|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA;
Department of Medicinal Chemistry, University of Florida, Gainesville, Florida, USA;
Department of Dermatology and Ludwig Boltzmann Institute for Cell Biology and Immunobiology of the Skin, University of Münster, Munster, Germany; and
¶ Department of Dermatology, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA
1Correspondence: University of Florida, Department of Medicinal Chemistry, Rm. P526, 1600 SW Archer Rd., Gainesville, FL 32610, USA. E-mail: frouzaud{at}ufl.edu
ABSTRACT
Melanin synthesized by epidermal melanocytes protects the skin against UVR-induced DNA damage and skin cancer. Exposure to UVR increases the synthesis of the photoprotective eumelanin on activation of MC1R, a melanoma susceptibility gene. We studied the expression of MC1R under UVR and
-MSH stimulation in skin of different ethnic origins and in melanocytes of various pigmentary levels. This study identifies and characterizes a novel MC1R isoform (MC1R350) generated by alternative splicing of the classically known MC1R (MC1R317). We demonstrate that the melanin content of melanocytes shows a significant positive correlation with MC1R317 levels but correlates inversely with the amount of MC1R350, suggesting that this latter isoform could act as a negative regulator of melanin synthesis. We confirmed that hypothesis by showing that while MC1R317 signaling significantly increases the expression of MITF and tyrosinase, two key factors in the melanin synthesis pathway, MC1R350 dramatically hampers their expression. In the skin, we show that UVR does not increase MC1R350 expression but does significantly increase MC1R317. Taken together, our results strongly suggest that MC1R350 acts as a negative regulator of skin pigmentation and demonstrate for the first time that MC1R isoform-specific expression is closely related to skin pigmentation and photoprotection.Rouzaud, F., Costin, G-E., Yamaguchi, Y., Valencia, J. C., Berens, W. F., Chen, K. G., Hoashi, T., Böhm, M., Abdel-Malek, Z. A., Hearing, V. J. Regulation of constitutive and UVR-induced skin pigmentation by melanocortin 1 receptor isoforms.
Key Words: splice variant melanocyte UVR
VARIATIONS IN HUMAN hair and skin colors are caused by differences in the distribution and type of melanins that are produced in melanocytes. Melanins exist in two distinct types: the brown/black eumelanins and the yellow/red pheomelanins. Individuals with light skin and red hair have a predominance of pheomelanin in their skin and hair and/or an impaired ability to produce eumelanin. Although human pigmentation shows a wide variety of phenotypes and is thought to be under the control of several genetic loci (1)
, recent studies have shown that the red hair phenotype can be associated predominantly with variants of a single geneextensionwhich encodes the melanocortin 1 receptor (MC1R) (2
3)
. MC1R was the first member of the melanocortin receptors to be cloned (4
5)
. The membrane-anchored 317 amino acid protein has 7 transmembrane spanning domains and plays a critical role in the determination of skin and/or hair color in mammals. Common MC1R alleles in Northern European populations, particularly R151C, R160W, and D294H, are associated with red hair and sun sensitivity (2
3
, 6)
. These mutants all bind
-MSH but are unable to activate adenylate cyclase in cultured cells (7
8)
. Though knowledge of the downstream signaling of MC1R is still incomplete, activation of the receptor by either
-MSH or ACTH increases the intracellular cAMP concentration, which in turn regulates the activity of a range of transcription factors (such as microphthalmia, or MITF) and melanogenic enzymes (such as tyrosinase) that modulate the amounts of eumelanin and pheomelanin (9
10)
.
MC1R is also a member of the G-protein-coupled receptor (GPCR) family. GPCRs act as recognition elements for a vast range of hormones, transmitters, and modulators (11)
. They have therefore been widely studied and are considered the most tractable class of proteins for drug design in the pharmaceutical industry (12)
. Many of the key early studies of GPCR have been reviewed recently (13)
and include data from ligand binding studies, target size irradiation, and antibody (Ab) -induced receptor activation. However, in most cells and tissues, individual GPCRs are expressed at low levels; this is especially the case for human MC1R (14)
. Until recently, virtually every picture of GPCR structure and function had depicted the protein as a monomer. However, a growing number of biochemical, biophysical, and functional studies suggest that GPCRs form functional, SDS-stable dimers (15)
. It was recently indicated that melanocortin receptors can form dimeric structures (16
17
18)
.
UV radiation (UVR) is among the most ubiquitous agents in the environment, and humans are inevitably exposed to it. UVR not only initiates and promotes the transformation of normal epidermal cells to cancer cells via dysregulation of intracellular signaling pathways and via its mutagenic effects on DNA, but also by altering host immunity by reducing its capability for surveillance against tumor or viral antigens (19
20)
. The significance of cutaneous pigmentation lies in the photoprotective effect of melanin, particularly eumelanin, against sun-induced carcinogenesis. Epidermal melanocytes and keratinocytes respond to UVR by increasing their expression of
-MSH and ACTH, which up-regulate the expression of MC1R and mediate the pigmentary response to UVR, as proposed in studies using mouse melanoma cells (21)
.
Constitutive skin pigmentation dramatically affects the incidence of skin cancer, and the photoprotective function of eumelanin in the skin is highly significant (22
23)
. In the U.S., rates of basal and squamous cell carcinomas are 50-fold higher in Caucasians than in African Americans (24
25
26)
, and African Americans have a 13-fold lower incidence of melanoma than do Caucasians. Pigmentation patterns in the skin are determined not only by the location of melanocytes but also by the type and amount of melanins they produce. It has been shown that melanin affords significant protection against DNA damage in underlying skin cells (23)
, as it can absorb UV very efficiently at most wavelengths. Levels of melanin are
4-fold higher in African American skin than in Caucasian skin, and levels of DNA damage were
7- to 8-fold lower in African American skin than in Caucasian skin (23)
.
Since epidermal melanocytes respond to UVR by increasing their expression of
-MSH, which up-regulates the expression of MC1R (27
28)
and consequently enhances the response of melanocytes to melanocortins, we studied the expression of MC1R in skin of different ethnic origins and in primary normal human melanocytes (NHM) displaying a large range of pigmentation phenotypes. We characterize for the first time MC1R350, a new human MC1R isoform different from the one described by Tan et al. (29)
, which contains 350 amino acids and is generated by alternative splicing of the more commonly known MC1R, here named MC1R317.
Its implication in human skin pigmentation is investigated with respect to its influence on melanin production as well as tyrosinase and MITF expression.
MATERIALS AND METHODS
Cell culture
Primary NHM cultures established from neonatal foreskins were maintained at 37°C with 5% CO2 in Medium 154 (Cascade Biologics, Portland, OR, USA) supplemented with human melanocyte growth supplement containing bovine pituitary extract, FBS, bovine insulin, bovine transferrin, fibroblast growth factor, hydrocortisone, heparin, phorbol 12-myristate 13-acetate (TPA) (Cascade Biologics), and 50 ng/ml of gentamicin/amphothericin B (Biowhittaker, Walkersville, MD, USA). Donors were anonymous and no ethnic background information was available. We classified them according to visual pigmentation of the skin and to melanin content, which correlates well with the extent of pigmentation of the skin and derived melanocytes.
Cell growth assessment
Ten thousand cells were seeded in triplicate into 35 mm tissue culture dishes (BD Biosciences, San Jose, CA, USA) and harvested by trypsinization at several time points. Cells were counted with a Coulter Particle Counter Z1 (Beckman Coulter, Inc., Fullerton, CA, USA) and the doubling time was determined.
Melanin content measurement
The melanin content was measured using a modification of a previously reported method (30)
. Briefly, melanocytes were cultured until they became confluent. They were solubilized in lysis buffer (1% Nonidet P-40; Calbiochem, San Diego, CA, USA; in PBS containing a protease inhibitor cocktail; Roche, Indianapolis, IN, USA) for 1 h on ice with occasional vortexing, and protein concentrations were measured with a bicinconinic acid kit (Pierce, Rockford, IL, USA). Melanin pellets were dissolved by incubation in 1 N NaOH at 37°C for 18 h. Aliquots of each sample were transferred to 96-well plates, quantitated by absorbance at 405 nm using an automatic microplate reader (Molecular Devices, Sunnyvale, CA, USA), and calibrated against a standard curve generated using synthetic melanin (Sigma, St. Louis, MO, USA).
Transient transfection of melanocytes
The Amaxa Nucleofectant system was used to transiently transfect NHM according to the manufacturers instructions (Amaxa, Cologne, Germany). Two million cells were used and seeded in 100 mm dishes directly after transfection. Assessment of transfection efficiency was performed by measuring the amount of plasmids present in the cells by semiquantitative real-time RT-polymerase chain reaction (RT-PCR).
Electrophoresis and Western blot
NHM were harvested and solubilized in the lysis buffer described above for 1 h on ice with occasional vortexing. The samples were centrifuged at 14,000 g for 30 min at 4°C and the supernatants were recovered and kept at 70°C for further experiments. Protein concentrations of the samples were measured as noted above. For Western blot, samples were separated by electrophoresis under reducing conditions. Lysates were mixed 1:2 (v/v) with sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 5% 2-mercaptoethanol and boiled for 10 min. Samples were separated by SDS/PAGE with 18% Tris-glycine gels (Invitrogen, Carlsbad, CA, USA) and transferred to polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA, USA). Blots were blocked in 5% nonfat milk in PBS for 1 h at room temperature, then incubated with
PEP19 antiserum (1:300) to MC1R in 1% milk in PBS for 1 h at room temperature. The
PEP19 Ab was raised in our laboratory against residues 266279 of the murine Mc1r, which is situated in the third extracellular loop of the receptor (31)
. An anti-rabbit horseradish peroxidase-linked whole Ab (Amersham Pharmacia, Piscataway, NJ, USA) was used as secondary Ab (dilution 1:1,000). The immunoreactivity of the blots was detected by enhanced chemiluminescence Western blot detection kit (Amersham Pharmacia), according to the manufacturers instructions.
[125I]
-MSH binding assays
Melanocytes were incubated for 2 h in the presence of 10 µCi [125I](Lys11)(Nle4-D-Phe7)
-MSH (Sigma) for each 10 mm dish. Total proteins were extracted with the lysis buffer described above and 40 µg of the total protein extract was separated by electrophoresis on Bis-Tris 412% gels (Invitrogen) under native or reducing conditions. The dried gels were exposed for 22 days in a storage phosphor screen, then scanned with a STORM PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA) and analyzed with the Image Quant program.
5' and 3'-Rapid amplification of cDNA end (RACE)
Total cytoplasmic RNA was isolated from cultured melanocytes using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturers recommendations. RACE reactions were performed with 200 ng RNA template using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA). The gene-specific primers used for 5' RACE were 1) 5'attctccaccagactcaccagccctagg3' and 2) 5'ggacacatacaggcaccaaggctctgac3', and for 3' RACE 3) 5'cagcaccccacctgcagctgcatgttc3', and 4) 5'agaacttcaacctcttcctcctcctc3'. Nested polymerase chain reaction (PCR) reactions were carried out in a 50 µl final volume with 50 ng cDNA template for the first reaction from which 5 µl were used as a template for the second one, 0.5 mM dNTPs, 10 pmol of MC1R specific primers, 100 pmol of Universal Primer Mix (or Nested Universal Primer Mix), and 3 U of the Expand Long template Taq polymerase mix (Roche, Indianapolis, IN, USA). After an initial denaturation for 2 min at 94°C, 34 cycles at 94°C for 30 s, 61°C for 30 s, and 68°C for 2 min were performed, followed by a final extension at 68°C for 5 min in a DNA Thermal Cycler 9700 (Perkin Elmer, Boston, MA, USA). Fragments of interest were cloned into the pGEM®-T Easy Vector (Promega, Madison, WI, USA).
Northern blot
Northern blot was performed following the NorthernMax procedure (Ambion, Austin, TX, USA). Briefly, 50 µg of total RNA was denatured in formaldehyde buffer for 15 min at 65°C before electrophoresis on a 1% agarose gel. After transfer to a BrightStar-Plus membrane (Ambion), RNA was cross-linked using UV radiation (Stratalinker, Stratagene, La Jolla, CA, USA). A sequence-verified fragment of the human MC1R cDNA was radiolabeled with deoxycytidine 5
[C32P]triphosphate by random priming using the DECAprime II labeling kit (Ambion). Northern blots were hybridized for 16 h at 42°C, then washed twice for 5 min in 2x saline-sodium citrate (SSC), 0.1% SDS, and once for 15 min in 0.1x SSC, 0.1% SDS at 42°C. Membranes were exposed on a Molecular Dynamics phosphor screen for 10 days before analysis with a STORM 860 PhosphorImager (Molecular Dynamics).
Sequencing analysis
Cloned fragments were analyzed by automatic sequencing using the ABI PRISM Big Dye Terminator reaction kit (Applied Biosystems, Foster City, CA, USA) and an automatic sequencer (ABI PRISM Cycle sequencing, Perkin Elmer, Boston, MA, USA) and sequencing files were analyzed with Sequencher 4.0.5 software. Nucleotidic sequences were compared using the CLUSTALW (EMBL-European Bioinformatics Institute, Cambridge, UK) and the basic local alignment search tool (BLAST) (NCBI, Bethesda, MD, USA) programs. Receptor secondary structure predictions were performed using the Predict Protein program, accessible at: www.embl-heidelberg.de/predictprotein.
Immunohistochemistry for skin sections
Study subjects
1. This study involved nine healthy volunteer subjects whose age ranged from 24 to 59 years old from three ethnic groups (African American, Asian, and Caucasian) and were selected among those used in an earlier study (23
, 32)
. The biopsy sites were all midback skin. This study was approved by the FDA Research Involving Human Subjects Committee, and informed consent was obtained from each study subject.
2. Samples fixed with formaldehyde were sectioned at 3 µm and mounted on silane-coated glass slides. The expression of MC1R was detected in paraffin-embedded sections by indirect immunofluorescence using rabbit polyclonal antibody (pAb),
PEP20 raised in our laboratory against amino acids 319338 of MC1R350 according to our previously published protocol (33)
. Samples were deparaffinized twice with xylene for 5 min and dehydrated with graduated ethanol. Specimens were then treated with cold methanol for 20 min and boiled with 10 mM citrate buffer (pH 6.0) for 20 min. They were subsequently incubated with 10% goat serum (Vector Laboratories, Burlingame, CA, USA) containing 2% BSA (Amersham Pharmacia) and 0.05% Tween20 for 30 min at 37°C, then with
PEP20 at 1:1,000 dilution with 2% goat serum at 4°C overnight. The slides were incubated with Alexa Fluor(R) 488 goat anti-rabbit IgG (H+L) (Molecular Probes, Eugene, OR, USA) at 37°C for 30 min at 1:500 dilution with 2% goat serum and covered by a drop of ProlongTM Antifade Kit (Molecular Probes) containing 1 µg/ml propidium iodide. The Alexa488 fluorescence was superimposed over propidium iodide to show colocalization. Fluorescence was analyzed and quantified using a LEICA DMRB/DMLD laser microscope (Leica, Wetzlar, Germany) and ScionImage computer software as previously reported (32)
. This system allows one to eliminate background level fluorescence and to quantify fluorescence intensity from original images.
3. Deparaffinized skin sections were processed for MC1R immunostaining with N218, an Ab directed against the amino acids 218 of the human MC1R, as described before with slight modifications (34
35)
. In short, deparaffinized sections were microwave-treated for epitope retrieval, followed by quenching with 0.33% hydrogen peroxide for 20 min and blocking with 2% BSA for 25 min. Sections were then incubated with the anti-MC1R Ab at 1 or 2 µg/ml for 45 min, followed by washing and Ab detection using the indirect immunoperoxidase technique. For negative controls, sections were incubated with preimmune serum at the same concentration as the primary Ab.
Single and dual Ab labeling for confocal immunofluorescence
NHM were seeded in 2-well Lab-Tek chamber slides (Nalge Nunc Intl., Naperville, IL, USA). After three washes in PBS, the cells were fixed in 4% paraformaldehyde for 15 min at 4°C. Then the cells were permeabilized with 0.01% Triton-X100 for 3 min at room temperature. For labeling with a single MC1R Ab, melanocytes were blocked with 5% normal goat serum for 1 h at room temperature. Melanocytes were incubated with the MC1R antibodies
PEP20 (1:10 dilution) or SC-N19 (1:20 dilution) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4°C. After three washes in PBS, the polyclonal antibodies were reacted with goat anti-rabbit IgG labeled with Texas red (1:100) and the monoclonal antibodies were reacted with goat antimouse IgG labeled with fluorescein (1:100) (Vector), followed by nuclear counterstaining with 4',6'-diam idino-2-phenylidole (DAPI) (Vector). Immunofluorescence signals were classified into three categories according to whether they showed green, red, or yellow fluorescence. The latter was indicative of colocalization of the red and green fluorescence signals. All preparations were examined with a confocal microscope LSM 510 (Zeiss, Jena, Germany) equipped with HeNe, argon, krypton, and UV laser sources.
Fluorescence index (FI) measurements
The fluorescence index was obtained by measurement of the fluorescence signal from MC1R Ab in at least five melanocytes under
-MSH-treated or untreated conditions. Briefly, original confocal microscopy images were obtained under same laser gain intensity, size and magnification. These images were analyzed by using the software contained in the Zeiss 510 LSM confocal microscope. All measurements were collected to a database and are expressed as mean ± SD.
Comparison of MC1R transcript levels
Comparative determination of MC1R transcript levels were performed by real-time semiquantitative RT-PCR using the SyBr Green detection on a Light Cycler (Roche) and specific primers. Because the levels and the quality of mRNA may vary slightly according to the different types of treatment, we quantified the transcripts relative to the GAPDH housekeeping gene using the primers listed above by determining the difference between the crossing point (Ct) of amplification of the target RNA and the GAPDH RNA (delta Ct GAPDH). The Ct is defined as the point when the amplification starts the exponential phase. Comparison of transcript levels then relies on differences between the delta Cts (delta-deltaCt, ddct). We considered the MC1R transcript level in 964b+ cells as a reference, since they were the most highly pigmented. Therefore, the numbers of fold activation were calculated as follows. Given the relation: nb fold = nb copies MC1R (target)/nb copies MC1R (reference), nb fold can be expressed as: 10 (log(nb copies Mc1r (target) log (nb copies Mc1r (reference)).
RESULTS
Morphology and growth of NHM in culture
Eighteen different NHM cultures derived from human neonatal foreskins obtained from individual donors presenting different levels of skin pigmentation (donors were anonymous, therefore no information on ethnicity was available) were established and maintained under identical conditions. Microphotographs were taken using a bright-field filter (Fig. 1
). The intensity of pigmentation varied from one population to another, spanning a large range of intensities from very dark to very lightly pigmented; measurements of melanin content were consistent with visible phenotype (Fig. 1)
.
|
Immunodetection of MC1R isoforms expressed by cultured melanocytes
Western blot experiments were performed to measure MC1R levels in the various melanocyte populations (Fig. 2
). Immunodetection by
PEP19 revealed three patterns of expression. Pattern 1 (shown in Fig. 2A
) had a single band at 60 kDa whereas pattern 2 (Fig. 2B
) revealed two sets of doublet bands, one at 30 and 36 kDa and the other at
60 and 70 kDa. Pattern 3 (Fig. 2C
) showed only one band at 30 kDa and one at 60 kDa, and was the most common pattern.
|
The receptor complexes
A binding experiment was conducted to determine if the doublet of high MW bands (
6070 kDa) revealed by Western blot correspond to a multi-MC1R complex structure that could bind
-MSH. We used 125I-
MSH labeling to detect the receptor, which revealed two distinct signals at
3035 kDa and 6070 kDa and corresponds to the sizes identified by immunoblotting (Fig. 2D
). The intensity of the two signals is approximately equivalent, suggesting that
-MSH binds with similar affinity to either the high or the low MW forms of the complexes. The same profile was obtained in both native and reducing conditions, indicating that the bond involved in the complex formation is covalent. Our results suggest that what we are detecting at 6070 kDa corresponds to a dimeric MC1R, but our data cannot at this point exclude the possibility that it could be the result of an interaction between MC1R and another protein.
Characterization of untranslated regions (UTRs)
To characterize at the nucleotide level the isoforms depicted in the Western blots, nested amplifications were performed using two distinct adapter-ligated cDNA libraries for each cell line. 5' RACE-PCR analysis revealed only one DNA fragment corresponding to a 5'untranslated region (5' UTR) of 547 bp. Similar investigations were performed to obtain the 3' UTR but, surprisingly, different products were detected in the 3' RACE-PCR experiments (Fig. 3
A). The largest fragment corresponded to the typical 954 nt coding region with a 762 nt 3' UTR. The smaller fragment corresponded to a 1053 nt coding region with a 283 nt 3' UTR. The sequence translation indicates that the second transcript encodes a 350 amino acid protein that differs from the standard 317 amino acid MC1R by the replacement of the last three residues with a new 36 amino acid C terminus sequence. Therefore, we named the first transcript MC1R317 and the second transcript MC1R350.
|
Nucleotidic and amino acid sequence analysis
The existence of the two isoforms was confirmed by Northern blot assay using total RNA from M14 and SKMel 28 melanoma cell lines, although melanoma cells may represent a different situation from that of normal melanocytes (Fig. 3B
). In a real-time RT-PCR assay performed on eight melanoma cell lines, M14 melanoma cells displayed the lowest proportion of MC1R350 (5%) and the unpigmented SKMel28 melanoma cells were the highest (90%) (not shown); the absolute amount of total MC1R was higher in M14 cells, which explains why the 5% MC1R350 can be detected. RACE fragments were sequenced and comparisons were established in the 3' region (Fig. 3C
). The splicing event in the second transcript starts 12 nt (corresponding to three amino acids plus the termination codon) upstream of the termination codon. Despite the induced frameshift, the removal of the last cysteine residue is compensated by the coding of another identical residue by the newly determined sequence in exactly the same position.
Secondary structure prediction
We performed a software-based prediction of the secondary structure of the MC1R isoforms using the Predict Protein program accessible at http://www.embl-heidelberg.de/predictprotein/predictprotein.html (Fig. 4
). Both isoforms have the typical seven transmembrane domain profile, with the carboxyl tail potentially anchored in the melanocyte membrane via the C315 palmitoylation. However, the 350 residue isoform harbors a total of five cysteine residues in its longer C-tail, each a potential target for palmitic acid fixation to the membrane.
|
MC1R expression in skin samples from different ethnic origins
MC1R350 was detected in paraffin skin sections using
PEP20, a rabbit pAb raised against the specific C terminus of that isoform. A positive signal was detected in
50% of the samples tested and immunofluorescence measurements indicated similar low levels of MC1R350 expression in Caucasian and in Asian skin (Fig. 5
A, B) and a significant 25% higher level in African American skin. Due to the structural characteristics of the two isoforms, it is not possible to design an Ab that would recognize MC1R317 only. Therefore, any Ab that recognizes MC1R317 will also detect de facto MC1R350, revealing the cumulative expression of the two isoforms. We therefore used N218 Ab (34
35)
and were able to detect the MC1Rs in African American samples only (Fig. 5C
). The N218 appears not to be sensitive enough to detect MC1R in Caucasian and Asian skin, where its level of expression is lower.
|
Influence of 1 minimal erythemal dose (MED) UVR on the MC1Rs expression in skin
PEP20 and N218 were used to monitor respectively MC1R350 and total MC1R expression 7 min, 1 day, and 7 days after irradiation with 1MED of UV. MC1R350 expression did not significantly vary after UV irradiation in any of the ethnic groups examined (Fig. 5D, E
). At 1 day and 7 days after irradiation, a significant increase was detected by staining with N218 which targets the total MC1R corresponding to the sum of MC1R350 and MC1R317 (Fig. 5C
). Therefore, we attribute the increase detected by N218 to MC1R317.
Influence of
-MSH on MC1R expression in cultured NHM
It has been known for a long time that
-MSH is a principal mediator of the melanogenic effects of UVR (28, 3637, 31). Therefore, we treated cultured primary NHM for 4 days with 100 nM
-MSH and assessed the changes in MC1R expression by confocal immunofluorescence (Fig. 6
A) and Western blot (Fig. 6B
) using SC-N19 and
PEP19 antibodies as well as semiquantitative real-time RT-PCR (Fig. 6C
). Fluorescence index measurements in 1088b cells revealed that upon
-MSH treatment, MC1R350 expression is increased 1.3-fold whereas the expression of both isoforms is increased 2.3-fold, indicating again that the increase is much greater for MC1R317 than for MC1R350. Western blot profiles revealed that in most of the NHM tested, MC1R317 levels were increased for both the monomer and multicomplex forms. It is interesting that 1088b is the only cell line showing the appearance of the 36 kDa monomer (i.e., MC1R350) after
-MSH treatment. At the mRNA level, we report that all melanocyte populations increased their total amount of MC1R with the exception of 3C05 cells. Our assay also reveals that all melanocytes (except 3C06 cells) show a higher relative amount of MC1R317 when stimulated by
-MSH, indicating that MC1R317 is a more suitable answer to an increased melanogenesis.
|
Assessment of MC1R isoform expression at the mRNA level
As indicated above, we designed two appropriate sets of oligo-primers that allow us to discriminate between MC1R317 and MC1R350. Figure 7
A shows there is a good correlation between the total level of MC1R mRNA and the total melanin content in the 10 different primary NHM cultures tested. Figure 7B
shows an even better correlation between the melanin content and the relative amounts of MC1R317 in the five NHM cultures expressing MC1R350. In the other five populations that do not express MC1R350, the relative amount of MC1R317 is 100% and renders the correlation insignificant. Figure 7C, D
reveals that, surprisingly, MC1R350 expression shows an inverse correlation with the total melanin content. Taken together, these results indicate that MC1R317 acts as a positive factor toward synthesis of the total melanin content whereas the MC1R350 isoform could have an opposite action.
|
Downstream signal transduction from MC1R317 and MC1R350
We transfected the primary NHM cultures (H253) using pCMV Script vector containing either MC1R317 or MC1R350. Negative controls were performed by transfecting cells with an empty vector (mock) as well as by using nontransfected cells. Transfection efficiency was assessed by measuring the amount of vector effectively present in the cells by real-time RT-PCR, and these data have been used to standardize measurements of MITF and Tyr transcript levels. Figure 8
shows that while MC1R317 increases expression of MITF and Tyr, MC1R350 dramatically reduces the expression of MITF and Tyr compared to untransfected cells (but expressing a basal level of MC1Rs) and mock-transfected cells. These results show the negative effect of MC1R350 on the intracellular signal transduced to the melanin synthesis pathway.
|
DISCUSSION
A key role of the MC1R in the determination of skin and hair pigmentation has been hypothesized since MC1R variants causing coat color changes are known in other mammalian species (38
39
40
41)
. So far, a great number of MC1R variants have been described in humans, and most result from single amino acid substitutions (2
, 8
, 42
43
44
45
46
47
48)
. However, in 1999 Tan et al. described a novel MC1R isoform isolated from human testis, fetal heart, and melanoma G361 cells that bears an additional 65 amino acid sequence at the C terminus (29)
. That was the only report of a human MC1R splice variant that did not result from a single amino acid substitution.
In this study, we characterized for the first time a new isoform of the receptor bearing 350 amino acids, namely MC1R350 instead of the MC1R317 with 317 amino acids, as classically described. The full implications of this new isoform as well as its mechanism of action remain to be clarified. However, we have reached a first level of understanding by showing that, unlike MC1R317, relative amounts of MC1R350 mRNA correlate inversely with the total melanin content of the NHM tested. This shows that MC1R350 is not positively involved in melanin synthesis but is perhaps a negative regulator. We have further demonstrated the negative impact of MC1R350 expression on MITF and tyrosinase, two key players of melanogenesis. When primary NHM are treated with
-MSH, most of the time they increase their level of MC1R350 amount; in contrast, however, in the majority of the cases they also decrease their proportion of this isoform (Fig. 6C
), as large increases in MC1R317 appear to be a more suitable answer to stimulation of the melanogenic pathway for melanocytes. Therefore, one can expect that the mechanism revealed for NHM also applies in the skin. Since our immunohistochemical studies have shown that African American skins have higher absolute levels of MC1R350 compared to Asian and Caucasian skins (Fig. 5)
, similar to the way that
-MSH-treated NHM increase their levels of MC1R350, we expect that darker skins have a greater relative amount of MC1R317. Indeed, UVR exposure does not increase MC1R350 expression but does significantly increase that of MC1R317, therefore increasing its relative amount as well as melanin production. In the model we propose, levels of melanin production appear to be regulated by the balance between the two isoforms of MC1R, and the relative amounts of MC1R317 and MC1R350 act like a rheostat to control the melanin production via MITF and tyrosinase. However, regulation of the balance itself will be interesting to investigate since MC1R350 is generated from MC1R317 by alternative splicing, and thus the nonspliced RNA could be considered an immature transcript. On the other hand, from the protein point of view we cannot rule out the possibility that MC1R350 might get cleaved to the shorter form by a protease, even though the C terminus would be slightly modified, in which case MC1R350 could be considered a proreceptor.
One way to control skin pigmentation was elucidated at the beginning of the 1990s with the molecular characterization of the MC1R and its antagonist agouti signal protein (ASP) (4
, 49)
, and we now know that MC1R and ASP are involved in the qualitative and quantitative regulation of mammalian pigmentation (50
51)
. ASP is produced in hair follicles and acts on follicular melanocytes to inhibit eumelanin synthesis (52
53)
. Recently, the 8818G allele of the ASP gene has been associated with a darker skin color in African Americans (54)
. Here, we report for the first time that MC1R isoform-specific expression is closely linked to darker skin pigmentation and photoprotection.
The secondary structure prediction indicates that the C-tail of MC1R350 bears not only one (as does MC1R317), but five, cysteine residues that could be palmitoylated in order to further anchor the tail of the receptor in the melanocyte membrane, which might significantly increase its stability, localization, or function. The carboxyl-terminal domain for all known MC1R proteins is strongly conserved, particularly the cysteine in position 315. In domestic dogs, a pheomelanic hair pattern is induced by the nonfunctional R306ter mutation at the Mc1r locus (40
, 55)
, which results from an early termination codon and the loss of the last 12 residues of the receptor, including the C315. By analogy to other G-protein-coupled receptors, the MC1R cytoplasmic tail is not expected to directly participate in signaling, but might impair coupling indirectly if C315 is palmitoylated and participates in receptor localization or trafficking (56
57
58
59). Biochemical and pharmacological studies may help to resolve the influence of this longer C terminus on MC1R function and assess whether or not this sequence is responsible for the negative effect of MC1R350 on the melanogenic pathway.
The Western blot profiles using
PEP19 also revealed a band (or a doublet) with a MW
6570 kDa, i.e., twice the size expected for the MC1R. Using 125I-
MSH labeling, we detected two distinct binding signals, each corresponding to the sizes seen by immunoblotting. The sum of these results clearly shows that MC1R can be involved in a multiproteic structure that is able to bind
-MSH with approximately the same affinity as the single receptor. Nevertheless, further studies are needed to establish precisely the nature of the multiproteic complex and its properties. We show that both structures are stable under reducing conditions, which strongly suggests they result from covalent bonds between the entities and not from disulfide bonds between the cysteine residues.
One of the most pressing and tantalizing issues raised by these results is the significance of the MC1R isoforms and their potential dimerization for the pharmacology of MC1R function, and whether this will result in the identification and development of novel ligands that interact selectively with such receptors. It was recently reported that MC1R forms dimeric structures (18)
, and that might be what we are detecting here, in which case further studies will be necessary to establish whether MC1R can form heterodimers in an MC1R317-MC1R350 complex. Does MC1R350, as a negative regulator of pigmentation, offer novel possibilities in terms of ways to inhibit melanogenesis? Melanocortin peptide structure-activity relationship studies are providing key insights regarding the design and synthesis of melanocortin selective agonists and/or antagonists and tremendous efforts have been recently put into the design and development of ligands for the melanocortin receptors with properties not present in the endogenous peptides, such as improved potency, receptor selectivity, and bioavailability (60).
MC1R350 has been detected in
50% of the cell lines studied, but so far we have not identified any cell line that expresses exclusively MC1R350. A larger screening process hopefully will identify melanocytes producing only MC1R350, which would be valuable as an in vivo model to further study the pharmacology and the functionality of this isoform.
ACKNOWLEDGMENTS
This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research, and also in part by NIH grant R01 ES009110 (Z. Abdel-Malek). The authors wish to thank Dr. Janusz Z. Beer and Barbara Z. Zmudska of the FDA for providing some of the specimens used in this study, and Pr. J. L. Garcia-Borron from the University of Murcia, Spain for insightful discussions.
Received for publication March 3, 2006. Accepted for publication April 10, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
Y. Yamaguchi, M. Brenner, and V. J. Hearing The Regulation of Skin Pigmentation J. Biol. Chem., September 21, 2007; 282(38): 27557 - 27561. [Full Text] [PDF] |
||||
![]() |
T. Haitina, A. Ringholm, J. Kelly, N. I. Mundy, and H. B. Schioth High Diversity in Functional Properties of Melanocortin 1 Receptor (MC1R) in Divergent Primate Species Is More Strongly Associated with Phylogeny than Coat Color Mol. Biol. Evol., September 1, 2007; 24(9): 2001 - 2008. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |