., Lee, P. J., McCurry, K. R., Choi, A. M. (2003) Carbon monoxide induces cytoprotection in rat orthotopic lung transplantation via anti-inflammatory and anti-apoptotic effects. Am. J. Pathol. 163,231-242[Abstract/Free Full Text]
  30. Stocker, R., Yamamoto, Y., McDonagh, A. F., Glazer, A. N., Ames, B. N. (1987) Bilirubin is an antioxidant of possible physiological importance. Science 235,1043-1046[Abstract/Free Full Text]
  31. Hammerman, C., Goldschmidt, D., Caplan, M. S., Kaplan, M., Bromiker, R., Eidelman, A. I., Gartner, L. M., Hochman, A. (2002) Protective effect of bilirubin in ischemia-reperfusion injury in the rat intestine. J. Pediatr. Gastroenterol. Nutr. 35,344-349[CrossRef][Medline]
  32. Nakao, A., Otterbein, L. E., Overhaus, M., Sarady, J. K., Tsung, A., Kimizuka, K., Nalesnik, M. A., Kaizu, T., Uchiyama, T., Liu, F., et al (2004) Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127,595-606[CrossRef][Medline]
  33. Fondevila, C., Shen, X. D., Tsuchiyashi, S., Yamashita, K., Csizmadia, E., Lassman, C., Busuttil, R. W., Kupiec-Weglinski, J. W., Bach, F. H. (2004) Biliverdin therapy protects rat livers from ischemia and reperfusion injury. Hepatology 40,1333-1341[CrossRef][Medline]
  34. Yamashita, K., McDaid, J., Ollinger, R., Tsui, T. Y., Berberat, P. O., Usheva, A., Csizmadia, E., Smith, R. N., Soares, M. P., Bach, F. H. (2004) Biliverdin, a natural product of heme catabolism, induces tolerance to cardiac allografts. FASEB J. 18,765-767[Abstract/Free Full Text]
  35. Dennery, P. A., Visner, G., Weng, Y. H., Nguyen, X., Lu, F., Zander, D., Yang, G. (2003) Resistance to hyperoxia with heme oxygenase-1 disruption: role of iron. Free Radic. Biol. Med. 34,124-133[CrossRef][Medline]
  36. Zhang, X., Shan, P., Alam, J., Fu, X. Y., Lee, P. J. (2005) Carbon monoxide differentially modulates STAT1 and STAT3 and inhibits apoptosis via a phosphatidylinositol 3-kinase/Akt and p38 kinase-dependent STAT3 pathway during anoxia-reoxygenation injury. J. Biol. Chem. 280,8714-8721[Abstract/Free Full Text]
  37. Crapo, J. D. (1986) Morphologic changes in pulmonary oxygen toxicity. Annu. Rev. Physiol. 48,721-731[CrossRef][Medline]
  38. Hokuto, I., Ikegami, M., Yoshida, M., Takeda, K., Akira, S., Perl, A. K., Hull, W. M., Wert, S. E., Whitsett, J. A. (2004) Stat-3 is required for pulmonary homeostasis during hyperoxia. J. Clin. Invest. 113,28-37[CrossRef][Medline]
  39. Negoro, S., Kunisada, K., Fujio, Y., Funamoto, M., Darville, M. I., Eizirik, D. L., Osugi, T., Izumi, M., Oshima, Y., Nakaoka, Y., et al (2001) Activation of signal transducer and activator of transcription 3 protects cardiomyocytes from hypoxia/reoxygenation-induced oxidative stress through the upregulation of manganese superoxide dismutase. Circulation 104,979-981[Abstract/Free Full Text]
  40. Negoro, S., Kunisada, K., Tone, E., Funamoto, M., Oh, H., Kishimoto, T., Yamauchi-Takihara, K. (2000) Activation of JAK/STAT pathway transduces cytoprotective signal in rat acute myocardial infarction. Cardiovasc. Res. 47,797-805[Abstract/Free Full Text]
  41. Kunisada, K., Negoro, S., Tone, E., Funamoto, M., Osugi, T., Yamada, S., Okabe, M., Kishimoto, T., Yamauchi-Takihara, K. (2000) Signal transducer and activator of transcription 3 in the heart transduces not only a hypertrophic signal but a protective signal against doxorubicin-induced cardiomyopathy. Proc. Natl. Acad. Sci. U. S. A. 97,315-319[Abstract/Free Full Text]
  42. Stephanou, A., Latchman, D. S. (1999) Transcriptional regulation of the heat shock protein genes by STAT family transcription factors. Gene Exp. 7,311-319
  43. Jacoby, J. J., Kalinowski, A., Liu, M. G., Zhang, S. S., Gao, Q., Chai, G. X., Ji, L., Iwamoto, Y., Li, E., Schneider, M., Russell, K. S., Fu, X. Y. (2003) Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age. Proc. Natl. Acad. Sci. U. S. A. 100,12929-12934[Abstract/Free Full Text]
  44. Podewski, E. K., Hilfiker-Kleiner, D., Hilfiker, A., Morawietz, H., Lichtenberg, A., Wollert, K. C., Drexler, H. (2003) Alterations in Janus kinase (JAK)-signal transducers and activators of transcription (STAT) signaling in patients with end-stage dilated cardiomyopathy. Circulation 107,798-802[Abstract/Free Full Text]
  45. Lu, Y., Parkyn, L., Otterbein, L. E., Kureishi, Y., Walsh, K., Ray, A., Ray, P. (2001) Activated Akt protects the lung from oxidant-induced injury and delays death of mice. J. Exp. Med. 4,545-549
  46. Ahmad, A., Ahmad, S., Chang, L. Y., Schaack, J., White, C. W. (2006) Endothelial Akt activation by hyperoxia: Role in cell survival. Free Radic. Biol. Med. 40,1108-1118[CrossRef][Medline]
  47. Jin, Y., Kim, H. P., Ifedigbo, E., Lau, L. F., Choi, A. M. (2005) Cyr61 protects against hyperoxia-induced cell death via Akt pathway in pulmonary epithelial cells. Am. J. Respir. Cell Mol. Biol. 33,297-302[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M.-F. Mashreghi, R. Klemz, I. S. Knosalla, B. Gerstmayer, U. Janssen, R. Buelow, A. Jozkowicz, J. Dulak, H.-D. Volk, and K. Kotsch
Inhibition of Dendritic Cell Maturation and Function Is Independent of Heme Oxygenase 1 but Requires the Activation of STAT3
J. Immunol., June 15, 2008; 180(12): 7919 - 7930.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
L. J. Quinton, M. R. Jones, B. E. Robson, B. T. Simms, J. A. Whitsett, and J. P. Mizgerd
Alveolar Epithelial STAT3, IL-6 Family Cytokines, and Host Defense during Escherichia coli Pneumonia
Am. J. Respir. Cell Mol. Biol., June 1, 2008; 38(6): 699 - 706.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
J. M. Siner, G. Jiang, Z. I. Cohen, P. Shan, X. Zhang, C. G. Lee, J. A. Elias, and P. J. Lee
VEGF-induced heme oxygenase-1 confers cytoprotection from lethal hyperoxia in vivo
FASEB J, May 1, 2007; 21(7): 1422 - 1432.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-5668fjev1
20/12/2156    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow