FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giroux, V.
Right arrow Articles by Dagorn, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giroux, V.
Right arrow Articles by Dagorn, J.-C.
(The FASEB Journal. 2006;20:1982-1991.)
© 2006 FASEB

Probing the human kinome for kinases involved in pancreatic cancer cell survival and gemcitabine resistance

Valentin Giroux, Juan Iovanna and Jean-Charles Dagorn1

INSERM U624, Stress Cellulaire, Parc Scientifique et Technologique de Luminy, Marseille, France

1Correspondence: Centre de Recherche INSERM, Unité 624, Stress Cellulaire, Parc Scientifique et Technologique de Luminy, case 915, 13288 Marseille Cedex 9, France. E-mail: dagorn{at}marseille.inserm.fr


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Except for gemcitabine, chemotherapeutic agents are ineffective with pancreatic adenocarcinoma because this cancer is resistant to apoptosis induction. Involvement of specific kinases in such resistance is likely. We developed a systematic strategy to screen the human kinome and select kinases whose inhibition in pancreatic cancer cells can increase 1) spontaneous apoptosis or 2) gemcitabine-induced apoptosis. The pancreatic adenocarcinoma cell line MiaPaCa-2 was transfected with 645 pairs of siRNAs directed to all human kinases. The same experiment was conducted in cells treated with 150 µM gemcitabine. Apoptosis was measured after 2 days and the results were normalized for cell viability. A panel of 56 kinases whose inhibition increased spontaneous apoptosis by at least 50% was established. Ten of them gave similar results on Panc1 and BxPC3 pancreatic adenocarcinoma cell lines. A panel of 83 kinases whose inhibition increased gemcitabine-induced apoptosis by 50% or more was also established. Twelve kinases appeared in both panels. A cumulative increase in apoptosis was observed when inhibiting simultaneously several kinases. Such a systematic approach allowed characterization of all kinases involved in pancreatic cancer cell survival and resistance to gemcitabine. Inhibitors of these kinases, used alone or in combination, might improve the treatment of pancreatic adenocarcinoma.—Giroux, V., Iovanna, J., Dagorn, J-C. Probing the human kinome for kinases involved in pancreatic cancer cell survival and gemcitabine resistance.


Key Words: apoptosis • pancreatic adenocarcinoma • chemotherapy


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
DESPITE MUCH EFFORT, the last decades have seen little progress in the treatment of pancreatic adenocarcinoma (1) . The 5 year survival rate remains <5%, except for patients whose cancer is diagnosed early enough to allow surgical resection. But this applies to only 10–20% of patients, whose 5 year survival can increase to 20%, which is still low. Classical chemotherapeutic agents that are efficient in other cancers have no effect on the pancreas. The cytosine analog gemcitabine is the only molecule that provides some survival benefit to patients with an advanced stage of the disease (2) , but survival improvement is limited, and attempts to increase gemcitabine efficacy by modulating pharmacokinetic parameters or by using the drug in combination with conventional cytotoxic drugs such as oxaliplatin have led to modest results (3 , 4) . More recently, new drugs such as inhibitors of farnesyltransferase and of matrix metalloproteases, cyclooxygenase-2, and lipoxygenase have entered clinical trials, but the first evaluations are not encouraging (5) . The failure of present anticancer strategies means that new directions should be explored. One possibility would be to target the mechanisms by which cancer cells escape apoptosis. We formed the hypothesis that such mechanisms involve specific kinases because several regulatory steps requiring protein or lipid phosphorylation have been described in all intracellular pathways. Our goal therefore was to identify the kinase(s) whose inhibition would decrease the resistance of pancreatic cancer cells to apoptosis. In addition, because many patients are resistant to gemcitabine, even though it is the only treatment for pancreatic cancer that shows some efficacy, we wanted to identify the kinases whose inhibition can increase gemcitabine-induced apoptosis. These kinases are potential therapeutic targets for pancreatic cancer, and the extensive knowledge already available on kinase inhibitors (6) should facilitate the design and development of efficient drugs. We took advantage of the recent description of the complete human kinome (7) to develop a systematic approach by which all 645 known and putative kinases were individually inhibited by specific siRNAs in pancreatic cancer-derived cells, and the consequences of the inhibitions on apoptosis were monitored. A similar approach has been used successfully by other groups to select survival kinases in HeLa cells (8) and to identify Akt-cooperating survival kinases in a renal carcinoma cell line (9) . We identified two groups of survival kinases: one involved in spontaneous apoptosis (n=56), the other in gemcitabine-induced apoptosis (n=83).


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 REFERENCES
 
Cell lines and cell culture conditions
The human pancreatic cancer cell lines MiaPaCa-2 and Panc1 were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS, 2 mM L-glutamine, 100 IU/ml penicillin G, and 100 µg/ml streptomycin. BxPc3 cells were cultivated in RPMI 1640 medium in the presence of 2 mM L-glutamine, 4.5 g/l glucose (Glc), 10 mM HEPES, 1 mM sodium pyruvate, 10% FBS, 100 IU/ml penicillin G, and 100 µg/ml streptomycin. All cell lines were routinely cultivated in a humidified 5% CO2 atmosphere.

siRNA library
A custom siRNA human kinase set comprising two siRNA duplexes for each of the 645 target genes was obtained from Qiagen (Chatsworth, CA, USA). The design of siRNA sequences is critical for efficient gene silencing. The siRNA library was designed with new algorithms, taking into account siRNA sequence base composition (G + C/A + T content), secondary structure of the target mRNA, and position effects within the mRNA, then choosing the best sequence motifs to ensure that the siRNA sequence targets a single kinase. The selected siRNAs were searched against the human genome sequence with a basic local alignment search tool (BLAST) to ensure that only one gene was targeted and that the nonsilencing siRNA used as control had no known overlap. Efficiency of the siRNAs was tested by the manufacturer, and we ensured that silencing was indeed significant in our cell lines. For each target, the two siRNA duplexes provided in the library were combined and arrayed in a 96-well format.

Apoptosis assay
MiaPaCa-2, BxPc3, or Panc1 cells were seeded for 24 h in 96-well plates (10,000 cells/well), then cells from each well were transfected with a mixture of 50 nM siRNA duplex 1 and 50 nM duplex 2 corresponding to a given kinase, using X-tremeGENE siRNA Transfection Reagent (Roche, Nutley, NJ, USA). In each siRNA screen, scrambled siRNAs were used as negative controls. After 48 h, apoptosis was assessed by an ELISA that quantifies cytoplasmic nucleosomes produced during apoptosis (Cell Death Detection ELISA plus, Roche). The 96-well plates were centrifuged (200 g) for 10 min, the supernatant was discarded, and lysis buffer was added. After lysis, the samples were centrifuged and 20 µl of the supernatant was transferred to a streptavidin-coated microtiter plate. Biotin-labeled antihistone antibodies and peroxidase conjugated anti-DNA antibodies were added to each well and the plate was incubated at room temperature for 2 h. After three washes with buffer, the peroxidase substrate was added to each well to quantitate the captured nucleosomes. After a 5 min incubation, the plates were read at 405 nm in a microplate reader. The enrichment in histone-DNA fragments is expressed as a fold increase in absorbance compared with control (nonsilencing) siRNA. Protein kinase A was considered a survival kinase when, after normalization for viability (see below), its inhibition increased apoptosis by > 50% over scrambled siRNA control. Experiments were repeated two or three times.

Gemcitabine treatment
104 cells/well were seeded on 96-well plate in 100 µl culture medium. The next day, pancreatic cells were transfected with siRNA mixtures as described above. Twenty-four hours later, gemcitabine (2',2'-difluorodeoxycytidine purchased from Eli Lilly; Indianapolis, IN, USA) was added in 100 µl of culture medium to a final concentration of 150 µM. After 48 h, cytoplasmic histone-DNA fragments produced during apoptosis and cell viability were assessed. Experiments were repeated two or three times.

Viability assay
Two days after siRNA transfection, 10 µl of the MTS reagent mixture (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) obtained from Promega (Madison, WI, USA) was added per well, the plates were incubated at 37°C for 45 min, and the absorbance at 490 nm was recorded. The percentage of viable cells in a well was obtained from the ratio of absorbances of cells transfected with kinases siRNAs to cells transfected with control siRNAs

Expression of kinases in human pancreatic cancer
Human pancreatic samples were obtained during pancreatectomy (Hôpital Nord, Marseille, France), using procedures in agreement with the local Ethical Committee. Total RNA from samples was isolated by standard procedures using Trizol (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized in a 20 µl reaction mix with 1 µg total RNA using Expand Reverse Transcriptase (Roche). Initially, RNA was incubated with 1 µl random primers for 10 min at 65°C, then quickly put on ice. After adding 4 µl reaction buffer, 2 µl DDT, 20 nmol dNTP, 0.5 µl RNase inhibitor, and 1 µl reverse trancriptase, the reaction was incubated for 10 min at 30°C, then for 45 min at 42°C. Five microliter samples of 10-fold diluted cDNA were specifically amplified with either PAK7 (sense: AGAAGTTTACCGGCCT; antisense: CTTTTCGGTCGTGTAGT), CSNK2{alpha}1 (sense: ATCTTTCGGAAGGAGCCATT; antisense: TATCGCAGCAGTTTGTCCAG), AK1 (sense: GACGCCCTAAAGTAGCAACG; antisense: GTGCTCAGCTGTCCATGAAA), GRAF (sense: GCTGTGGTGGTTTTCAAGGT; antisense: AGCCTCTTTTCACCAGCAAA) or MAP3K7 primers (sense: ACTCACTTGATGCGGT; antisense: CGGCGATCCTAGCTTC) with GoTaq DNA Polymerase (Invitrogen). As a control, the cDNA coding for the GAPDH protein was specifically amplified (sense: GGGAAGCTCACTGGCATGGCCTTCC; antisense: CATGTGGGCCATGAGGTCCACCAC). Polymerase chain reaction (PCR) was carried out for 2 min at 95°C, followed by 24–32 cycles, each cycle consisting of a denaturing step for 30 s at 95°C, an annealing step for 30 s at 57°C, and a polymerization step for 30 s at 72°C. PCR products were separated on a 2.0% agarose gel containing ethidium bromide and photographed under UV light.


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
REFERENCES
 
Inhibition of kinase expression in pancreatic cancer-derived cells
We conducted a systematic screening in vitro of all human kinases to identify those whose inhibition increases sensitivity of the cells to apoptosis. MiaPaCa-2 cells were chosen among available pancreatic-derived cancer cells to conduct the first screening because they are known to be particularly resistant to apoptosis (10) . Our purpose was not the molecular characterization of antiapoptotic pathways, but rather to establish a catalog of kinases whose inhibition could offer a new therapeutic strategy for pancreatic cancer. Cells were grown in 96-well plates, then transfected with a commercial panel of siRNAs directed to all human kinases, two siRNAs being provided for each kinase. Efficiency of transfection under our experimental conditions was close to 95% as judged by transfecting a fluorescent siRNA (data not shown). The efficacy of inhibition by the two siRNAs provided for each kinase had been previously controlled by the manufacturer. As a further control, we checked 20 kinases chosen at random to determine that inhibition was indeed >70% (data not shown). After 48 h of transfection, apoptosis was measured using a histone-DNA fragmentation ELISA and normalized to viability over scrambled siRNA control (Fig. 1 ). The entire experiment was conducted twice. In the screen, kinases whose siRNAs increased cell death by at least 50% over control siRNAs in both experiments were defined as survival kinases. Of the 645 tested kinases, 56 complied with these criteria (Table 1 ). To check whether some of these results could be artifactual due to "off-target" effects, we transfected cells with the two siRNAs separately. Results were similar to those observed on cotransfection (data not shown). Finally, our goal being to identify clinically relevant targets, we checked to see whether the selected kinases were specifically involved in the survival of MiaPaCa-2 cells or if they would promote survival of other pancreatic cancer cell lines. Ten relevant kinases were tested in two other human pancreatic cancer cell lines with different genetic backgrounds, BxPc3 and Panc1 (11) . Inhibiting the kinases promoted significant apoptosis in both cell lines (Table 2 ), with a stronger effect in BxPc3 than in MiaPaCa-2 or Panc1, probably because BxPc3 are more differentiated (11) . We concluded that the selected kinases could be representative of pancreatic cancer cell survival kinases.


Figure 1
View larger version (10K):
[in this window]
[in a new window]
  		Figure 1. Influence of kinase inhibition on the apoptosis rate in MiaPaCa-2 cells. Each bar represents the result of the inhibition by specific siRNAs of one of the 645 human kinases. Kinases whose inhibitions induced the strongest inductions of apoptosis are identified.


View this table:
[in this window]
[in a new window]
  		Table 1. Functional categories of pancreatic cancer cell survival kinasesa


View this table:
[in this window]
[in a new window]
  		Table 2. Fold increase of apoptosis in Bx-PC3 and Panc-1 cancer cell lines upon inhibition of 10 kinases selected for protecting Mia-PaCa2 cells from apoptosis

Kinases whose inhibitions have the strongest impact on apoptosis
When selected kinases were classified according to their effect on apoptosis (Table 1) , the most potent were PAK7 (also called PAK5), CSNK2A1, MAP3K7, AK1, and GRAF, their inhibition increasing apoptosis by >2.5-fold. None is yet recognized as a survival kinase in pancreatic cancer cells, but PAK7, CSNK2A1, and MAP3K7 are known to be directly involved in the regulation of apoptosis.

PAK7 is a member of the p21-activated kinase family that prevents apoptosis induced by campotothecin, a topoisomerase I inhibitor, and by C2-ceramide (12) . PAK7 expression inhibits PARP and caspase 3 cleavages, and, most important, promotes the phosphorylation of the antiapoptotic protein BAD on Ser-112, then of Ser-136 via the activation of Akt. As a consequence, PAK7 prevents BAD translocation to mitochondria, blocking an essential step in the triggering of apoptosis (12) . These results are consistent with our finding that inhibiting PAK7 expression induces a 7-fold increase in MiaPaCa-2 apoptosis.

Casein kinase 2 (CK2) is a tetrameric messenger-independent serine/threonine kinase consisting of two catalytic and two regulatory subunits (13) . CSNK2A1 is one of the catalytic subunits of the tetramer. Gene disruption experiments in yeast and slime mold demonstrated that casein kinase 2 is essential for viability (14 , 15) . A failure of kinase-inactive casein kinase 2 to restore viability in yeast indicates that the catalytic activity of casein kinase 2, and not just the presence of casein kinase 2 protein, is required for viability, which underscores the importance of CSNK2A1 in vital processes. Biochemical and genetic evidence indicates that casein kinase 2 participates in several other cellular functions, including cell cycle progression, in cooperation with H-Ras. Apparently casein kinase 2 exerts its antiapoptotic role by protecting regulatory proteins from caspase-mediated degradation. Overexpression of CK2 has been associated with lung, breast, and prostate cancers. In breast cancer, CK2 induces functional IKK-i/IKK epsilon, an important mediator of the activation of NF-{kappa}B that plays a critical role in the pathogenesis (16) , whereas in prostate cancer cells, CK2 promotes suppression of drug-mediated apoptosis via the death receptors (13 14 15 16 17) . These data confirm CSNK2A1 as an interesting target to promote apoptosis in cancer cells.

Fewer studies have addressed the function of MAP3K7, also known as TAK1 (TGFß-activated kinase 1). However, it is known that inhibition of apoptosis by IAPs, which occurs through direct caspase activation, can also occur through MAP3K7 activation, which triggers c-Jun NH2-terminal kinase (JNK) and NF-{kappa}B inductions (18) . Yet other studies show that MAP3K7 is clearly linked to cancer progression, because WNT/PCP signals are transduced to the NLK signaling cascade through MAP3K7 and aberrant activation of WNT/PCP signaling pathway in human cancer leads to more malignant phenotypes, such as abnormal tissue polarity, invasion, and metastasis (19) . Therefore, activity of the MAP3K7 seems to be critical for cell survival.

Contrary to PAK7, CSNK2A1, and MAP3K7, AK1 and GRAF have never been associated with apoptosis. AK1 is a cytosolic enzyme that catalyzes the phosphoryl transfer reaction AMP+ATP <=> ADP to harvest energy from the ß-phosphoryl group of ADP. AK1 is therefore an important regulator of the adenine nucleotide pool of the cell that is determinant in energy storage. AK1-catalyzed phosphotransfer was found to be essential to the management of energy economy in several tissues. As a result, AK1 gene disruption decreases cell tolerance to metabolic stress, which could possibly lead to cell death by apoptosis (20) ; to our knowledge, however, our data are the first report of a direct link between AK1 inactivation and apoptosis. In the literature, the link between GRAF and apoptosis is even thinner. GRAF binds pp125FAK, one of the tyrosine kinases regarded as critical in the integrin signaling transduction pathways. Binding occurs in the C-terminal region of pp125FAK, through SH3 domains, and stimulates the GTPase activity of the GTP binding protein RhoA (21) . GRAF therefore mediates the cross-talk between tyrosine kinases such as focal adhesion kinase F-actin (FAK) and the Rho family GTPase to control steps in integrin-initiated signaling events. Selecting GRAF and AK1 among important kinases for pancreatic cancer cell survival was completely unexpected, which opens up new therapeutic options for this cancer.

To assess the clinical relevance of the most important survival kinases identified in our screening, we checked their expression in pancreatic cancer biopsies. As shown in Fig. 2 , all five kinases were actually expressed in normal pancreas, in the five samples of pancreatic adenocarcinoma, and in the two hepatic metastases of pancreatic cancer, which supports the idea that they might be therapeutic targets.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
  		Figure 2. RT-polymerase chain reaction (RT-PCR) monitoring of the expression of the 5 kinases whose inhibition induces the strongest induction of apoptosis (PAK7, CNSK2A1, AK1, GRAF, and MAP3K7) in normal pancreas, pancreatic adenocarcinoma, and metastases of pancreatic cancer. GAPDH expression was used as control.

Simultaneous inhibition of kinases led to additive effects
The ultimate goal of this work is to provide information allowing eventual development of anticancer drugs adapted to pancreatic adenocarcinoma. Because practical constraints (e.g., toxicity, bioavailability) may prevent the use of inhibitors of interesting kinases at sufficient doses, we investigated the possibility that simultaneous inhibition of several kinases shows additive effects on apoptosis. In that case, giving the patient a cocktail of inhibitors could limit side effects while achieving good efficacy. Obviously, testing all combinations of all selected kinases was beyond the scope of this paper. We chose among the 56 selected kinases three kinases involved in distinct pathways, CSNK2A1, PRKCI, and HRI, and compared the influences on apoptosis of their inhibitions, alone or in combination. When CSNK2A1, PRKCI, or HRI siRNAs were separately transfected in MiaPaCa-2 cells, apoptosis was increased 3.1-, 1.9-, and 2.0-fold, respectively. When two of them were simultaneously inhibited, the increases were 4.1-, 4.3-, and 3.3-fold for CSNK2A1+PRKCI, CSNK2A1+HRI, and PRKCI+HRI, respectively. Finally, when the three siRNAs were transfected together, apoptosis was further increased (by 5.2-fold) (Fig. 3 ). Apoptosis measurements are not accurate enough to state that the effects are strictly additive, but they are clearly cumulative. The same experiments of combined kinase inhibitions performed in BxPc3 cells revealed more dramatic increases in apoptosis, as expected from results described above showing that BxPc3 cells were more sensitive to apoptosis than MiaPaCa-2 cells (Fig. 3) . The potential interest of combining the inhibitions of several kinases was confirmed in both cell lines with another set of three siRNAs corresponding to kinases AK1, PRKD2, and MAP3K7 (Fig. 3) . These results support the premise that the simultaneous targeting of several kinases would increase the promotion of apoptosis in pancreatic cancer cells.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
  		Figure 3. Influence of the simultaneous inhibition of kinases on the apoptosis rate of MiaPaCa-2 and BxPc3 cells. The effect on apoptosis of inhibiting CSNK2A1, PRKC1, and HR1 (upper panel) or AK1, PRKD2, and MAP3K7 (lower panel) is cumulative.

Cell-type dependence of the survival pathways
Our results indicate that ~ 8.5% of kinases are important for pancreatic cancer cell survival. A similar siRNA approach was recently used to identify survival kinases in HeLa cells, and 73 kinases (~11% of the kinome) were eventually selected (8) . Only 13 of these kinases are also present in our 56 kinase panel (Table 1) , suggesting that survival mechanisms can be different in different cell types. This observation and several reports that kinase inhibitors that are efficient in certain cancers are ineffective in others offer hope that inhibitors of the survival kinases that show some specificity for pancreatic cancer will improve pancreatic cancer treatment, with limited adverse effects on other tissues. This is an important issue because side effects of anticancer drugs often restrain their use.

Increasing sensitivity to gemcitabine by knocking-down kinases
Gemcitabine has become the standard first-line treatment for patients with pancreatic cancer. When used as monotherapy, gemcitabine results in a tumor response rate of only 12% and offers a median survival time of 5 months (2) . Gemcitabine is supposed to promote cancer cell apoptosis, suggesting that inhibiting the kinases that prevent gemcitabine-induced apoptosis might evoke a response in gemcitabine-resistant patients and, in the others, might increase the efficacy of the drug. Ng et al. (22) have shown that inhibitors of the PI3K-AKT increased sensitivity of pancreatic cancer cells to gemcitabine, and Duxbury et al. (23) demonstrated that Src kinase inhibitors potentiated gemcitabine-induced apoptosis in Panc1 cells. Based on the same experimental set-up as above, we used MiaPaCa-2 cells to screen the kinase siRNA library by assessing apoptosis in the presence of a low dose of gemcitabine. We identified 83 kinases that, when down-regulated, increased cellular sensitivity to gemcitabine-induced apoptosis by > 50% (Fig. 4 ). Among them, MAPKAP1, MAK, PAK4, ADRBK1, and PIK3CG were the most active, suggesting that adjuvant treatment with their inhibitors would improve gemcitabine treatment. Inhibition of MAPKAP1, also called RSK2 or ISPK, inhibits proliferation of prostate cancer cell lines (24) . MAK activity is enhanced in prostate cancer cells (25) , and ADRBK1 (also called GRK2) activity is increased in differentiated thyroid carcinoma compared with normal thyroid tissue (26) , but there is no report that inhibition of these kinases will affect apoptosis. Selecting PIK3CG, a catalytic subunit of PI3K, confirms the importance of the PI3K-AKT pathway in the limitation of gemcitabine activity (22) . PI3K-AKT is activated in many malignancies, including pancreatic carcinoma (27) , which supports the therapeutic relevance of PIK3CG inhibitors in pancreatic cancer treatment. However, the fact that it is down-regulated in colon cancer (28) supports the tissue specificity of survival kinases already suggested by a comparison of our findings and those in HeLa cells (8) . Finally, we found that Src inhibition did not alter the response of cells to gemcitabine, contrary to previous data (23) . One explanation could be that the pancreatic cell line used in that work was derived from Panc1 by selection for resistance to gemcitabine. The selection process might have favored Src-linked resistance mechanisms at the expense of the original resistance pathways. Table 3 shows that 12 kinases were selected in the two screenings addressing "spontaneous" and gemcitabine-induced apoptosis, of which 10 were not selected in the HeLa screening already mentioned (8) . They may represent the best target for adjuvant therapy when gemcitabine is combined with another drug such as oxaliplatin (3) .


Figure 4
View larger version (15K):
[in this window]
[in a new window]
  		Figure 4. Influence of kinase inhibition on gemcitabine-induced apoptosis in MiaPaCa-2 cells. Each bar represents the result of the inhibition by specific siRNAs of one of the 645 human kinases. Kinases whose inhibitions induced the strongest inductions of apoptosis are identified.


View this table:
[in this window]
[in a new window]
  		Table 3. Functional categories of kinases involved in resistance of pancreatic cancer cells to gemcitabinea

In conclusion, we show after systematic analysis of all human kinases that a few favor survival of pancreatic cancer cells in the absence of specific induction of apoptosis or upon exposure to gemcitabine. Preclinical and clinical studies might eventually select, among inhibitors of these kinases, the best candidates for pancreatic cancer treatment. Of course, decreasing resistance to apoptosis is not the only way to prevent pancreatic cancer development (29 30 31) . Targeting angiogenesis is another promising way (29 30) , which suggests that the solution perhaps lies in combined strategies addressing several pathways required for cancer development.


   ACKNOWLEDGMENTS
 
The technical assistance of P. Spoto and J. Tardivel-Lacombe is acknowledged. This work was supported by grants from INSERM and the Canceropole PACA.

Received for publication March 30, 2006. Accepted for publication May 22, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Jemal, A., Tiwari, R. C., Murray, T., Ghafoor, A., Samuels, A., Ward, E, Feuer, E. J., Thun, M. J. (2004) Cancer statistics. CA Cancer J. Clin. 54,8-29[Abstract/Free Full Text]
  2. Burris, H. A., Moore, M. J., Andersen, J., Green, M. R., Rothenberg, M. L., Modiano, M. R., Cripps, M. C., Portenoy, R. K., Storniolo, A. M., Tarassoff, P., et al (1997) Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial. J. Clin. Oncol. 15,2403-2413[Abstract/Free Full Text]
  3. Richards, D. A. (2005) Chemotherapeutic gemcitabine doublets in pancreatic carcinoma. Semin. Oncol. 32,S9-S13[CrossRef][Medline]
  4. Demols, A., Peeters, M., Polus, M., Marechal, R., Gay, F., Monsaert, E., Hendlisz, A., Van Laethem, J. L. (2006) Gemcitabine and oxaliplatin (GEMOX) in gemcitabine refractory advanced pancreatic adenocarcinoma: a phase II study. Br. J. Cancer 94,481-485[CrossRef][Medline]
  5. Friberg, G., Kindler, H. L. (2005) Chemotherapy for advanced pancreatic cancer: past, present, and future. Curr. Oncol. Rep. 7,186-195[Medline]
  6. Cohen, M. S., Zhang, C., Shokat, K. M., Taunton, J. (2005) Structural bioinformatics-based design of selective, irreversible kinase inhibitors. Science 308,1318-1321[Abstract/Free Full Text]
  7. Manning, G., Whyte, D. B., Martinez, R., Hunter, T., Sudarsanam, S. (2002) The protein kinase complement of the human genome. Science 298,1912-1934[Abstract/Free Full Text]
  8. MacKeigan, J. P., Murphy, L. O., Blenis, J. (2005) Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nature Cell Biol. 7,591-600[CrossRef][Medline]
  9. Morgan-Lappe, S., Woods, K. W., Li, Q., Anderson, M. G., Schurdak, M. E., Luo, Y, Giranda, V. L., Fesik, S. W., Leverson, J. D. (2006) RNAi-based screening of the human kinome identifies Akt-cooperating kinases: a new approach to designing efficacious multitargeted kinase inhibitors. Oncogene 2,1340-1348[CrossRef]
  10. Giroux, V., Malicet, C., Barthet, M., Gironella, M., Archange, C., Dagorn, J. C., Vasseur, S., Iovanna, J. L. (2006) p8 is a new target of gemcitabine in pancreatic cancer cells. Clin. Cancer Res. 12,235-241[Abstract/Free Full Text]
  11. Sun, C, Yamato, T, Furukawa, T, Ohnishi, Y, Kijima, H., Horii, A. (2001) Characterization of the mutations of the K-ras, p53, p16, and SMAD4 genes in 15 human pancreatic cancer cell lines. Oncol. Rep. 8,89-92[Medline]
  12. Cotteret, S., Jaffer, Z. M., Beeser, A., Chernoff, J. (2003) p21-Activated kinase 5 (Pak5) localizes to mitochondria and inhibits apoptosis by phosphorylating BAD. Mol. Cell. Biol. 23,5526-5539[Abstract/Free Full Text]
  13. Litchfield, D. W. (2003) Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochem. J. 369,1-15[CrossRef][Medline]
  14. Kikkawa, U., Mann, S. K., Firtel, R. A., Hunter, T. (1992) Molecular cloning of casein kinase II alpha subunit from Dictyostelium discoideum and its expression in the life cycle. Mol. Cell. Biol. 12,5711-5723[Abstract/Free Full Text]
  15. Glover, C. V. (1998) On the physiological role of casein kinase II in Saccharomyces cerevisiae. Prog. Nucleic Acids Res. Mol. Biol. 59,95-133[Medline]
  16. Eddy, S. F., Guo, S., Demicco, E. G., Romieu-Mourez, R., Landesman-Bollag, E., Seldin, D. C., Sonenshein, G. E. (2005) Inducible IkappaB kinase/IkappaB kinase epsilon expression is induced by CK2 and promotes aberrant nuclear factor-kappaB activation in breast cancer cells. Cancer Res. 65,11375-83[Abstract/Free Full Text]
  17. Meggio, F., Pinna, L. A. (2003) One-thousand-and-one substrates of protein kinase CK2?. FASEB J. 17,349-368[Abstract/Free Full Text]
  18. Shim, J. H., Xiao, C., Paschal, A. E., Bailey, S. T., Rao, P., Hayden, M. S., Lee, K. Y., Bussey, C., Steckel, M., Tanaka, N., Yamada, G., Akira, S., Matsumoto, K., Ghosh, S. (2005) TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev. 19,2668-2681[Abstract/Free Full Text]
  19. Katoh, M. (2005) WNT/PCP signaling pathway and human cancer. Oncol. Rep. 14,1583-8[Medline]
  20. Janssen, E., Dzeja, P. P., Oerlemans, F., Simonetti, A. W., Heerschap, A., de Haan, A., Rush, P. S., Terjung, R. R., Wieringa, B., Terzic, A. (2000) Adenylate kinase 1 gene deletion disrupts muscle energetic economy despite metabolic rearrangement. EMBO J. 19,6371-6381[CrossRef][Medline]
  21. Taylor, J. M., Macklem, M. M., Parsons, J. T. (1999) Cytoskeletal changes induced by GRAF, the GTPase regulator associated with focal adhesion kinase, are mediated by Rho. J. Cell Sci. 112,231-242[Abstract]
  22. Ng, S. S. W., Tsao, M. S., Chow, S., Hedley, D. W. (2000) Inhibition of phosphatidylinositide 3-kinase enhances gemcitabine-induced apoptosis in human pancreatic cancer cells. Cancer Res. 60,5451-5455[Abstract/Free Full Text]
  23. Duxbury, M. S., Ito, H., Zinner, M. J., Ashley, S. W., Whang, E. E. (2004) Inhibition of SRC tyrosine kinase impairs inherent and acquired gemcitabine resistance in human pancreatic adenocarcinoma cells. Clin. Cancer Res. 10,2307-2318[Abstract/Free Full Text]
  24. Clark, D. E., Errington, T. M., Smith, J. A., Frierson, H. F., Jr, Weber, M. J., Lannigan, D. A. (2005) The serine/threonine protein kinase, p90 ribosomal S6 kinase, is an important regulator of prostate cancer cell proliferation. Cancer Res. 65,3108-3116[Abstract/Free Full Text]
  25. Jia, L., Coetzee, G. A. (2005) Androgen receptor-dependent PSA expression in androgen-independent prostate cancer cells does not involve androgen receptor occupancy of the PSA locus. Cancer Res. 65,8003-8008[Abstract/Free Full Text]
  26. Metaye, T., Menet, E., Guilhot, J., Kraimps, J. L. (2002) Expression and activity of G protein-coupled receptor kinases in differentiated thyroid carcinoma. J. Clin. Endocrinol. Metab. 87,3279-3286[Abstract/Free Full Text]
  27. Bondar, V. M., Sweeney-Gotsch, B., Andreeff, M., Mills, G. B., McConkey, D. J. (2002) Inhibition of the phosphatidylinositol 3'-kinase-AKT pathway induces apoptosis in pancreatic carcinoma cells in vitro and in vivo. Mol. Cancer Ther. 1,989-997[Abstract/Free Full Text]
  28. Semba, S., Itoh, N., Ito, M., Youssef, E. M., Harada, M., Moriya, T., Kimura, W., Yamakawa, M. (2002) Down-regulation of PIK3CG, a catalytic subunit of phosphatidylinositol 3-OH kinase, by CpG hypermethylation in human colorectal carcinoma. Clin. Cancer Res. 8,3824-3831[Abstract/Free Full Text]
  29. Yokoi, K., Sasaki, T., Bucana, C. D., Fan, D., Baker, C. H., Kitadai, Y., Kuwai, T., Abbruzzese, J. L., Fidler, I. J. (2005) Simultaneous inhibition of EGFR, VEGFR, and platelet-derived growth factor receptor signaling combined with gemcitabine produces therapy of human pancreatic carcinoma and prolongs survival in an orthotopic nude mouse model. Cancer Res. 65,10371-10380[Abstract/Free Full Text]
  30. Siu, L. L., Awada, A., Takimoto, C. H., Piccart, M., Schwartz, B., Giannaris, T., Lathia, C., Petrenciuc, O., Moore, M. J. (2006) Phase I trial of sorafenib and gemcitabine in advanced solid tumors with an expanded cohort in advanced pancreatic cancer. Clin. Cancer Res. 12,144-151[Abstract/Free Full Text]
  31. Zhang, Y., Banerjee, S., Wang, Z., Xu, H., Zhang, L., Mohammad, R., Aboukameel, A., Adsay, N. V., Che, M., Abbruzzese, J. L., Majumdar, A. P., Sarkar, F. H. (2006) Antitumor activity of epidermal growth factor receptor-related protein is mediated by inactivation of ErbB receptors and nuclear factor-kappaB in pancreatic cancer. Cancer Res. 66,1025-1032[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giroux, V.
Right arrow Articles by Dagorn, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giroux, V.
Right arrow Articles by Dagorn, J.-C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS