|
|
||||||||




* Departments of Physiology and
Anatomy and Neurobiology, University of Maryland Baltimore, School of Medicine, Baltimore, Maryland, USA; and
Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann Arbor, Michigan, USA
1Correspondence: Department of Physiology, University of Maryland Baltimore, School of Medicine, Baltimore, MD 21201, USA. E-mail: akons001{at}umaryland.edu
| ABSTRACT |
|---|
|
|
|---|
800 kDa) in striated muscle closely surrounds sarcomeres at the level of the M-band and Z-disk where, we hypothesize, it participates in the assembly of the contractile apparatus and membrane systems required for Ca2+ homeostasis. In this study, we used small inhibitory RNA (siRNA) technology to reduce the levels of obscurin in primary cultures of skeletal myotubes to study its role in myofibrillogenesis and the organization of the sarcoplasmic reticulum (SR). siRNA-treated myotubes showed a specific and dramatic reduction in the
800 kDa form of obscurin by reverse transcription-polymerase chain reaction, immunoblotting, and immunofluorescence. M-bands and A-bands, but not Z-disks or I-bands, were disrupted when the synthesis of obscurin was inhibited. Small ankyrin 1, an integral protein of the network SR that binds to obscurin, also failed to align around developing sarcomeres in treated myotubes. Myosin and myomesin levels were significantly reduced in treated myotubes but
-actinin was not, suggesting that down-regulation of obscurin destabilizes proteins of the M-band and A-band but not of the Z-disk. Our findings suggest that obscurin is required for the assembly of the M-band and A-band and for the regular alignment of the network SR around the contractile apparatus.Kontrogianni-Konstantopoulos, A., Catino, D. H., Strong, J. C., Sutter, S., Borisov, A. B., Pumplin, D. W., Russell, M. W., Bloch, R. J. Obscurin modulates the assembly and organization of sarcomeres and the sarcoplasmic reticulum.
Key Words: obscurin myosin myomesin titin small ankyrin 1 A-band M-band
| INTRODUCTION |
|---|
|
|
|---|
The assembly of myofibrils is a complex process that depends on the coordinated integration of actin, myo-sin, and their associated proteins into sarcomeres (1
, 2)
. The striking regularity of actin and myosin in sarcomeres cannot be explained simply by their ability to assemble independently into thin and thick filaments, respectively. Rather, it involves specific and dynamic interactions with other cytoskeletal components (2
3
4
5)
that are still poorly understood. In one recent model of myofibrillogenesis, primitive Z-disks, termed "Z-bodies," composed of
-actinin interact with the N-terminus of titin, nebulin, and T-cap/telethonin to nucleate the polarized organization of actin filaments (6
7
8)
. Similarly, proteins of the M-band, including the COOH-terminal region of titin, myomesin, M-protein, and obscurin, are essential for the integration of myosin filaments into A-bands (5
, 9
10
11
12
13
14)
. As myofibrils mature, they align parallel to each other, assume a diameter of 13 µm, and become organized as a series of sarcomeres with sharply delineated Z-lines, highly ordered I-bands consisting of
1 µm-long thin filaments, and mature A-bands composed of
1.6 µm-long, thick filaments that are centrally symmetrical and are bisected by M-bands.
As myofibrillogenesis proceeds, the t-tubules and SR, which together modulate cytosolic Ca2+ release and uptake during contraction and relaxation, assemble gradually and in close coordination with the sarcomeric cytoskeleton (15
, 16)
. T-tubules are not associated with specific regions of the sarcomere until late in development, when they localize to the myoplasm surrounding the sites where the A and I bands overlap (the "A/I junction") in each sarcomere. Similarly, organized elements of the SR appear only at later stages of myofibrillogenesis, when the key features of sarcomeres are easily recognizable. At maturity, the SR of mammalian skeletal muscle contains three morphologically and functionally distinct, yet continuous, compartments: the terminal cisternae, the network SR, and the longitudinal SR (17)
. Like the t-tubules, these compartments occupy specific locations around each sarcomere in skeletal myofibers: the network SR is positioned around M-bands and Z-disks whereas the terminal cisternae are located with the t-tubules around A/I junctions. Specific localization of the t-tubules and compartments of the SR requires a set of anchoring mechanisms that are strong enough to resist the strong shear forces that can be exerted on the membranes during the contractile cycle.
We have been studying the role of obscurin, a large (
800 kDa) protein of the titin superfamily, in organizing myofibrils and the SR (10
, 11
, 18
19
20
21
22)
. Like titin, obscurin is a multidomain protein composed of tandem adhesion modules and signaling domains (Fig. 1
A) (23)
. Specifically, its NH2-terminal half is composed of 49 immunoglobulin (Ig) and 2 fibronectin III-like (FNIII) domains, and is followed by a complex region consisting of 4 additional Ig domains, flanked by nonmodular sequences, an IQ motif, and a conserved SH3 domain adjacent to Rho guanine nucleotide exchange factor and pleckstrin homology domains. Its COOH-terminal region consists of two additional Ig repeats, followed by a nonmodular region of 417 amino acids with several consensus phosphorylation motifs for ERK kinases.
|
Unlike titin, which is an integral component of sarcomeres, obscurin intimately surrounds myofibrils at the level of the Z-disk and M-band, where it is appropriately positioned to participate in their assembly and integration with elements of the SR (20)
. Consistent with this, obscurin binds to titin and sarcomeric myosin, and to small ankyrin 1 (sAnk1), an integral component of the network SR (11
, 20
, 23
24
25)
. During myofibrillogenesis in cultured neonatal rat cardiac and skeletal myotubes, obscurin associates primarily with developing M-bands and, at a later time and to a lesser extent, with Z-disks (18
, 23
, 26)
. Overexpression of its COOH-terminus in primary cultures of skeletal myotubes has a profound and specific effect on the organization of sarcomeric myosin, suggesting a role in the assembly of A-bands (11)
.
Here we use small inhibitory RNAs (siRNAs) to reduce the expression of obscurin and examine its role in developing skeletal myotubes. Our results show that siRNA targeted to the mRNA of the
800 kDa form of obscurin reduces the levels of protein by
70% and selectively inhibits the formation of M-bands and A-bands. They further suggest that the network SR also fails to differentiate and align with the contractile apparatus when obscurin levels are reduced. Our results are the first to demonstrate a key role for obscurin in the assembly and maintenance of sarcomeric A-bands and M-bands, and in the regular alignment of the network SR around developing sarcomeres.
| MATERIALS AND METHODS |
|---|
|
|
|---|
0.5 ml) were applied to sterile glass coverslips and supplemented with 1 ml of the same medium the next day. Medium was replaced 48 h later with medium containing 2 x 105 M cytosine arabinoside (Sigma Chemicals, St. Louis, MO, USA) to kill dividing cells. Cultures were infected with adenoviral constructs 5 days after initial plating and analyzed 48 h later.
siRNA adenoviral constructs and infection of primary cultures
siRNA constructs were designed to inhibit the expression of the first coding exon of the rat obscurin gene (XM340807; nucleotides 1600). Target siRNA sequences were selected based on Tuschls principles (28)
. Three different siRNA target sites and one control sequence (Ambion Inc., Austin, TX, USA) were selected: I: 5'GTGGAGGCAGGAGCACGCT3', IIa: 5'GACGCCACCTTCCGATGTC3', IIb: 5'GCTGTGAGCTGGTCCAAAGA3', and control: 5'ACTACCGTTGTTATAGGTG3'. The siRNA target sites were converted into oligonucleotide sequences as described in pSilencerTM kit (Ambion). Duplex DNA was directionally cloned into the pSilencer 2.0-U6 expression vector driven by the U6 promoter (Ambion). The U6 promoter and siRNA constructs were subcloned in the adenoviral shuttle vector, pACpL+loxP-SSP (http://www.med.umich.edu/vcore/pdf/pAC%20pL+loxP-SSP.pdf). Obscurin I, IIa, and IIb as well as control siRNA adenoviruses were produced, as described (10)
.
Cultures of rat myotubes were infected with 109 viral particles/ml of obscurin-I, obscurin-IIa, obscurin-IIb, or control siRNA viruses in 1 ml DMEM for 1 h at room temperature. Infected cells were supplemented with 1 ml of DMEM plus 20% FBS and 4 x 105 M cytosine arabinoside (Sigma Chemicals). After 48 h cultures were rinsed with PBS and fixed with 2% paraformaldehyde for 15 min at room temperature. Fixed cells were permeabilized with 0.1% Triton-X-100 for 10 min at room temperature, rinsed with PBS, and processed for immunolabeling and confocal imaging.
Experiments were repeated eight times and
25 cells were analyzed from each.
Antibodies
Primary antibodies were rabbit antibodies to obscurin-C (3 µg/ml; ref. 20
), titin-Z (to the first two Ig domains; 3 µg/ml), titin-M (to its M-band portion, 3 µg/ml; a gift of Dr. S. Labeit; ref. 29
), and sAnk1 (3 µg/ml; ref. 30
), and mouse antibodies to obscurin-N (to the two NH2-terminal Ig domains; 3 µg/ml), myosin II (clone MY-32, diluted 1:500; Sigma),
-actinin (diluted 1:500, Sigma), and myomesin-B4 (diluted 1:100; a gift of Dr. J.-C. Perriard; ref. 31
). Secondary antibodies were goat anti-mouse and goat anti-rabbit IgGs conjugated to Alexa488 and Alexa568, respectively, for immunofluorescence (Molecular Probes, Eugene, OR, USA; used at 1:200) or to alkaline phosphatase for immunoblotting (Jackson ImmunoResearch, West Grove, PA, USA; used at 1:2500).
Generation of P1 myotube lysates and immunoblotting
Protein lysate was prepared from infected myotubes as described (11)
, and
50 µg from each sample were solubilized in 2 x SDS Laemmli buffer either at 42°C for 30 min (for obscurin) (20)
or at 90°C for 5 min (for myosin, myomesin,
-actinin, and sAnk1). Samples fractionated by SDS-PAGE were transferred to nitrocellulose, processed (11)
, and probed with primary antibodies at 100 ng/ml (or other concentrations; see above). These experiments were repeated at least four times and yielded consistent results.
Reverse transcription-polymerase chain reaction
Total RNA was isolated from cultures of rat myotubes, infected with control siRNA viruses or with siRNA viruses targeting obscurin, with Trizol as reagent (Invitrogen Corporation, Carlsbad, CA, USA). Aliquots containing
5 µg of RNA were reverse transcribed using the Superscript First Strand Synthesis System for RT-polymerase chain reaction (RT-PCR) (Invitrogen) following the manufacturers instructions. Polymerase chain reaction (PCR) amplification yielded cDNAs encoding fragments of the rat obscurin gene (accession number: XM_340807), with the following sets of oligonucleotide primers: a: 5'GCACCCAGGAGGCCACCCCTGTACCCT3' (sense) and a': 5'GTGGTCCGAGGGGCTCT GGGGCTG3' (antisense), b: 5'GAGTCCCAAACTCCACAGAGGCCT3' (sense) and b': 5'CTTTCCTCTGTAGTTCCCCGAGTG3' (antisense), c: 5'ACTGTGGAAGCTCGGGAGGTG ACA3' (sense) and c': 5'CAAGAGTTTAGTCCCTGTGAGCCT3' (antisense), d: 5'CCTGCACAGCCCAGCCTGCCTCCC3' (sense) and d': 5'CTGCTGCTTCATCTCCTTCCT CAC3' (antisense) and e: 5'GCCAAAGAAGAGGAGCAGGAGAGA3' (sense) and e': 5'AGGAGATAGCTTGAGCCTCTTGTC3' (antisense).
cDNAs encoding sequences of different isoforms of muscle myosin were also assessed (32)
. A sense oligonucleotide primer, A: 5' GAAGGCCAAGAAGGCCATC 3', annealed to a highly conserved region shared by all four isoforms of the heavy chain of muscle myosin (MHC) expressed in adult rat skeletal muscle. A slightly modified primer A, termed A': 5' GAAGGCCAARAARGCCATYA 3' was used for the embryonic (E) and neonatal (N) myosin isoforms. Primers A and A' were used in combination with antisense oligonucleotide primers designed to anneal to highly specific sequences for each MHC gene, present in their 3' untranslated regions. These included MHC-IIa: 5' TCTACAGCATCAGAGCTGCC 3', MHC-IIb: 5' GTGTGATTTCTTCTGTCACC 3', MHC-IIx: 5' GGTCACTTTCCTGCTTTGGA 3', MHC-I: 5' GGTCTCAGGGCTTCACAGGC 3', MHC-E: 5' CCCTCACCAAGAGGACATGC 3' and MHC-N: 5' GCGGCCTCCTCAAGATGCGT 3'. In parallel experiments, cDNAs encoding segments of
-actinin-3 (AF450248) and myomesin-2 (XM_240481) from rat skeletal muscle (accession numbers: AF450248 and XM_240481, respectively) were amplified using primers: 5'GTTATGCAGCCCGAGGGT3' (sense) and 5'CAGCGGAAAACAGCACCA3' (antisense) and 5'ATGTCCCTGGTTGTAGTG3' (sense) and 5'GGTGTGGGACCTTAACCT3' (antisense), respectively. All PCR products were analyzed by electrophoresis in 1% agarose gels and their authenticity was verified by sequencing.
Immunofluorescence staining and confocal microscopy
Fixed, permeabilized cultures were immunolabeled with primary antibodies and analyzed with a Zeiss 410 confocal microscope (Carl Zeiss, Inc, Tarrytown, NY, USA) equipped with a 63x, numerical apertune (NA) 1.4 objective, with pinholes set at 18, as in ref. 11
.
Electron microscopy
Myotube cultures, prepared on glass coverslips and infected with viruses encoding either control siRNA or siRNA targeting obscurin, were fixed with 2% paraformaldehyde for 15 min at room temperature, washed with PBS, and incubated in 100 mM glycine for 10 min at room temperature. Samples were permeabilized with 0.5 mg/ml saponin in PBS, 1%BSA (PBS/BSA/Saponin) for 1 h at room temperature, immunolabeled with obscurin-N or obscurin-C antibodies, washed in PBS/BSA/Saponin, counterstained with goat anti-mouse-Alexa488 or goat anti-rabbit-Alexa568 (Molecular Probes), and mounted onto slides with Vectashield (Vector Laboratories, Burlingame, CA, USA). The locations of infected cells that showed reduced staining for obscurin were marked with a diamond stylus. Coverslips were removed and samples were fixed overnight in 0.2M cacodylate buffer, 2% glutaraldehyde, 5 mg/ml tannic acid. After washing in 0.2M cacodylate buffer, cultures were postfixed in 50 mM acetate buffer, 1% osmium tetroxide, en bloc stained with 1% uranyl acetate, dehydrated, and embedded in araldite-embed 812 (Electron Microscopy Sciences, Fort Washington, PA, USA). After hardening of the resin, glass coverslips were separated from the cells with hydrofluoric acid. For cross sections, samples were oriented under a dissecting microscope to allow sectioning of myotubes in a direction perpendicular both to the substrate and to the long axis of filament bundles. Sections were cut at a thickness of
6080 nm with an LKB MT5000 microtome (LKB-Pharmacia, Bromma, Sweden) and picked up on 200 mesh copper grids. They were stained again with uranyl acetate, followed by lead citrate, and examined under a Philips 201 electron microscope (Philips, Eindhoven, The Netherlands) at a magnification of 30,000. Pictures were taken on Kodak 4489 film and digitally scanned at 720 dpi.
| RESULTS |
|---|
|
|
|---|
Immunoblots showed that primary myotubes infected with siRNA-IIa expressed significantly lower levels of the
800 kDa form of obscurin than controls (Fig. 1B
). Quantitation of the immunoreactive bands with Metamorph Imaging Software showed a decrease of
70% (P<0.05) in the amount of obscurin expressed in cultures treated with siRNA-IIa virus compared with the scrambled control. RT-PCR analysis confirmed that the levels of transcripts encoding the
800 kDa form of obscurin were reduced. These experiments used five different sets of primers designed to anneal to sequences flanking either the first FnIII domain (a/a'), internal Ig repeats (b/b' and c/c'), the IQ motif (d/d'), or the SH3 domain (e/e') of the
800 kDa protein (Fig. 1A
). There was a significant decrease in all RT-PCR products (
65%, P<0.05) in cultures infected with the obscurin siRNA virus (Fig. 1C
) compared with controls (Fig. 1D
).
Immunolabeling of rat myotubes 2 days after infection with viruses expressing siRNA-IIa showed that
65% of the cells were severely depleted of obscurin, which failed to accumulate into M-bands and Z-disks (Fig. 2
A, B, asterisk). Remarkably, these cells also showed significantly reduced labeling for sarcomeric myosin (Fig. 2A', B'
, asterisk). In the other
35% of infected myotubes, obscurin was also decreased compared with controls but not as dramatically (Fig. 2B, C
). In these cells, obscurin was present either along striated fibrils near the periphery (Fig. 2B
, arrow), punctate throughout the myoplasm (Fig. 2B
), or in aggregates that exhibited occasional periodicity (Fig. 2C
, arrowheads). As in more severely affected cells, sarcomeric myosin also failed to assemble into A-bands in these myotubes and instead tended to concentrate in the same structures as obscurin (Fig. 2B'
, arrow and C', arrowheads). By contrast,
95% of myotubes infected with control virus showed a regular organization of obscurin at the level of the M-band and Z-disk (Fig. 2D
, big and small arrows, respectively), with sarcomeric myosin expressed at high levels and assembled into A-bands (Fig. 2D'
).
|
As obscurin is an early component of the M-band that is present even before A-bands assemble (10
, 26)
, we examined the effects of siRNA-IIa on two other M-band markers: myomesin and COOH-terminal epitopes of titin (Fig. 3
). In
65% of myotubes infected with the virus encoding siRNA targeting obscurin, the amounts of both myomesin and COOH-terminal epitopes of titin detected by immunofluorescence were dramatically reduced. The normally strong, linear labeling of M-bands was replaced by hazy staining of the myoplasm, with occasional accumulations in short fibrils (Fig. 3A, A' and D, D'
, respectively). In another
35% of infected cells, myomesin and the COOH terminus of titin were detected in the same punctate or filamentous structures as the residual obscurin (Fig. 3B, B'
and E, E', arrows, respectively). Notably, in
95% of myotubes infected with virus encoding control siRNA, both myomesin and the COOH-terminal epitopes of titin were present at M-bands, which appeared to be normal (Fig. 3C, C' and F, F'
, respectively).
|
Contrary to myofibrillar proteins of the A-band and M-band, which were severely disrupted in the absence of obscurin, two markers of the Z-disk,
-actinin and the NH2-terminal region of titin, were not significantly affected by treatment of myotubes with either control virus or virus targeting obscurin. Indeed, the distribution of
-actinin at Z-disks was apparently normal whether the expression of obscurin was inhibited or not (Fig. 4
A, A', D, D', respectively). The same was true for the NH2-terminal region of titin in most (
60%) myotubes depleted of obscurin and in
95% of myotubes infected with control virus (Fig. 4B, B' and E, E'
, respectively). The remaining
40% of cells treated with siRNA-IIa showed extensive disorganization of the N-terminus of titin (Fig. 4C, C'
, arrow).
|
We also examined the subcellular distribution of sAnk1, an integral component of the network SR that directly binds to the COOH-terminus of obscurin and localizes around M-bands and Z-disks of the contractile apparatus (20
, 24)
. The organization of sAnk1 was severely disrupted in myotubes infected with siRNA-IIa virus and instead concentrated in longitudinally oriented structures throughout the myoplasm (Fig. 5
A, A'). In controls, sAnk1 was regularly organized at the level of the M-band, where it coincided with obscurin (Fig. 5B, B'
).
|
To determine whether the reduced immunolabeling of myosin and myomesin in cells treated with the obscurin siRNA virus was due to their specific loss, we collected homogenates of P1 myotubes infected with either control or siRNA-IIa virus and analyzed them by SDS-PAGE, followed by immunoblotting (Fig. 6
A, B). Immunoreactive bands of
220 and
150 kDa that correspond to sarcomeric myosin and myomesin were detected in extracts of cells infected with control siRNA virus, but were severely reduced in extracts of cells infected with the siRNA virus targeting obscurin (P<0.05). By contrast, immunoblots of the same extracts for
-actinin and sAnk1 showed no significant differences (P>0.05; Fig. 6C, D
), consistent with immunofluorescence data (Figs. 4
, 5)
. These results suggest that siRNA targeted to obscurin selectively reduces the levels not only of obscurin, but also of myosin and myomesin, two proteins with which it closely associates in the middle of the sarcomere.
|
We next used RT-PCR to learn whether the down-regulation of obscurin by siRNA affects sarcomeric myosin and myomesin by reducing the amounts of their mRNAs. For these experiments we used primers that specifically amplified sequences in mRNAs encoding myomesin and different muscle myosin forms, including fast IIa, IIb, and IIx, slow I, embryonic and neonatal. P1 myotubes infected with siRNA-IIa (Fig. 6E
) or control virus (Fig. 6F
) expressed similar amounts of myomesin and of the fast IIb, embryonic, and neonatal myosins (P>0.05). Sequences encoding the other forms of skeletal myosin were not detected in experimental or control samples (Fig. 6E
and F, respectively). Products of the RT-PCR reaction with oligonucleotide primers for the isoform of
-actinin present in skeletal muscle were similarly unchanged (Fig. 6E, F
). These results suggest that siRNA viruses that target the expression of obscurin reduce the levels of myosin and myomesin without affecting the transcription or stability of their mRNAs. Thus, the reduced levels of these proteins must be a consequence of the reduced expression of obscurin, which alters their ability to assemble into A-bands and M-bands.
We also used electron microscopy (EM) to examine myotubes treated with siRNA targeting obscurin in order to learn whether the ultrastructural features of the altered A-bands and M-bands in these cells were consistent with their decreased stability. In electron micrographs, myotubes treated with siRNA-IIa, which were severely depleted of obscurin, resembled empty "myosacs" with no discernible structures (not shown). Electron micrographs of longitudinal sections of myotubes treated with siRNA-IIa that were only moderately depleted of obscurin (Fig. 7
A) revealed the total absence of M-bands and the presence of irregular A-bands in regions of the myoplasm that contained Z-disks, which appeared normal. Residual myosin filaments extended uniformly along the entire length of assembled sarcomeres, between neighboring Z-disks, rendering both A- and I-bands indistinct (Fig. 7A
). Consistent with longitudinal views, ultrastructural views of cross sections of such myotubes showed that myosin filaments were less frequent and more poorly organized in myotubes lacking obscurin (Fig. 7C
). By contrast, myotubes infected with control siRNA virus showed regularly organized sarcomeres in longitudinal and cross sections (Fig. 7B, D
). We further analyzed images of cross sections with Fast Fourier transforms (FFT). The transform from a control myotube (Fig. 7D
, inset) showed the typical pattern of myosin filaments equally spaced in a hexagonal array (i.e., six dots surrounding a central core). The transform from a myotube depleted of obscurin (Fig. 7C
, inset) also had densities corresponding to myosin filaments, but the pattern was distorted, reflecting the decreased order in the myosin array. In agreement with this, quantitative measurements of the distances between myosin filaments in the two samples showed that the variance of the distances in myotubes treated with siRNA-IIa virus was significantly higher (s2=7.41 nm, n=4) than in controls (s2=5.46 nm, n=5; P = 0.014, Mann-Whitney U test), although the means were approximately the same39 nm and 40 nm, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
800 kDa), with the aim of determining its roles in myofibrillogenesis and the organization of the sarcoplasmic reticulum (SR). Our earlier results suggested an important role for obscurin in the formation of myosin-rich A-bands (11)
800 kDa form of obscurin has no obvious effect on the assembly of Z-disks and I-bands or on the levels of expression of their major components,
-actinin and actin, respectively. Our results are the first to demonstrate a central role for obscurin, or any protein for that matter, in the assembly and maintenance of sarcomeric A-bands and M-bands, and in the regular alignment of the network SR membranes around the middle of the sarcomere. Thus, like titin and nebulin (39
Early in myofibrillogenesis, obscurin assembles with other M-band proteins, including myomesin, M-protein, and the COOH terminus of titin to form primordial M-bands (26)
. This occurs well before myosin filaments assemble into A-bands, suggesting a possible role for obscurin in A-band formation (10
, 11
, 26)
. Consistent with this, formation of A-bands is specifically inhibited by overexpression of the COOH-terminal region of obscurin (11)
. Our present study further supports this possibility and indicates that obscurin is essential not only for the assembly of thick filaments into A-bands, but also for the formation or maintenance of the M-band lattice. These results are also consistent with the role of UNC-89, obscurins orthologue in C. elegans (41
, 42)
, as mutants lacking UNC-89 have normal numbers of thick filaments but severely disrupted A-bands devoid of M-lines.
At the time of viral infection in our cell system, M-bands have already formed, but sarcomeric myosin is present only in primordial A-bands and has not yet assembled into regular A-bands (11
, 26)
. Thus, the reduced expression of obscurin appears to inhibit the maturation of A-bands and impair the stability of M-bands. This is consistent with the early localization of obscurin at M-bands of differentiating muscle cells, where it may stabilize a core complex of titin and myomesin at the middle of each sarcomere, on which thick filaments later assemble (18)
. Remarkably, the absence of these structures, when obscurin levels are reduced, has no significant effect on the assembly of two other key sarcomeric elementsZ-disks and I-bandsperhaps because obscurins association with these structures occurs only late in the process of myofibrillogenesis. Although the NH2-terminus of titin was disorganized in
40% of treated cells, this was likely an indirect effect of its failure to anchor to the M-band. This agrees with reports that disruption of the COOH-terminus of titin in cultured skeletal myoblasts by gene targeting affected its organization at the Z-line (43)
, and that electroporation of an antititin antibody (Ab) targeted to its M-band disrupted its assembly at Z-disks as well as M-bands (12)
.
In contrast to the reduction of obscurin in cells treated with targeted siRNA, which directly correlates with the reduction in its mRNA, the reduction of myosin and myomesin appears to be due to translational or posttranslational regulatory processes. Although obscurin may contribute to the rate of synthesis or turnover of sarcomeric proteinsfor example, through its signaling domainsthe loss of myosin and myomesin in treated myotubes is more likely due to increased degradation linked to their failure to incorporate into sarcomeres. This is consistent with our previous report of a mild diminution of myosin levels in myotubes in which the COOH-terminal region of obscurin was overexpressed (11)
. Notably, the effects of reducing the overall levels of obscurin in developing myotubes are greater than the effects of overexpressing the COOH-terminal region of the molecule, which inhibits the assembly of A-bands but has no effect on M-bands, Z-disks, or I-bands (11)
. Our current results suggest that domains of obscurin in addition to those at the COOH-terminus are important for the assembly or stability of M-bands and are likely to be required for the subsequent assembly of A-bands.
Unlike myosin and myomesin, which are lost when obscurin levels are reduced, sAnk1 remains stably associated with intracellular membranes, consistent with its identity as an integral protein of the SR. Remarkably, however, the SR fails to organize around the contractile elements when obscurin is depleted. This supports our hypothesis that interactions between obscurin at the periphery of the M-band and proteins in the SR, such as sAnk1, organize the network SR in its stereotypical pattern around the middle of each M-band of the sarcomere.
Our studies show that down-regulation of the
800 kDa form of obscurin results in the failure of two important structures to form A-bands and their central M-bands, and the network compartment of the SR. Thus, our findings are the first to demonstrate a role for obscurin in assembling and stabilizing M-bands and A-bands and in linking the contractile apparatus to the network SR in vertebrate skeletal muscle. Since multiple obscurin isoforms are produced by alternative splicing (21
, 23)
, there may be isoforms that are not targeted by our siRNA constructs. Certainly, the expression of the small kinase isoforms of obscurin-MLCK, which have a distinct translation initiation site (21)
, would not be directly affected by these siRNAs. However, they do appear to target many, if not all, of the isoforms derived from the
25 kb mRNA transcript, as indicated by the diminished abundance of all of the RT-PCR products tested in this study (Fig. 1C, D
). Still, given the potential for obscurin and obscurin-MLCK isoforms to remain unaffected by our siRNA constructs, as well as the limitations of our model, we cannot rule out the possibility that some forms of obscurin may play additional roles in myofibrillogenesis, including roles at the Z-disk, in the lateral association of myofibrils, or in the links between superficial myofibrils and the sarcolemma. Further studies are required to determine the additional functions of obscurin and its isoforms in sarcomerogenesis, and more generally in the physiology of striated muscle.
| ACKNOWLEDGMENTS |
|---|
Received for publication January 18, 2006. Accepted for publication May 25, 2006.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. A. Ackermann, L.-Y. R. Hu, A. L. Bowman, R. J. Bloch, and A. Kontrogianni-Konstantopoulos Obscurin Interacts with a Novel Isoform of MyBP-C Slow at the Periphery of the Sarcomeric M-Band and Regulates Thick Filament Assembly Mol. Biol. Cell, June 15, 2009; 20(12): 2963 - 2978. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Coisy-Quivy, O. Touzet, A. Bourret, R. A. Hipskind, J. Mercier, P. Fort, and A. Philips TC10 controls human myofibril organization and is activated by the sarcomeric RhoGEF obscurin J. Cell Sci., April 1, 2009; 122(7): 947 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Cusimano, F. Pampinella, E. Giacomello, and V. Sorrentino Assembly and dynamics of proteins of the longitudinal and junctional sarcoplasmic reticulum in skeletal muscle cells PNAS, March 24, 2009; 106(12): 4695 - 4700. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Cunha and P. J. Mohler Obscurin Targets Ankyrin-B and Protein Phosphatase 2A to the Cardiac M-line J. Biol. Chem., November 14, 2008; 283(46): 31968 - 31980. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Bowman, D. H. Catino, J. C. Strong, W. R. Randall, A. Kontrogianni-Konstantopoulos, and R. J. Bloch The Rho-Guanine Nucleotide Exchange Factor Domain of Obscurin Regulates Assembly of Titin at the Z-Disk through Interactions with Ran Binding Protein 9 Mol. Biol. Cell, September 1, 2008; 19(9): 3782 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fukuzawa, S. Lange, M. Holt, A. Vihola, V. Carmignac, A. Ferreiro, B. Udd, and M. Gautel Interactions with titin and myomesin target obscurin and obscurin-like 1 to the M-band - implications for hereditary myopathies J. Cell Sci., June 1, 2008; 121(11): 1841 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. R. Healy, F. Zhu, J. D. Stull, and K. Konstantopoulos Elucidation of the signaling network of COX-2 induction in sheared chondrocytes: COX-2 is induced via a Rac/MEKK1/MKK7/JNK2/c-Jun-C/EBP{beta}-dependent pathway Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1146 - C1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Lowe, O. Palygin, N. Bhasin, T. J. Hund, P. A. Boyden, E. Shibata, M. E. Anderson, and P. J. Mohler Voltage-gated Nav channel targeting in the heart requires an ankyrin-G dependent cellular pathway J. Cell Biol., January 10, 2008; 180(1): 173 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Borzok, D. H. Catino, J. D. Nicholson, A. Kontrogianni-Konstantopoulos, and R. J. Bloch Mapping the Binding Site on Small Ankyrin 1 for Obscurin J. Biol. Chem., November 2, 2007; 282(44): 32384 - 32396. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |