FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-5922fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-5922fjev1
20/11/1927    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rouzaud, F.
Right arrow Articles by Hearing, V. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rouzaud, F.
Right arrow Articles by Hearing, V. J.
(The FASEB Journal. 2006;20:1927-1929.)
© 2006 FASEB

Regulation of constitutive and UVR-induced skin pigmentation by melanocortin 1 receptor isoforms

Francois Rouzaud*,{dagger},1, Gertrude-E. Costin*, Yuji Yamaguchi*, Julio C. Valencia*, Werner F. Berens*, Kevin G. Chen*, Toshihiko Hoashi*, Markus Böhm§, Zalfa A. Abdel-Malek and Vincent J. Hearing*

* Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA;

{dagger} Department of Medicinal Chemistry, University of Florida, Gainesville, Florida, USA;

§ Department of Dermatology and Ludwig Boltzmann Institute for Cell Biology and Immunobiology of the Skin, University of Münster, Munster, Germany; and

Department of Dermatology, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA

1Correspondence: University of Florida, Department of Medicinal Chemistry, Rm. P5–26, 1600 SW Archer Rd., Gainesville, FL 32610, USA. E-mail: frouzaud{at}ufl.edu

ABSTRACT

Melanin synthesized by epidermal melanocytes protects the skin against UVR-induced DNA damage and skin cancer. Exposure to UVR increases the synthesis of the photoprotective eumelanin on activation of MC1R, a melanoma susceptibility gene. We studied the expression of MC1R under UVR and {alpha}-MSH stimulation in skin of different ethnic origins and in melanocytes of various pigmentary levels. This study identifies and characterizes a novel MC1R isoform (MC1R350) generated by alternative splicing of the classically known MC1R (MC1R317). We demonstrate that the melanin content of melanocytes shows a significant positive correlation with MC1R317 levels but correlates inversely with the amount of MC1R350, suggesting that this latter isoform could act as a negative regulator of melanin synthesis. We confirmed that hypothesis by showing that while MC1R317 signaling significantly increases the expression of MITF and tyrosinase, two key factors in the melanin synthesis pathway, MC1R350 dramatically hampers their expression. In the skin, we show that UVR does not increase MC1R350 expression but does significantly increase MC1R317. Taken together, our results strongly suggest that MC1R350 acts as a negative regulator of skin pigmentation and demonstrate for the first time that MC1R isoform-specific expression is closely related to skin pigmentation and photoprotection.—Rouzaud, F., Costin, G-E., Yamaguchi, Y., Valencia, J. C., Berens, W. F., Chen, K. G., Hoashi, T., Böhm, M., Abdel-Malek, Z. A., Hearing, V. J. Regulation of constitutive and UVR-induced skin pigmentation by melanocortin 1 receptor isoforms.


Key Words: splice variant • melanocyte • UVR

VARIATIONS IN HUMAN hair and skin colors are caused by differences in the distribution and type of melanins that are produced in melanocytes. Melanins exist in two distinct types: the brown/black eumelanins and the yellow/red pheomelanins. Individuals with light skin and red hair have a predominance of pheomelanin in their skin and hair and/or an impaired ability to produce eumelanin. Although human pigmentation shows a wide variety of phenotypes and is thought to be under the control of several genetic loci (1) , recent studies have shown that the red hair phenotype can be associated predominantly with variants of a single gene—extension—which encodes the melanocortin 1 receptor (MC1R) (2 3) . MC1R was the first member of the melanocortin receptors to be cloned (4 5) . The membrane-anchored 317 amino acid protein has 7 transmembrane spanning domains and plays a critical role in the determination of skin and/or hair color in mammals. Common MC1R alleles in Northern European populations, particularly R151C, R160W, and D294H, are associated with red hair and sun sensitivity (2 3 , 6) . These mutants all bind {alpha}-MSH but are unable to activate adenylate cyclase in cultured cells (7 8) . Though knowledge of the downstream signaling of MC1R is still incomplete, activation of the receptor by either {alpha}-MSH or ACTH increases the intracellular cAMP concentration, which in turn regulates the activity of a range of transcription factors (such as microphthalmia, or MITF) and melanogenic enzymes (such as tyrosinase) that modulate the amounts of eumelanin and pheomelanin (9 10) .

MC1R is also a member of the G-protein-coupled receptor (GPCR) family. GPCRs act as recognition elements for a vast range of hormones, transmitters, and modulators (11) . They have therefore been widely studied and are considered the most tractable class of proteins for drug design in the pharmaceutical industry (12) . Many of the key early studies of GPCR have been reviewed recently (13) and include data from ligand binding studies, target size irradiation, and antibody (Ab) -induced receptor activation. However, in most cells and tissues, individual GPCRs are expressed at low levels; this is especially the case for human MC1R (14) . Until recently, virtually every picture of GPCR structure and function had depicted the protein as a monomer. However, a growing number of biochemical, biophysical, and functional studies suggest that GPCRs form functional, SDS-stable dimers (15) . It was recently indicated that melanocortin receptors can form dimeric structures (16 17 18) .

UV radiation (UVR) is among the most ubiquitous agents in the environment, and humans are inevitably exposed to it. UVR not only initiates and promotes the transformation of normal epidermal cells to cancer cells via dysregulation of intracellular signaling pathways and via its mutagenic effects on DNA, but also by altering host immunity by reducing its capability for surveillance against tumor or viral antigens (19 20) . The significance of cutaneous pigmentation lies in the photoprotective effect of melanin, particularly eumelanin, against sun-induced carcinogenesis. Epidermal melanocytes and keratinocytes respond to UVR by increasing their expression of {alpha}-MSH and ACTH, which up-regulate the expression of MC1R and mediate the pigmentary response to UVR, as proposed in studies using mouse melanoma cells (21) .

Constitutive skin pigmentation dramatically affects the incidence of skin cancer, and the photoprotective function of eumelanin in the skin is highly significant (22 23) . In the U.S., rates of basal and squamous cell carcinomas are 50-fold higher in Caucasians than in African Americans (24 25 26) , and African Americans have a 13-fold lower incidence of melanoma than do Caucasians. Pigmentation patterns in the skin are determined not only by the location of melanocytes but also by the type and amount of melanins they produce. It has been shown that melanin affords significant protection against DNA damage in underlying skin cells (23) , as it can absorb UV very efficiently at most wavelengths. Levels of melanin are ~4-fold higher in African American skin than in Caucasian skin, and levels of DNA damage were ~7- to 8-fold lower in African American skin than in Caucasian skin (23) .

Since epidermal melanocytes respond to UVR by increasing their expression of {alpha}-MSH, which up-regulates the expression of MC1R (27 28) and consequently enhances the response of melanocytes to melanocortins, we studied the expression of MC1R in skin of different ethnic origins and in primary normal human melanocytes (NHM) displaying a large range of pigmentation phenotypes. We characterize for the first time MC1R350, a new human MC1R isoform different from the one described by Tan et al. (29) , which contains 350 amino acids and is generated by alternative splicing of the more commonly known MC1R, here named MC1R317.

Its implication in human skin pigmentation is investigated with respect to its influence on melanin production as well as tyrosinase and MITF expression.

MATERIALS AND METHODS

Cell culture
Primary NHM cultures established from neonatal foreskins were maintained at 37°C with 5% CO2 in Medium 154 (Cascade Biologics, Portland, OR, USA) supplemented with human melanocyte growth supplement containing bovine pituitary extract, FBS, bovine insulin, bovine transferrin, fibroblast growth factor, hydrocortisone, heparin, phorbol 12-myristate 13-acetate (TPA) (Cascade Biologics), and 50 ng/ml of gentamicin/amphothericin B (Biowhittaker, Walkersville, MD, USA). Donors were anonymous and no ethnic background information was available. We classified them according to visual pigmentation of the skin and to melanin content, which correlates well with the extent of pigmentation of the skin and derived melanocytes.

Cell growth assessment
Ten thousand cells were seeded in triplicate into 35 mm tissue culture dishes (BD Biosciences, San Jose, CA, USA) and harvested by trypsinization at several time points. Cells were counted with a Coulter Particle Counter Z1 (Beckman Coulter, Inc., Fullerton, CA, USA) and the doubling time was determined.

Melanin content measurement
The melanin content was measured using a modification of a previously reported method (30) . Briefly, melanocytes were cultured until they became confluent. They were solubilized in lysis buffer (1% Nonidet P-40; Calbiochem, San Diego, CA, USA; in PBS containing a protease inhibitor cocktail; Roche, Indianapolis, IN, USA) for 1 h on ice with occasional vortexing, and protein concentrations were measured with a bicinconinic acid kit (Pierce, Rockford, IL, USA). Melanin pellets were dissolved by incubation in 1 N NaOH at 37°C for 18 h. Aliquots of each sample were transferred to 96-well plates, quantitated by absorbance at 405 nm using an automatic microplate reader (Molecular Devices, Sunnyvale, CA, USA), and calibrated against a standard curve generated using synthetic melanin (Sigma, St. Louis, MO, USA).

Transient transfection of melanocytes
The Amaxa Nucleofectant system was used to transiently transfect NHM according to the manufacturer’s instructions (Amaxa, Cologne, Germany). Two million cells were used and seeded in 100 mm dishes directly after transfection. Assessment of transfection efficiency was performed by measuring the amount of plasmids present in the cells by semiquantitative real-time RT-polymerase chain reaction (RT-PCR).

Electrophoresis and Western blot
NHM were harvested and solubilized in the lysis buffer described above for 1 h on ice with occasional vortexing. The samples were centrifuged at 14,000 g for 30 min at 4°C and the supernatants were recovered and kept at –70°C for further experiments. Protein concentrations of the samples were measured as noted above. For Western blot, samples were separated by electrophoresis under reducing conditions. Lysates were mixed 1:2 (v/v) with sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 5% 2-mercaptoethanol and boiled for 10 min. Samples were separated by SDS/PAGE with 18% Tris-glycine gels (Invitrogen, Carlsbad, CA, USA) and transferred to polyvinylidene difluoride membranes (Millipore Corp., Bedford, MA, USA). Blots were blocked in 5% nonfat milk in PBS for 1 h at room temperature, then incubated with {alpha}PEP19 antiserum (1:300) to MC1R in 1% milk in PBS for 1 h at room temperature. The {alpha}PEP19 Ab was raised in our laboratory against residues 266–279 of the murine Mc1r, which is situated in the third extracellular loop of the receptor (31) . An anti-rabbit horseradish peroxidase-linked whole Ab (Amersham Pharmacia, Piscataway, NJ, USA) was used as secondary Ab (dilution 1:1,000). The immunoreactivity of the blots was detected by enhanced chemiluminescence Western blot detection kit (Amersham Pharmacia), according to the manufacturer’s instructions.

[125I]{alpha}-MSH binding assays
Melanocytes were incubated for 2 h in the presence of 10 µCi [125I](Lys11)(Nle4-D-Phe7){alpha}-MSH (Sigma) for each 10 mm dish. Total proteins were extracted with the lysis buffer described above and 40 µg of the total protein extract was separated by electrophoresis on Bis-Tris 4–12% gels (Invitrogen) under native or reducing conditions. The dried gels were exposed for 22 days in a storage phosphor screen, then scanned with a STORM PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA) and analyzed with the Image Quant program.

5' and 3'-Rapid amplification of cDNA end (RACE)
Total cytoplasmic RNA was isolated from cultured melanocytes using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s recommendations. RACE reactions were performed with 200 ng RNA template using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA). The gene-specific primers used for 5' RACE were 1) 5'attctccaccagactcaccagccctagg3' and 2) 5'ggacacatacaggcaccaaggctctgac3', and for 3' RACE 3) 5'cagcaccccacctgcagctgcatgttc3', and 4) 5'agaacttcaacctcttcctcctcctc3'. Nested polymerase chain reaction (PCR) reactions were carried out in a 50 µl final volume with 50 ng cDNA template for the first reaction from which 5 µl were used as a template for the second one, 0.5 mM dNTPs, 10 pmol of MC1R specific primers, 100 pmol of Universal Primer Mix (or Nested Universal Primer Mix), and 3 U of the Expand Long template Taq polymerase mix (Roche, Indianapolis, IN, USA). After an initial denaturation for 2 min at 94°C, 34 cycles at 94°C for 30 s, 61°C for 30 s, and 68°C for 2 min were performed, followed by a final extension at 68°C for 5 min in a DNA Thermal Cycler 9700 (Perkin Elmer, Boston, MA, USA). Fragments of interest were cloned into the pGEM®-T Easy Vector (Promega, Madison, WI, USA).

Northern blot
Northern blot was performed following the NorthernMax procedure (Ambion, Austin, TX, USA). Briefly, 50 µg of total RNA was denatured in formaldehyde buffer for 15 min at 65°C before electrophoresis on a 1% agarose gel. After transfer to a BrightStar-Plus membrane (Ambion), RNA was cross-linked using UV radiation (Stratalinker, Stratagene, La Jolla, CA, USA). A sequence-verified fragment of the human MC1R cDNA was radiolabeled with deoxycytidine 5{alpha}[C32P]triphosphate by random priming using the DECAprime II labeling kit (Ambion). Northern blots were hybridized for 16 h at 42°C, then washed twice for 5 min in 2x saline-sodium citrate (SSC), 0.1% SDS, and once for 15 min in 0.1x SSC, 0.1% SDS at 42°C. Membranes were exposed on a Molecular Dynamics phosphor screen for 10 days before analysis with a STORM 860 PhosphorImager (Molecular Dynamics).

Sequencing analysis
Cloned fragments were analyzed by automatic sequencing using the ABI PRISM Big Dye Terminator reaction kit (Applied Biosystems, Foster City, CA, USA) and an automatic sequencer (ABI PRISM Cycle sequencing, Perkin Elmer, Boston, MA, USA) and sequencing files were analyzed with Sequencher 4.0.5 software. Nucleotidic sequences were compared using the CLUSTALW (EMBL-European Bioinformatics Institute, Cambridge, UK) and the basic local alignment search tool (BLAST) (NCBI, Bethesda, MD, USA) programs. Receptor secondary structure predictions were performed using the Predict Protein program, accessible at: www.embl-heidelberg.de/predictprotein.

Immunohistochemistry for skin sections
Study subjects
1. This study involved nine healthy volunteer subjects whose age ranged from 24 to 59 years old from three ethnic groups (African American, Asian, and Caucasian) and were selected among those used in an earlier study (23 , 32) . The biopsy sites were all midback skin. This study was approved by the FDA Research Involving Human Subjects Committee, and informed consent was obtained from each study subject.

2. Samples fixed with formaldehyde were sectioned at 3 µm and mounted on silane-coated glass slides. The expression of MC1R was detected in paraffin-embedded sections by indirect immunofluorescence using rabbit polyclonal antibody (pAb), {alpha}PEP20 raised in our laboratory against amino acids 319–338 of MC1R350 according to our previously published protocol (33) . Samples were deparaffinized twice with xylene for 5 min and dehydrated with graduated ethanol. Specimens were then treated with cold methanol for 20 min and boiled with 10 mM citrate buffer (pH 6.0) for 20 min. They were subsequently incubated with 10% goat serum (Vector Laboratories, Burlingame, CA, USA) containing 2% BSA (Amersham Pharmacia) and 0.05% Tween20 for 30 min at 37°C, then with {alpha}PEP20 at 1:1,000 dilution with 2% goat serum at 4°C overnight. The slides were incubated with Alexa Fluor(R) 488 goat anti-rabbit IgG (H+L) (Molecular Probes, Eugene, OR, USA) at 37°C for 30 min at 1:500 dilution with 2% goat serum and covered by a drop of ProlongTM Antifade Kit (Molecular Probes) containing 1 µg/ml propidium iodide. The Alexa488 fluorescence was superimposed over propidium iodide to show colocalization. Fluorescence was analyzed and quantified using a LEICA DMRB/DMLD laser microscope (Leica, Wetzlar, Germany) and ScionImage computer software as previously reported (32) . This system allows one to eliminate background level fluorescence and to quantify fluorescence intensity from original images.

3. Deparaffinized skin sections were processed for MC1R immunostaining with N2–18, an Ab directed against the amino acids 2–18 of the human MC1R, as described before with slight modifications (34 35) . In short, deparaffinized sections were microwave-treated for epitope retrieval, followed by quenching with 0.33% hydrogen peroxide for 20 min and blocking with 2% BSA for 25 min. Sections were then incubated with the anti-MC1R Ab at 1 or 2 µg/ml for 45 min, followed by washing and Ab detection using the indirect immunoperoxidase technique. For negative controls, sections were incubated with preimmune serum at the same concentration as the primary Ab.

Single and dual Ab labeling for confocal immunofluorescence
NHM were seeded in 2-well Lab-Tek chamber slides (Nalge Nunc Intl., Naperville, IL, USA). After three washes in PBS, the cells were fixed in 4% paraformaldehyde for 15 min at 4°C. Then the cells were permeabilized with 0.01% Triton-X100 for 3 min at room temperature. For labeling with a single MC1R Ab, melanocytes were blocked with 5% normal goat serum for 1 h at room temperature. Melanocytes were incubated with the MC1R antibodies {alpha}PEP20 (1:10 dilution) or SC-N19 (1:20 dilution) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4°C. After three washes in PBS, the polyclonal antibodies were reacted with goat anti-rabbit IgG labeled with Texas red (1:100) and the monoclonal antibodies were reacted with goat antimouse IgG labeled with fluorescein (1:100) (Vector), followed by nuclear counterstaining with 4',6'-diam idino-2-phenylidole (DAPI) (Vector). Immunofluorescence signals were classified into three categories according to whether they showed green, red, or yellow fluorescence. The latter was indicative of colocalization of the red and green fluorescence signals. All preparations were examined with a confocal microscope LSM 510 (Zeiss, Jena, Germany) equipped with HeNe, argon, krypton, and UV laser sources.

Fluorescence index (FI) measurements
The fluorescence index was obtained by measurement of the fluorescence signal from MC1R Ab in at least five melanocytes under {alpha}-MSH-treated or untreated conditions. Briefly, original confocal microscopy images were obtained under same laser gain intensity, size and magnification. These images were analyzed by using the software contained in the Zeiss 510 LSM confocal microscope. All measurements were collected to a database and are expressed as mean ± SD.

Comparison of MC1R transcript levels
Comparative determination of MC1R transcript levels were performed by real-time semiquantitative RT-PCR using the SyBr Green detection on a Light Cycler (Roche) and specific primers. Because the levels and the quality of mRNA may vary slightly according to the different types of treatment, we quantified the transcripts relative to the GAPDH housekeeping gene using the primers listed above by determining the difference between the crossing point (Ct) of amplification of the target RNA and the GAPDH RNA (delta Ct GAPDH). The Ct is defined as the point when the amplification starts the exponential phase. Comparison of transcript levels then relies on differences between the delta Cts (delta-deltaCt, ddct). We considered the MC1R transcript level in 964b+ cells as a reference, since they were the most highly pigmented. Therefore, the numbers of fold activation were calculated as follows. Given the relation: nb fold = nb copies MC1R (target)/nb copies MC1R (reference), nb fold can be expressed as: 10 (log(nb copies Mc1r (target) – log (nb copies Mc1r (reference)).

RESULTS

Morphology and growth of NHM in culture
Eighteen different NHM cultures derived from human neonatal foreskins obtained from individual donors presenting different levels of skin pigmentation (donors were anonymous, therefore no information on ethnicity was available) were established and maintained under identical conditions. Microphotographs were taken using a bright-field filter (Fig. 1 ). The intensity of pigmentation varied from one population to another, spanning a large range of intensities from very dark to very lightly pigmented; measurements of melanin content were consistent with visible phenotype (Fig. 1) .


Figure 1
View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Phenotypic appearance of NHM in culture (upper panel). Photographs of NHM in culture were taken using bright-field optics. Images were obtained at a magnification of 20x. Examples shown are 964b+, 1088b, 996c, 777c, 1089c, 1106c. Total melanin content of primary NHM (lower panel). Total melanin content was measured for each cell line and the results are given in micrograms of total melanin per million cells.

Immunodetection of MC1R isoforms expressed by cultured melanocytes
Western blot experiments were performed to measure MC1R levels in the various melanocyte populations (Fig. 2 ). Immunodetection by {alpha}PEP19 revealed three patterns of expression. Pattern 1 (shown in Fig. 2A ) had a single band at 60 kDa whereas pattern 2 (Fig. 2B ) revealed two sets of doublet bands, one at 30 and 36 kDa and the other at ~60 and 70 kDa. Pattern 3 (Fig. 2C ) showed only one band at 30 kDa and one at 60 kDa, and was the most common pattern.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Several isoforms of MC1R expressed by melanocytes are observed in different human cell lines. Western blot profiles obtained using {alpha}PEP19 Ab on 50 µg of total proteins extracted from cell lines are shown. A) Detection using {alpha}PEP19 Ab of MC1R proteins reveal a single band at 60 kDa. B) Immunodetection revealed two sets of two bands each: one at 30 kDa and 36 kDa, and a second one with a greater intensity at ~60 kDa and 70 kDa. C) The most widely represented with 1 band at 30 kDa and a second one at 60 kDa. D) [125I] {alpha}-MSH binding assay. 964b+ melanocytes were incubated with 10 µCi of [125I](Lys11)(Nle4-D-Phe7){alpha}-MSH for 2 h, then washed as described in Materials and Methods. {alpha}-MSH that remained bound to MC1R allowed the detection of 2 pools of signals in native and reducing conditions. The lower signal corresponds to a molecular size of ~30 to 35 kDa and the higher signal gives a size of ~60 to 70 kDa. There is no detectable difference between the intensities of the signals in either native or reducing environments. The corresponding Western blot profile is displayed for band size comparison.

The receptor complexes
A binding experiment was conducted to determine if the doublet of high MW bands (~60–70 kDa) revealed by Western blot correspond to a multi-MC1R complex structure that could bind {alpha}-MSH. We used 125I-{alpha}MSH labeling to detect the receptor, which revealed two distinct signals at ~30–35 kDa and 60–70 kDa and corresponds to the sizes identified by immunoblotting (Fig. 2D ). The intensity of the two signals is approximately equivalent, suggesting that {alpha}-MSH binds with similar affinity to either the high or the low MW forms of the complexes. The same profile was obtained in both native and reducing conditions, indicating that the bond involved in the complex formation is covalent. Our results suggest that what we are detecting at 60–70 kDa corresponds to a dimeric MC1R, but our data cannot at this point exclude the possibility that it could be the result of an interaction between MC1R and another protein.

Characterization of untranslated regions (UTRs)
To characterize at the nucleotide level the isoforms depicted in the Western blots, nested amplifications were performed using two distinct adapter-ligated cDNA libraries for each cell line. 5' RACE-PCR analysis revealed only one DNA fragment corresponding to a 5'untranslated region (5' UTR) of 547 bp. Similar investigations were performed to obtain the 3' UTR but, surprisingly, different products were detected in the 3' RACE-PCR experiments (Fig. 3 A). The largest fragment corresponded to the typical 954 nt coding region with a 762 nt 3' UTR. The smaller fragment corresponded to a 1053 nt coding region with a 283 nt 3' UTR. The sequence translation indicates that the second transcript encodes a 350 amino acid protein that differs from the standard 317 amino acid MC1R by the replacement of the last three residues with a new 36 amino acid C terminus sequence. Therefore, we named the first transcript MC1R317 and the second transcript MC1R350.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. A) Comparative scheme of the structures of the end the monoexonic sequence and 3'UTRs for MC1R317 and MC1R350 determined by RACE-polymerase chain reaction. MC1R317 transcript has the typical coding region of 954 nt and a 762 bp 3'UTR. In MC1R350, a 392 nt sequence including the last 12 nucleotides of the monoexon is spliced, creating a frameshift and the cancellation of the typical termination codon. This results in a 99 nt extension of the coding sequence and an only 283 nt 3'UTR. B) Northern blot of MC1R transcripts of total RNA extracted from M14 (1) and from SKMel28 (2) melanoma cell lines. In a real-time RT-PCR assay performed on 8 melanoma cell lines, M14 was the cell line displaying the lowest proportion of MC1R350 and the unpigmented SKMel28 the highest. The Northern blot profile shows 1 band corresponding to the major MC1R350 in SKMel28 cells and 2 bands in M14 cells, one for the predominant MC1R317 and the second one for the minor MC1R350. C) End of coding sequence and 3'UTR alignment for MC1R317 and MC1R350. Termination codons are underlined, and amino acid sequence corresponding to C terminus extremity is also shown.

Nucleotidic and amino acid sequence analysis
The existence of the two isoforms was confirmed by Northern blot assay using total RNA from M14 and SKMel 28 melanoma cell lines, although melanoma cells may represent a different situation from that of normal melanocytes (Fig. 3B ). In a real-time RT-PCR assay performed on eight melanoma cell lines, M14 melanoma cells displayed the lowest proportion of MC1R350 (5%) and the unpigmented SKMel28 melanoma cells were the highest (90%) (not shown); the absolute amount of total MC1R was higher in M14 cells, which explains why the 5% MC1R350 can be detected. RACE fragments were sequenced and comparisons were established in the 3' region (Fig. 3C ). The splicing event in the second transcript starts 12 nt (corresponding to three amino acids plus the termination codon) upstream of the termination codon. Despite the induced frameshift, the removal of the last cysteine residue is compensated by the coding of another identical residue by the newly determined sequence in exactly the same position.

Secondary structure prediction
We performed a software-based prediction of the secondary structure of the MC1R isoforms using the Predict Protein program accessible at http://www.embl-heidelberg.de/predictprotein/predictprotein.html (Fig. 4 ). Both isoforms have the typical seven transmembrane domain profile, with the carboxyl tail potentially anchored in the melanocyte membrane via the C315 palmitoylation. However, the 350 residue isoform harbors a total of five cysteine residues in its longer C-tail, each a potential target for palmitic acid fixation to the membrane.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Secondary structure prediction of the MC1R isoforms established using the Predict Protein program (EMBL). The typical 317 amino acid consensus protein encoded by the MC1R317 variant is depicted in gray. In black we show the C terminus part specific to the MC1R350 isoform. N2–18, SC-N19, {alpha}PEP19, and {alpha}PEP20 antibodies recognition sites are indicated.

MC1R expression in skin samples from different ethnic origins
MC1R350 was detected in paraffin skin sections using {alpha}PEP20, a rabbit pAb raised against the specific C terminus of that isoform. A positive signal was detected in ~50% of the samples tested and immunofluorescence measurements indicated similar low levels of MC1R350 expression in Caucasian and in Asian skin (Fig. 5 A, B) and a significant 25% higher level in African American skin. Due to the structural characteristics of the two isoforms, it is not possible to design an Ab that would recognize MC1R317 only. Therefore, any Ab that recognizes MC1R317 will also detect de facto MC1R350, revealing the cumulative expression of the two isoforms. We therefore used N2–18 Ab (34 35) and were able to detect the MC1Rs in African American samples only (Fig. 5C ). The N2–18 appears not to be sensitive enough to detect MC1R in Caucasian and Asian skin, where its level of expression is lower.


Figure 5
View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. A) Immunodetection of MC1R350 by {alpha}PEP20 in paraffin-embedded skin sections from Caucasian (C), Asian (A), and African American (AA) donors. Three different subjects were tested for each ethnic group. Representative fluorescence images of MC1R350 detected by FITC-coupled {alpha}PEP20 (green, left column) and nuclei detected by PI (red, right column) in nonirradiated skin are shown for one subject from each ethnic group. B) The related fluorescence index values obtained with the Scion Image program are displayed on the graph. C) Typical images of immunodetection by N2–18 of total MC1R expression after irradiation with 1 MED UV dose. A positive signal was obtained for the 3 African American samples only. Melanocytes had a significant increase in expression 1 and 7 days after irradiation. D) Immunodetection of MC1R350 by {alpha}PEP20 in paraffin embedded skin sections of 3 Asian, Caucasian, and African American subjects. Typical fluorescence images of MC1R350 detected by Texas Red (red, left column) and nuclei detected by DAPI (blue, right column) in UV-irradiated skin. One representative Asian specimen is displayed. E) Graph of fluorescence index measurements in 3 Asian, Caucasian, and African American subjects after immunodetection of MC1R350 by {alpha}PEP20. Data are shown for unirradiated (UI) skin as well as 7 min, 1 day, and 7 days after 1 MED UV exposure.

Influence of 1 minimal erythemal dose (MED) UVR on the MC1Rs expression in skin
{alpha}PEP20 and N2–18 were used to monitor respectively MC1R350 and total MC1R expression 7 min, 1 day, and 7 days after irradiation with 1MED of UV. MC1R350 expression did not significantly vary after UV irradiation in any of the ethnic groups examined (Fig. 5D, E ). At 1 day and 7 days after irradiation, a significant increase was detected by staining with N2–18 which targets the total MC1R corresponding to the sum of MC1R350 and MC1R317 (Fig. 5C ). Therefore, we attribute the increase detected by N2–18 to MC1R317.

Influence of {alpha}-MSH on MC1R expression in cultured NHM
It has been known for a long time that {alpha}-MSH is a principal mediator of the melanogenic effects of UVR (28, 36–37, 31). Therefore, we treated cultured primary NHM for 4 days with 100 nM {alpha}-MSH and assessed the changes in MC1R expression by confocal immunofluorescence (Fig. 6 A) and Western blot (Fig. 6B ) using SC-N19 and {alpha}PEP19 antibodies as well as semiquantitative real-time RT-PCR (Fig. 6C ). Fluorescence index measurements in 1088b cells revealed that upon {alpha}-MSH treatment, MC1R350 expression is increased 1.3-fold whereas the expression of both isoforms is increased 2.3-fold, indicating again that the increase is much greater for MC1R317 than for MC1R350. Western blot profiles revealed that in most of the NHM tested, MC1R317 levels were increased for both the monomer and multicomplex forms. It is interesting that 1088b is the only cell line showing the appearance of the 36 kDa monomer (i.e., MC1R350) after {alpha}-MSH treatment. At the mRNA level, we report that all melanocyte populations increased their total amount of MC1R with the exception of 3C05 cells. Our assay also reveals that all melanocytes (except 3C06 cells) show a higher relative amount of MC1R317 when stimulated by {alpha}-MSH, indicating that MC1R317 is a more suitable answer to an increased melanogenesis.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. A) Immunohistochemical detection of MC1R expression using {alpha}PEP20 (top row) and SC-N19 (bottom row) MC1R antibodies. Single-labeling indirect immunofluorescence and laser scanning confocal microscopy were used to evaluate the localization and intensity of the reaction for MC1R. 1088b NHM show a diffuse reactivity for MC1R (green) under normal conditions ({alpha}PEP20, IFI=71230; SC-N19, IFI=15768). The intensity of MC1R reactivity is increased when cells are treated with {alpha}-MSH ({alpha}PEP20, IFI=94830; SC-N19, IFI=36907). Original, x400. B) Western blot profiles obtained using {alpha}PEP19 Ab on 50 µm of total proteins extracted from cell lines untreated or treated 4 days with 100 nM {alpha}-MSH (top row). An increase in expression of monomers and dimers is detected. 1088b cells reveal the appearance of the 36 kDa band corresponding to MC1R350 after {alpha}-MSH treatment. ß-actin standard is displayed in the bottom row. C) Influence of 100 nM {alpha}-MSH on MC1R mRNA levels in cultured melanocytes H253, 1088b, 3C05, 1118c, 3C06, 1100b, and 1073c. Each bar corresponds to the amount of total MC1R, which is the sum of MC1R317 (in white) and MC1R350 (in gray). In every case (except 3C05 cells) the amount of total MC1R transcripts is significantly increased on {alpha}-MSH treatment, as is the proportion of MC1R317 (except for 3C06 cells). Three independent measurements were performed for each case and the SD is reported as a bar.

Assessment of MC1R isoform expression at the mRNA level
As indicated above, we designed two appropriate sets of oligo-primers that allow us to discriminate between MC1R317 and MC1R350. Figure 7 A shows there is a good correlation between the total level of MC1R mRNA and the total melanin content in the 10 different primary NHM cultures tested. Figure 7B shows an even better correlation between the melanin content and the relative amounts of MC1R317 in the five NHM cultures expressing MC1R350. In the other five populations that do not express MC1R350, the relative amount of MC1R317 is 100% and renders the correlation insignificant. Figure 7C, D reveals that, surprisingly, MC1R350 expression shows an inverse correlation with the total melanin content. Taken together, these results indicate that MC1R317 acts as a positive factor toward synthesis of the total melanin content whereas the MC1R350 isoform could have an opposite action.


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Correlations between total melanin content and MC1R isoforms at the mRNA level obtained by semiquantitative real-time RT-PCR. The 964b+ melanocytic population was set as a reference for both melanin content and MC1R mRNA amounts. A) Total MC1R levels correlate well with the total melanin content in the 10 primary NHM tested. B) The proportion of MC1R317 correlates even better with the total melanin content in cells that express MC1R350. C) The lack of correlation between the relative amount of MC1R350 and the melanin levels. D) The good inverse correlation in cells that express MC1R350 ({blacktriangleup}: melanin content in µg per million cells. {blacksquare}: MC1R levels). On the Y axis, "Relative amount of RNA" refers to panel A: the amount of total MC1R in each melanocyte population compared to the one measured in 964b+; B–D) the proportion of either MC1R317 or MC1R350 compared to the total amount of MC1R.

Downstream signal transduction from MC1R317 and MC1R350
We transfected the primary NHM cultures (H253) using pCMV Script vector containing either MC1R317 or MC1R350. Negative controls were performed by transfecting cells with an empty vector (mock) as well as by using nontransfected cells. Transfection efficiency was assessed by measuring the amount of vector effectively present in the cells by real-time RT-PCR, and these data have been used to standardize measurements of MITF and Tyr transcript levels. Figure 8 shows that while MC1R317 increases expression of MITF and Tyr, MC1R350 dramatically reduces the expression of MITF and Tyr compared to untransfected cells (but expressing a basal level of MC1Rs) and mock-transfected cells. These results show the negative effect of MC1R350 on the intracellular signal transduced to the melanin synthesis pathway.


Figure 8
View larger version (8K):
[in this window]
[in a new window]
 
Figure 8. Effects of MC1R isoforms on MITF and tyrosinase expressions. Levels of expression of MITF (A) and Tyr (B) transcripts in NHM that have been untransfected, mock-transfected, transfected with pCMV-Script-MC1R317 or with pCMV-Script-MC1R350. Three independent measurements were performed for each case. T tests were performed using GraphPad Prism software, and in each case P < 0.05. Bars represent SD. MC1R317 shows a significant positive action on MITF and Tyr expression whereas MC1R350 clearly hampers the expression of the 2 genes.

DISCUSSION

A key role of the MC1R in the determination of skin and hair pigmentation has been hypothesized since MC1R variants causing coat color changes are known in other mammalian species (38 39 40 41) . So far, a great number of MC1R variants have been described in humans, and most result from single amino acid substitutions (2 , 8 , 42 43 44 45 46 47 48) . However, in 1999 Tan et al. described a novel MC1R isoform isolated from human testis, fetal heart, and melanoma G361 cells that bears an additional 65 amino acid sequence at the C terminus (29) . That was the only report of a human MC1R splice variant that did not result from a single amino acid substitution.

In this study, we characterized for the first time a new isoform of the receptor bearing 350 amino acids, namely MC1R350 instead of the MC1R317 with 317 amino acids, as classically described. The full implications of this new isoform as well as its mechanism of action remain to be clarified. However, we have reached a first level of understanding by showing that, unlike MC1R317, relative amounts of MC1R350 mRNA correlate inversely with the total melanin content of the NHM tested. This shows that MC1R350 is not positively involved in melanin synthesis but is perhaps a negative regulator. We have further demonstrated the negative impact of MC1R350 expression on MITF and tyrosinase, two key players of melanogenesis. When primary NHM are treated with {alpha}-MSH, most of the time they increase their level of MC1R350 amount; in contrast, however, in the majority of the cases they also decrease their proportion of this isoform (Fig. 6C ), as large increases in MC1R317 appear to be a more suitable answer to stimulation of the melanogenic pathway for melanocytes. Therefore, one can expect that the mechanism revealed for NHM also applies in the skin. Since our immunohistochemical studies have shown that African American skins have higher absolute levels of MC1R350 compared to Asian and Caucasian skins (Fig. 5) , similar to the way that {alpha}-MSH-treated NHM increase their levels of MC1R350, we expect that darker skins have a greater relative amount of MC1R317. Indeed, UVR exposure does not increase MC1R350 expression but does significantly increase that of MC1R317, therefore increasing its relative amount as well as melanin production. In the model we propose, levels of melanin production appear to be regulated by the balance between the two isoforms of MC1R, and the relative amounts of MC1R317 and MC1R350 act like a rheostat to control the melanin production via MITF and tyrosinase. However, regulation of the balance itself will be interesting to investigate since MC1R350 is generated from MC1R317 by alternative splicing, and thus the nonspliced RNA could be considered an immature transcript. On the other hand, from the protein point of view we cannot rule out the possibility that MC1R350 might get cleaved to the shorter form by a protease, even though the C terminus would be slightly modified, in which case MC1R350 could be considered a proreceptor.

One way to control skin pigmentation was elucidated at the beginning of the 1990s with the molecular characterization of the MC1R and its antagonist agouti signal protein (ASP) (4 , 49) , and we now know that MC1R and ASP are involved in the qualitative and quantitative regulation of mammalian pigmentation (50 51) . ASP is produced in hair follicles and acts on follicular melanocytes to inhibit eumelanin synthesis (52 53) . Recently, the 8818G allele of the ASP gene has been associated with a darker skin color in African Americans (54) . Here, we report for the first time that MC1R isoform-specific expression is closely linked to darker skin pigmentation and photoprotection.

The secondary structure prediction indicates that the C-tail of MC1R350 bears not only one (as does MC1R317), but five, cysteine residues that could be palmitoylated in order to further anchor the tail of the receptor in the melanocyte membrane, which might significantly increase its stability, localization, or function. The carboxyl-terminal domain for all known MC1R proteins is strongly conserved, particularly the cysteine in position 315. In domestic dogs, a pheomelanic hair pattern is induced by the nonfunctional R306ter mutation at the Mc1r locus (40 , 55) , which results from an early termination codon and the loss of the last 12 residues of the receptor, including the C315. By analogy to other G-protein-coupled receptors, the MC1R cytoplasmic tail is not expected to directly participate in signaling, but might impair coupling indirectly if C315 is palmitoylated and participates in receptor localization or trafficking (56 57 58 59). Biochemical and pharmacological studies may help to resolve the influence of this longer C terminus on MC1R function and assess whether or not this sequence is responsible for the negative effect of MC1R350 on the melanogenic pathway.

The Western blot profiles using {alpha}PEP19 also revealed a band (or a doublet) with a MW ~65–70 kDa, i.e., twice the size expected for the MC1R. Using 125I-{alpha}MSH labeling, we detected two distinct binding signals, each corresponding to the sizes seen by immunoblotting. The sum of these results clearly shows that MC1R can be involved in a multiproteic structure that is able to bind {alpha}-MSH with approximately the same affinity as the single receptor. Nevertheless, further studies are needed to establish precisely the nature of the multiproteic complex and its properties. We show that both structures are stable under reducing conditions, which strongly suggests they result from covalent bonds between the entities and not from disulfide bonds between the cysteine residues.

One of the most pressing and tantalizing issues raised by these results is the significance of the MC1R isoforms and their potential dimerization for the pharmacology of MC1R function, and whether this will result in the identification and development of novel ligands that interact selectively with such receptors. It was recently reported that MC1R forms dimeric structures (18) , and that might be what we are detecting here, in which case further studies will be necessary to establish whether MC1R can form heterodimers in an MC1R317-MC1R350 complex. Does MC1R350, as a negative regulator of pigmentation, offer novel possibilities in terms of ways to inhibit melanogenesis? Melanocortin peptide structure-activity relationship studies are providing key insights regarding the design and synthesis of melanocortin selective agonists and/or antagonists and tremendous efforts have been recently put into the design and development of ligands for the melanocortin receptors with properties not present in the endogenous peptides, such as improved potency, receptor selectivity, and bioavailability (60).

MC1R350 has been detected in ~50% of the cell lines studied, but so far we have not identified any cell line that expresses exclusively MC1R350. A larger screening process hopefully will identify melanocytes producing only MC1R350, which would be valuable as an in vivo model to further study the pharmacology and the functionality of this isoform.

ACKNOWLEDGMENTS

This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research, and also in part by NIH grant R01 ES009110 (Z. Abdel-Malek). The authors wish to thank Dr. Janusz Z. Beer and Barbara Z. Zmudska of the FDA for providing some of the specimens used in this study, and Pr. J. L. Garcia-Borron from the University of Murcia, Spain for insightful discussions.

Received for publication March 3, 2006. Accepted for publication April 10, 2006.

REFERENCES

  1. Harrison, G. A. (1973) Differences in human pigmentation: measurement, geographic variation, and causes. J. Invest. Dermatol. 60,418-426[CrossRef][Medline]
  2. Valverde, P., Healy, E., Jackson, I., Rees, J. L., Thody, A. J. (1995) Variants of the melanocyte-stimulating hormone receptor gene are associated with red hair and fair skin in humans. Nat. Genet. 11,328-330[CrossRef][Medline]
  3. Box, N. F., Wyeth, J. R., O’Gorman, L. E., Martin, N. G., Sturm, R. A. (1997) Characterization of melanocyte stimulating hormone receptor variant alleles in twins with red hair. Hum. Mol. Genet. ,1891-1897
  4. Mountjoy, K. G., Robbins, L. S., Mortrud, M. T., Cone, R. D. (1992) The cloning of a family of genes that encode the melanocortin receptors. Science 257,1248-1251[Abstract/Free Full Text]
  5. Chhajlani, V., Wikberg, J. E. (1992) Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA. FEBS Lett. 309,417-420[CrossRef][Medline]
  6. Smith, R., Healy, E., Siddiqui, S., Flanagan, N., Steijlen, P. M., Rosdahl, I., Jacques, J. P., Rogers, S., Turner, R., Jackson, I. J., et al (1998) Melanocortin 1 receptor variants in an Irish population. J. Invest. Dermatol. 111,119-122[CrossRef][Medline]
  7. Frandberg, P. A., Doufexis, M., Kapas, S., Chhajlani, V. (1998) Human pigmentation phenotype: a point mutation generates nonfunctional MSH receptor. Biochem. Biophys. Res. Commun. 245,490-492[CrossRef][Medline]
  8. Schioth, H. B., Phillips, S. R., Rudzish, R., Birch-Machin, M. A., Wikberg, J. E., Rees, J. L. (1999) Loss of function mutations of the human melanocortin 1 receptor are common and are associated with red hair. Biochem. Biophys. Res. Commun. 260,488-491[CrossRef][Medline]
  9. Suzuki, I., Cone, R. D., Im, S., Nordlund, J., Abdel-Malek, Z. A. (1996) Binding of melanotropic hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis. Endocrinology 137,1627-1633[Abstract]
  10. Abdel-Malek, Z., Swope, V. B., Suzuki, I., Akcali, C., Harriger, M. D., Boyce, S. T., Urabe, K., Hearing, V. J. (1995) Mitogenic and melanogenic stimulation of normal human melanocytes by melanotropic peptides. Proc. Natl. Acad. Sci. U. S. A. 92,1789-1793[Abstract/Free Full Text]
  11. Bockaert, J., Pin, J. P. (1999) Molecular tinkering of G protein-coupled receptors: an evolutionary success. EMBO J. 18,1723-1729[CrossRef][Medline]
  12. Wilson, S., Bergsma, D. J., Chambers, J. K., Muir, A. I., Fantom, K. G., Ellis, C., Murdock, P. R., Herrity, N. C., Stadel, J. M. (1998) Orphan G-protein-coupled receptors: the next generation of drug targets?. Br. J. Pharmacol. 125,1387-1392[CrossRef][Medline]
  13. Salahpour, A., Angers, S., Bouvier, M. (2000) Functional significance of oligomerization of G-protein-coupled receptors. Trends Endocrinol. Metab. 11,163-168[CrossRef][Medline]
  14. Donatien, P. D., Hunt, G., Pieron, C., Lunec, J., Taieb, A., Thody, A. J. (1992) The expression of functional MSH receptors on cultured human melanocytes. Arch. Dermatol. Res. 284,424-426[CrossRef][Medline]
  15. Hebert, T. E., Bouvier, M. (1998) Structural and functional aspects of G protein-coupled receptor oligomerization. Biochem. Cell Biol. 76,1-11[CrossRef][Medline]
  16. Milligan, G. (2004) G protein-coupled receptor dimerization: function and ligand pharmacology. Mol. Pharmacol. 66,1-7[Abstract/Free Full Text]
  17. Mandrika, I., Petrovska, R., Wikberg, J. (2005) Melanocortin receptors form constitutive homo- and heterodimers. Biochem. Biophys. Res. Commun. 326,349-354[CrossRef][Medline]
  18. Sanchez-Laorden, B. L., Sanchez-Mas, J., Martinez-Alonso, E., Martinez-Menarguez, J. A., Garcia-Borron, J. C., Jimenez-Cervantes, C. (2006) Dimerization of the human melanocortin 1 receptor: functional consequences and dominant-negative effects. J. Invest. Dermatol. 126,172-181[CrossRef][Medline]
  19. Imoto, K., Kobayashi, N., Katsumi, S., Nishiwaki, Y., Iwamoto, T. A., Yamamoto, A., Yamashina, Y., Shirai, T., Miyagawa, S., Dohi, Y., et al (2002) The total amount of DNA damage determines ultraviolet-radiation-induced cytotoxicity after uniformor localized irradiation of human cells. J. Invest. Dermatol. 119,1177-1182[CrossRef][Medline]
  20. Rouzaud, F., Kadekaro, A. L., Abdel-Malek, Z. A., Hearing, V. J. (2005) MC1R and the response of melanocytes to ultraviolet radiation. Mutat. Res. 571,133-152[Medline]
  21. Chakraborty, A. K., Funasaka, Y., Slominski, A., Bolognia, J., Sodi, S, Ichihashi, M., Pawelek, J. M. (1999) UV light and MSH receptors. Ann. N. Y. Acad. Sci. 885,100-116[Medline]
  22. Tadokoro, T., Kobayashi, N., Zmudzka, B. Z., Ito, S., Wakamatsu, K., Yamaguchi, Y., Korossy, K. S., Miller, S. A., Beer, J. Z., Hearing, V. J. (2003) UV-induced DNA damage and melanin content in human skin differing in racial/ethnic origin. FASEB J. 17,1177-1179[Abstract/Free Full Text]
  23. Halder, R. M., Bridgeman-Shah, S. (1995) Skin cancer in African Americans. Cancer 75,667-673[CrossRef][Medline]
  24. Preston, D. S., Stern, R. S. (1992) Nonmelanoma cancers of the skin. N. Engl. J. Med. 327,1649-1662[Medline]
  25. Kricker, A, Armstrong, B. K., English, D. R. (1994) Sun exposure and non-melanocytic skin cancer. Cancer Causes Control 5,367-392[CrossRef][Medline]
  26. Scott, M. C., Suzuki, I., Abdel-Malek, Z. A. (2002) Regulation of the human melanocortin 1 receptor expression in epidermal melanocytes by paracrine and endocrine factors and by ultraviolet radiation. Pigment Cell Res. 15,433-439[CrossRef][Medline]
  27. Tan, C. P., McKee, K. K., Weinberg, D. H., MacNeil, T., Palyha, O. C., Feighner, S. D., Hreniuk, D. L., Van Der Ploeg, L. H., MacNeil, D. J., Howard, A. D. (1999) Molecular analysis of a new splice variant of the human melanocortin-1 receptor. FEBS Lett. 451,137-141[CrossRef][Medline]
  28. Siegrist, W., Eberle, A. N. (1986) In situ melanin assay for MSH using mouse B16 melanoma cells in culture. Anal. Biochem. 159,191-197[CrossRef][Medline]
  29. Rouzaud, F., Annereau, J. P., Valencia, J. C., Costin, G. E., Hearing, V. J. (2003) Regulation of melanocortin 1 receptor expression at the mRNA and protein levels by its natural agonist and antagonist. FASEB J. 17,2154-2156[Abstract/Free Full Text]
  30. Tadokoro, T., Yamaguchi, Y., Batzer, J., Coelho, S. G., Zmudzka, B. Z., Miller, S. A., Wolber, R., Beer, J. Z., Hearing, V. J. (2005) Mechanisms of skin tanning in different racial/ethnic groups in response to ultraviolet radiation. J. Invest. Dermatol. 124,1326-1332[CrossRef][Medline]
  31. Jiménez, M., Maloy, W. L., Hearing, V. J. (1989) Specific identification of an authentic clone for mammalian tyrosinase. J. Biol. Chem. 264,3397-3403[Abstract/Free Full Text]
  32. Böhm, M., Metze, D., Schulte, U., Becher, E., Luger, T. A., Brzoska, T. (1999) Detection of melanocortin-1 immunoreactivity in human skin cells in culture and in situ. Exp. Dermatol. 8,453-461[Medline]
  33. Böhm, M., Brzoska, T., Schulte, U., Schiller, M., Kubitscheck, U., Luget, T. A. (1999) Characterization of a polyclonal antibody against the human melanocortin-1 receptor. Ann. N. Y. Acad. Sci. 885,372-382[Medline]
  34. Pawelek, J. M., Chakraborty, A. K., Osber, M. P., Orlow, S. J., Min, K. K., Rosenzweig, K. E., Bolognia, J. L. (1992) Molecular cascades in UV-induced melanogenesis: a central role for melanotropins?. Pigment Cell Res. 5,348-356[CrossRef][Medline]
  35. Im, S., Moro, O., Peng, F., Medrano, E. E., Cornelius, J., Babcock, G., Nordlund, J. J., Abdel-Malek, Z. A. (1998) Activation of the cyclic AMP pathway by alpha-melanotropin mediates the response of human melanocytes to ultraviolet B radiation. Cancer Res. 58,47-54[Abstract/Free Full Text]
  36. Robbins, L. S., Nadeau, J. H., Johnson, K. R., Kelly, M. A., Roselli-Rehfuss, L., Baack, E., Mountjoy, K. G., Cone, R. D. (1993) Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72,827-834[CrossRef][Medline]
  37. Klungland, H., Vage, D. I., Gomez-Raya, L., Adalsteinsson, S., Lien, S. (1995) The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mamm. Genome 6,636-639[CrossRef][Medline]
  38. Newton, J. M., Wilkie, A. L., He, L., Jordan, S.A., Metallinos, D. L., Holmes, N. G., Jackson, I. J., Barsh, G. S. (2000) Melanocortin 1 receptor variation in the domestic dog. Mamm. Genome 11,24-30[CrossRef][Medline]
  39. Rouzaud, F., Martin, J., Gallet, P. F., Delourme, D., Goulemot-Leger, V., Amigues, Y., Menissier, F., Leveziel, H., Julien, R., Oulmouden, A. (2000) A first genotyping assay of French cattle breeds based on a new allele of the extension gene encoding the melanocortin-1 receptor (Mc1r). Genet. Sel. Evol. 32,511-520[CrossRef][Medline]
  40. Rana, B. K., Hewett-Emmett, D., Jin, L., Chang, B. H., Sambuughin, N., Lin, M., Watkins, S., Bamshad, M., Jorde, L. B., Ramsay, M. (1999) High polymorphism at the human melanocortin 1 receptor locus. Genetics 151,1547-1557[Abstract/Free Full Text]
  41. Jimenez-Cervantes, C., Germer, S., Gonzalez, P., Sanchez, J., Sanchez, C. O., Garcia-Borron, J. C. (2001) Thr40 and Met122 are new partial loss-of-function natural mutations of the human melanocortin 1 receptor. FEBS Lett. 508,44-48[CrossRef][Medline]
  42. Jimenez-Cervantes, C., Olivares, C., Gonzalez, P., Morandini, R., Ghanem, G., Garcia-Borron, J. C. (2001) The Pro162 variant is a loss-of-function mutation of the human melanocortin 1 receptor gene. J. Invest. Dermatol. 117,156-158[CrossRef][Medline]
  43. Box, N. F., Duffy, D. L., Irving, R. E., Russell, A., Chen, W., Griffyths, L. R., Parsons, P. G., Green, A. C., Sturm, R. A. (2001) Melanocortin-1 receptor genotype is a risk factor for basal and squamous cell carcinoma. J. Invest. Dermatol. 116,224-229[CrossRef][Medline]
  44. Sturm, R. A., Teasdale, R. D., Box, N. F. (2001) Human pigmentation genes: identification, structure and consequences of polymorphic variation. Gene 277,49-62[CrossRef][Medline]
  45. Scott, M. C., Wakamatsu, K., Ito, S., Kadekaro, A. L., Kobayashi, N., Groden, J., Kavanagh, R., Takakuwa, T., Virador, V., Hearing, V. J., et al (2002) Human melanocortin 1 receptor variants, receptor function and melanocyte response to UV radiation. J. Cell Sci. 115,2349-2355[Abstract/Free Full Text]
  46. John, P. R., Ramsay, M. (2002) Four novel variants in MC1R in red-haired South African individuals of European descent: S83P, Y152X, A171D, P256S. Hum. Mutat. 19,461-462[Medline]
  47. Lu, D., Willard, D., Patel, I. R., Kadwell, S., Overton, L., Kost, T., Luther, M., Chen, W., Woychik, R. P., Wilkison, W. O. (1994) Agouti protein is an antagonist of the melanocyte stimulating- hormone receptor. Nature 371,799-802[CrossRef][Medline]
  48. Little, C. C. (1957) The Inheritance of Coat Color in Dogs Howell New York.
  49. Searle, A. G. (1968) Comparative Genetics of Coat Colour in Mammals Academic Press New York.
  50. Silvers, W. K., Russel, E. S. (1955) An experimental approach to action of genes at the agouti locus in mouse. J. Exp. Zool. 130,199-220[CrossRef]
  51. Silvers, W. K. (1979) The Coat Colors of Mice: A Model for Mammalian Gene Action and Interaction Springer-Verlag Basel, Switzerland.
  52. Bonilla, C., Boxill, L. A., Donald, S. A., Williams, T., Sylvester, N., Parra, E. J., Dios, S., Norton, H. L., Shriver, M. D., Kittles, R. A. (2005) The 8818G allele of the agouti signaling protein (ASIP) gene is ancestral and is associated with darker skin color in African Americans. Hum. Genet. 116,402-406[CrossRef][Medline]
  53. Everts, R. E., Rothuizen, J., van Oost, B. A. (2000) Identification of a premature stop codon in the melanocyte-stimulating hormone receptor gene (MC1R) in Labrador and Golden retrievers with yellow coat colour. Anim. Genet. 31,194-199[CrossRef][Medline]
  54. Eason, M. G., Jacinto, M. T., Theiss, C. T., Liggett, S. B. (1994) The palmitoylated cystein of the cytoplasmic tail of alpha 2A-adrenergic receptors confers subtype-specific agonist-promoted downregulation. Proc. Natl. Acad. Sci. U. S. A. 91,11178-11182[Abstract/Free Full Text]
  55. Kawate, N., Menon, K. M. (1994) Palmitoylation of luteinizing hormone/human choriogonadotropin receptors in transfected cells. Abolition of palmitoylation by mutation of Cys-621 and Cys-622 residues in the cytoplasmic tail increases ligand-induced internalization of the receptor. J. Biol. Chem. 269,30651-30658[Abstract/Free Full Text]
  56. Schulein, R., Liebenhoff, U., Muller, H., Birnbaumer, M., Rosenthal, W. (1996) Properties of the human arginine vasopressin V2 receptor after site-directed mutagenesis of its putative palmitoylation site. Biochem. J. 313,611-616[Medline]
  57. Tanaka, K., Nagayama, Y., Nishihara, E., Namba, H., Yamashita, S., Niwa, M. (1998) Palmitoylation of human thyrotropin receptor: slower intracellular trafficking of the palmitoylation-defective mutant. Endocrinology 139,803-806[Abstract/Free Full Text]
  58. Irani, B. G., Holder, J. R., Todorovic, A., Wilczynski, A. M., Joseph, C. G., Wilson, K. R., Haskell-Luevano, C. (2004) Progress in the development of melanocortin receptor selective ligands. Curr. Pharm. Des. 10,3443-3479[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Yamaguchi, M. Brenner, and V. J. Hearing
The Regulation of Skin Pigmentation
J. Biol. Chem., September 21, 2007; 282(38): 27557 - 27561.
[Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. Haitina, A. Ringholm, J. Kelly, N. I. Mundy, and H. B. Schioth
High Diversity in Functional Properties of Melanocortin 1 Receptor (MC1R) in Divergent Primate Species Is More Strongly Associated with Phylogeny than Coat Color
Mol. Biol. Evol., September 1, 2007; 24(9): 2001 - 2008.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-5922fjev1
20/11/1927    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rouzaud, F.
Right arrow Articles by Hearing, V. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rouzaud, F.
Right arrow Articles by Hearing, V. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS