FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-5716fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-5716fjev1
20/11/1916    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carrotta, R.
Right arrow Articles by San Biagio, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrotta, R.
Right arrow Articles by San Biagio, P. L.
(The FASEB Journal. 2006;20:1916-1917.)
© 2006 FASEB

Toxicity of recombinant ß-amyloid prefibrillar oligomers on the morphogenesis of the sea urchin Paracentrotus lividus

R. Carrotta*,1, M. Di Carlo{dagger},1, M. Manno*, G. Montana{dagger}, P. Picone{dagger}, D. Romancino{dagger} and P. L. San Biagio*,2

* CNR-Istituto di Biofisica U.O. di Palermo, Palermo, Italy; and

{dagger} CNR-Istituto di Biomedicina e di Immunologia Molecolare, Palermo, Italy

2Correspondence: CNR-IBF, Via Ugo La Malfa, 153, 90146 Palermo, Italy. E-mail: pierluigi.sanbiagio{at}pa.ibf.cnr.it

ABSTRACT

A distinctive feature of Alzheimer’s disease is the deposition of amyloid ß-protein (Aß) in senile or diffuse plaques. The 42 residue ß-peptide (Aß42) is the predominant form found in plaques. In the present work we report a high-yield expression and purification method of production of a recombinant Aß42. The purified recombinant peptide shows characteristics similar to the synthetic human peptide. Different size aggregates, either small oligomers or larger aggregates, were obtained upon dissolving the recombinant Aß42 peptide under different conditions at pH 7.2 or pH 3, respectively. We report a new toxicity assay on the morphogenic development of the sea urchin Paracentrotus lividus and study the toxicity of the two kinds of aggregates. Despite the difference between the ionic strength of human extracellular fluid (0.154 mol/l) and artificial sea water (0.48 mol/l), toxicity data collected in this system have an intrinsic relevance. The different ionic strength, in fact, could change the kinetics of oligomer formation, but the effect of morphogenic development reported here is related to the final oligomer sizes. Results of the toxicity assay of Aß42 on sea urchin development also show a dose-dependent effect. After only 4 h of embryo development, one can note morphological defects in the cell membrane. Retardation of the embryo’s development, along with cellular disorders visible inside the blastocoele, can be observed after 1 day of development. Cellular degeneration in two different pathological phenotypes—the occluded blastulae and the occluded prism—is present after 48 h of development. Results show that a greater effect on cell death is induced by the small oligomers stabilized under physiological conditions than at acid pH. In this case only occluded blastulae are found after 48 h of development.—Carrotta, R., Di Carlo, M., Manno, M., Montana, G., Picone, P., Romancino, D., San Biagio, P. L. Toxicity of recombinant ß-amyloid prefibrillar oligomers on the morphogenesis of the sea urchin Paracentrotus lividus.


Key Words: Aß42 • light scattering • toxicity

THE AMYLOID ß-PEPTIDE (Aß) is the main component of the extracellular senile plaques extracted from two specific brain regions, the hippocampus and cerebral cortex, from Alzheimer’s deceased people (1) . The precise mechanisms that cause Alzheimer’s disease (AD) and the role of Aß aggregates in its etiology are still topics of scientific debate (2 3 4 5 6 7 8 9 10) . The core of senile plaques is made of protein material organized in structured linear aggregates (amyloid fibrils). Amyloid ß-peptides of varying length (39–43 residues) are produced by cleavage of a transmembrane protein, the amyloid ß-protein precursor (APP) (11) . The 42 residues ß-peptide (Aß42) is the predominant form found in plaques. In vitro, Aß42 can form fibrils that are similar to the ones found in Alzheimer’s plaques. Although the connection between clinical symptoms and Aß production is well established, the role of the ß-peptide in the disease is still controversial. A convincing and popular belief is that small diffusible oligomers of Aß42, called ADDLs (6) , are the determining pathogenic species causing synaptic dysfunction and eventually neuronal degeneration. Such oligomers, also obtained by in vivo amyloid deposits, could cause membrane damage, alter membrane fluidity, and act as neurotoxins forming pores in membranes. This view would explain why early symptoms of ad are poorly correlated with detection of plaques in the brain (2 , 12) . Many recent studies concerning a complete characterization of ß-peptides, their aggregation properties, and their toxic effect in vivo have been performed with great effort (3 4 5 6 , 9 , 10 , 12 13 14 15 16 17 18 19 20) . The main experimental difficulties in working with this system essentially come from its biochemical and physical properties. The aggregation properties of the commercially synthesized ß-peptides, for example, can be changed by the presence in solution of small aggregates (seeds) or spurious products as well as the presence of fragments of the entire protein (21 22) . Pretreatment of synthetic ß-peptides in different solvents able, for example, to dissolve small aggregates can improve the experimental repeatability (14) . An alternative method to obtain amyloid ß-peptides is the expression of the recombinant peptides in bacteria and their ensuing purification. Production of polypeptides and small proteins using the machinery of living organisms can be preferable because it allows better control of protein purity (23) . Here we report data on the expression and purification of the human recombinant peptide Aß42 obtained by using RNA from human neuroblastoma LAN5 cells and an Escherichia coli expression vector. This technique of production allows us to obtain large amounts of peptide, with properties similar to those found in synthetic Aß42. Kinetics of aggregation of Aß42 solutions are reported at pH 3 and pH 7.2 and T = 37°C, using light scattering, in order to characterize the initial conditions and the aggregation properties of the recombinant purified peptide under both conditions (18 , 19) . Small oligomers (5 nm diameter) and larger aggregates (30 nm diameter) are observed at physiological and acid pH, respectively, similar to what has been reported for synthetic peptides (18 , 19) . It is well known that Aß42 aggregation is dependent on pH, peptide concentration, and incubation time in aqueous buffer. Time course static light scattering measurements also show aggregation behavior similar to that reported for the synthetic peptide (15 ,18) . Furthermore, in this work we report a new toxicity assay of Aß42 on a living organism, the sea urchin Paracentrotus lividus. Among the classical model systems, sea urchin provides a powerful model for a great variety of studies in molecular and cell biology and biochemistry (24 25 26) . Eggs and embryos are transparent, allowing direct observation of cell division and movement. Nervous systems begin to be present with some neurons at late gastrula, and at pluteus ganglia, neurons and neuritis are present in the structure called the ciliary band, in the esophagus, and in the intestine (27) . Moreover, sea urchin occupies a key phylogenetic position as the only nonchordate detereustomes and the results obtained on this embryo can be extrapolated and compared to those of higher eukaryotes such as mammalian.

MATERIALS AND METHODS

Cloning of Aß42 peptide
A DNA fragment containing the coding sequences for the Aß 42 peptide was amplified by reverse transcription polymerase chain reaction (PCR) (RT-PCR) from 2 µg of total RNA from human neuroblastoma LAN5 cells (gift of Dr. M. Cervello). Reverse transcription was carried out with SuperScript II (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. PCR amplification was performed with Platinum Taq High Fidelity (Invitrogen) using an initial denaturing step at 95°C for 2 min, followed by 35 cycles of incubation at 95°C for 1 min, 55°C for 1 min, 72°C for 1 min. Forward (TCAAGGATCCATGCAGAATTCCGACAT) and reverse (AACGAAGCTTTGTCGCTATGACAACT) primers corresponding to the 5'- and 3'-ends of the human 42 Aß peptide of APP protein were designed to containing BamHI and HindIII restriction sites (underlined) for directional and in-frame cloning. The resulting PCR product was digested with BamHI and HindIII, eluted from the gel utilizing Gel cleanup (Eppendorf, Madison, WI, USA), and legated to the vector pQE30 (Qiagen, Chatsworth, CA, USA), which was previously digested with the same enzymes. The legated product was transformed in competent M15 E. coli. A recombinant clone (pQE30-Aß42) was isolated and characterized by restriction digestion and sequencing.

Bacterial expression
Recombinant human Aß42 peptide was expressed as a fusion protein linked to a polyhistidine (6 x His) peptide at the NH2 terminus. A preculture was grown overnight at 37°C in Luria broth (LB) with ampicillin (50 µg/ml) and Kanamycin (25 µg/ml), and was inoculated to fresh LB medium (1:50 dilution). The protein expression was induced with 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) when the absorbance at 600 nm reached 0.6. After growth for 5 h at 37°C, the cells were chilled in ice and harvested by centrifugation at 4000 g for 15 min at 4°C. Commercial Aß42 obtained from Biosource (Camarillo, CA, USA) was used as a control and prepared for experiments in the same manner.

Electroelution of His6-Aß42
Preparative SDS-PAGE containing protein extracted from induced pQE30-Aß42 was carried out. A band corresponding to the induced protein was excised from the gel and electro eluted in 50 mM NH4CO3 at 60 mA at 4°C overnight utilizing a Bio-Rad apparatus (Hercules, CA, USA). The recovered samples were dried in a speed vacuum.

SDS-PAGE and Western blot
Analysis of fractions obtained at various steps in the expression or purification process was carried out using 15% SDS-PAGE or 4–12% gradient gel (NUPAGE Invitrogen). The protein bands were visualized by staining with Comassie brillant blue R-250 or with cold 1M KCl for electroelution. For Western blot protein samples SDS-PAGE gels were transferred onto nitrocellulose filters. After blocking in 3% BSA in TBST, the Western blot was incubated with anti-His (1:7500) probe (Pierce, Rockford, IL, USA) or antibeta-amyloid (1:2000) overnight at 4°C. Primary antibodies were detected using the enhanced chemiluminescence (ECL) chemiluminescence’s kit (Amersham, Arlington Heights, IL, USA), according to the manufacturer’s instructions, and using secondary antibodies conjugated to horseradish peroxidase (1:7500) (Amersham).

Sample pretreatment
The peptide obtained as a powder was dissolved in trifluoroacetic acid (TFA) and gently stirred for 3 h at 5°C to completely dissolve associated peptides (14 ,16) . The solution was then diluted 1/10 by adding deionized water and immediately lyophilized.

Sample preparation for scattering measurements
Samples at acid condition were obtained by dissolving the pretreated lyophilized powder in 0.1 M sodium-citrate buffer at pH 3, or in 0.01 M Tris-HCl buffer at pH 7.2. Solutions made for scattering measurements were filtered through a 0.02 µm Anotop syringe filter (Whatman, Clifton, NJ, USA) directly into cylindrical quartz cuvettes. A negligible loss of material under filtration was noticed after dissolution at both conditions, pH 3 and pH 7.2, confirming that the peptide was efficiently dissolved by the treatment in TFA. Moreover, no significant aggregation occurred while dissolving the peptide at neutral pH (14) despite the acid conditions of the pretreatment. Final peptide concentration was obtained by measuring tyrosine absorption (extinction coefficient {epsilon}276=1390 M–1 cm–1) with a Jasco J-530 spectrophotometer (28) . For samples at pH 3 and pH 7.2, the measured concentration was respectively 180 µM and 200 µM.

Static and quasi-elastic light scattering (SLS and QLS)
Time-resolved light scattering experiments were carried out at T = 37°C immediately after peptide dissolution in buffer at pH 3 or at pH 7.2. The cuvette was placed in a thermostatically controlled cell compartment of a Brookhaven Instrument BI200-SM goniometer equipped with a 30 mW He-Neon Spectra Physics laser tuned at {lambda}0 = 632.8 nm. Temperature was thermostatically controlled by a circulating bath with a tolerance within 0.05°C. Scattered light intensity at 90°, I90°(t), and its time autocorrelation function, g2(t), were measured simultaneously by using a Brookhaven BI-9000 correlator. The static scattered light was monitored in order to follow the growth of the wt averaged molecular mass Mw in the aggregation process of the Aß42 peptide, according to

Formula
where n is the refraction index of the solution, {lambda}0 is the laser wavelength, dn/dc is the derivative of n to respect of the protein concentration (we use dn/dc=0.18 cm3g–1), c is the protein concentration, and Mw its MW. P(90°) ≤ 1 accounts for a decrease in intensity due to the increase of the scatterer’s average dimension, d (d≥{lambda}0/10) (29) . Autocorrelation functions g2(t) were analyzed using a smoothing constrained regularization method (30) in order to obtain the distribution P(D) of the apparent diffusion coefficients Formula, where qis the scattering vector defined as Formula, with n the medium refractive index and {theta} the scattering angle (29) . Assuming the Stokes Einstein relation, we can express the apparent diffusion coefficient as a function of the z-averaged hydrodynamic diameter Dh: Formula, where k is the Boltzman constant, T the absolute temperature, and {eta} the solvent viscosity. Thus, we obtain the distribution P(Dh) of the z-averaged hydrodynamic diameter. The absolute scale for the scattered intensity was obtained by normalization with respect to toluene, whose Rayleigh ratio at 632.8 nm was taken as 14 x 10–6cm–1.

Thioflavin T staining
Aliquots of a recombinant Aß42 solution at pH 3 and c = 180 µM, incubated at T = 37°C for 4 days, were stained adding Thioflavin-T at a final concentration of 70 µM and applied to microscope slides. The presence of fibrils was confirmed either with differential interference contrast (DIC) or fluorescence optics using a FITC filter ({lambda}ex=470±20 nm, ({lambda}em>515 nm) of an Axioscop 2 microscope (Zeiss, Thornwood, NY, USA). The images were captured using an Axiocam digital camera interfaced with a computer.

Morphogenetic assay
Eggs from sea urchins (Paracentrotus lividus) were demembranated by fertilization in 2 mM PABA. Approximately 1000 embryos were added to artificial sea water (ASW) and purified Aß42 at different doses (from 0.03 to 3 µM) was added in 8-well plates at two cell stages. Depending on the experiment, the Aß42 was solved in water or in buffer at pH 3 or pH 7. The effect on morphogenesis was observed at different times of development by microscopic inspection, and representative pictures of the sample were recorded using a Zeiss Axioscop2. As a control, in all experiments embryos were also cultured in ASW or in ASW containing 3 µM BSA or in ASW containing the buffer in which the Aß42 was dissolved; assays were repeated three times with different batches.

RESULTS

Cloning and purification of recombinant Aß42 peptide
To investigate intrinsic biochemical and biophysical proprieties of Aß42, we utilized an expression plasmid to produce Aß42 recombinant protein. Human Aß42 was reversed translated by cultured LAN5 neuroblastoma cell line RNA and inserted in pQ30 expression plasmid. Upon IPTG induction, E. coli transformed with pQ30- Aß42 produced a very large amount of a 4.8 kDa fusion protein (Fig. 1 A). Moreover, to contrast the tendency of Aß42 to form aggregates, we decided to cut the band corresponding to the recombinant protein directly from preparative gels and to elute the peptide in order to avoid oligomer formation (Fig. 1A ). To obtain additional evidence that the recombinant peptide is Aß42, Western blots containing induced E. coli total proteins and purified peptide were incubated with anti-His (Fig. 1B ) and an human anti-Aß42 (Fig. 1C ). The recombinant protein was recognized by both the antibodies, confirming that the produced and isolated peptide is the right one; the reaction with anti-Aß42 also suggests that its immunological proprieties are maintained.


Figure 1
View larger version (68K):
[in this window]
[in a new window]
 
Figure 1. Expression and purification of recombinant Aß42. A) SDS-PAGE stained with Coomassie blue. E. coli transformed with pQ30-Aß42 without (lane 1) or with (lane 2) IPTG induction. Fusion protein purified by electrolelution (lane 3). B) Western blot of E. coli transformed pQ30-Aß42 without (lane 1) or with (lane 2) IPTG induction and purified recombinant protein (lane 3) incubated with anti-His. C) Western blot of noninduced (lane 1) or induced (lane 2) E. coli transformed pQ30-Aß42 and purified (lane 3) His6-Aß42, incubated with anti-Aß42. Arrows indicate the expressed or purified Aß42. On the right the migration position of different standard proteins is expressed in kDa.

Initial size and mass at pH 7.2 and pH 3
To know what different structural species are present in solution when the Aß42 peptide is dissolved at pH 7.2 and pH 3, we measured the light intensity scattered at 90° and its autocorrelation function immediately after dissolution and filtration. Figure 2 A shows the distribution function of the z-averaged hydrodynamic diameter, P(Dh), under both conditions. At pH 7.2 we observe a dominant band of small oligomer, with dimensions ranging from ~3 to 7 nm, and a broad band of aggregates with hydrodynamic diameter 10-fold larger. It should be noted that the low relative intensity of the aggregate band suggests that the number of molecules with a diameter of ~50 nm is very low compared to the number of oligomers. At pH 3, an intense band of large oligomers with z-averaged hydrodynamic diameter of ~30 nm is detected. However, to give a clear picture, we should indicate that together with the small oligomers at pH 7.2 and the large oligomers at pH 3, there could also be monomers present in solution. The presence of these species cannot be detected with our technique because their diffusive motions are too fast for the time resolution of our experimental setup. The wt averaged molecular mass of the species in solution immediately after dissolution at both pH values was calculated by the measured Rayleigh ratio. Taking dn/dc = 0.18 cm3 g–1 (31) , P(90°)=1, and using the known molecular mass of the monomer peptide, Mw = 4.8 kDa, we find that Mw = 10.7 ± 0.6 kDa at pH 7.2 and Mw = 44.5 ± 2.3 kDa at pH 3, suggesting the presence of dimers or trimers in the former case and nine-mers or decamers in the latter case. These values should be taken as the mean of the oligomer’s size due to the presence of some undetected monomers. However, the distribution function along with the average molecular mass indicate quite clearly that different oligomer species are stabilized at the two different pH conditions (32) . To better ascertain the presence of small or large oligomers in the sample at pH 7 and pH 3, respectively, we carried out a 4–12% gradient SDS-PAGE containing an aliquot of both samples. The Western blot was incubated with anti-His and the result obtained confirms that under acid condition there are strong aggregation bands with a MW higher than 180 kDa; under neutral conditions, only a band with a MW corresponding to small oligomers was detected (data not shown). The presence of small oligomers at pH 7.2 indicates that under this condition these species are not strongly assembled, and separate and enter the gel as monomers because of the denaturing pretreatment with SDS (33) .


Figure 2
View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. A) Distribution function of the z-average hydrodynamic diameter at 37°C immediately after dissolution at pH 7.2 and c = 200 µM (continuous line) and at pH 3.2 and c = 180 µM (dashed line). Analysis of QLS data was performed as described in the text. The distribution is reported in terms of the hydrodynamic diameter by assuming the Stokes-Einstein relation. B) Time evolution of the scattered intensity at 90° from Aß42 peptide dissolved at pH 3 and c = 180 µM (full circle), and at pH 7.2 and c = 200 µM (full triangles) at 37°C.

Kinetics of aggregation at pH 7.2 and pH 3
To study the aggregation properties of the Aß42 peptide in solution at 37°C, the light scattered at 90° was recorded at different times. Figure 2B reports on the time evolution of the Rayleigh ratio for the two samples at pH 7.2 and pH 3. No intensity change is detected at pH 7.2 within the first 2 h of observation. The experimental evidence that small species are in equilibrium at this pH together with this long-lasting lag phase in the aggregation process confirm that no seeds (i.e., preaggregated peptides) are present after filtration. In contrast, at pH 3 an intensity increase is registered after 30 min at 37°C. The behavior of the intensity growth agrees quite well with kinetics data of the scattered intensity at 90° measured from a solution of Aß40 peptide at 37°C and c = 185 µM (18) .

Thioflavin T staining of aggregated mature fibrils
To demonstrate the fibrillar nature of the aggregates obtained from Aß42 at pH 3, we stained a solution with thioflavin T after 4 days of incubation at T = 37°C. Structured mature fibrils appeared when the solution was examined with a fluorescence microscope. Figure 3 shows two images of a representative aggregate with a diameter of ~5 µm and a length of ~1 mm. It can be seen that the aggregate is built by narrower strands.


Figure 3
View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Staining of mature structured fibrils with thioflavin T. DIC (A) or with fluorescence (B) image of fibrils.

Toxic effect of Aß42 peptide on Paracentrotus lividus development
To study the toxic effect of Aß42 on a living organism, we utilized a simple model system Paracentrotus lividus, a sea urchin. The sea urchin is a good model often used in different areas of modern bioscience (24) . An abundance of eggs and sperms allows experiments with a large number of synchronously developing embryos. Two cell stage embryos were incubated with different concentrations of recombinant Aß42 dissolved in water varying from 0.03 µM to 3 µM, and its effect on P. lividus development was observed at different times. We found that the number of surviving embryos decreased in a dose-dependent manner; at higher doses the embryos showed many morphological defects with respect to the controls even at the first developmental stages (Fig. 4 ). At 7th cleavage, several embryos showed defects in cell division. In the same case, indeed, we observed that the cellular membrane fails to be constructed whereas a normal division of the nuclei occurred (Fig. 4D, E ). At mesenchyme blastula, the embryos were retarded with respect to the early invagination and a cellular disorder was visible inside the blastocoele (Fig. 4F ). At 48 h of development, when the controls arrived at pluteus stage (Fig. 4C ), some of the embryos failed to complete morphogenesis, displaying a range of phenotypes, and others were completely degenerated. We obtained at best prismoid embryos (so-called occluded prism) (Fig. 4G ) or blastulae full of cells (occluded blastulae) (Fig. 4H ). Furthermore, embryos treated with different doses of recombinant Aß42 showed significant differences as shown in Fig. 5 . At lower doses (0.03 µM and 0.15 µM) the embryos responded with survival levels comparable to untreated controls (Fig. 5A ), with no particularly evident morphological changes (Fig. 5B ). Higher doses instead displayed large reductions in survival (Fig. 5A ). At 3 µM only 30% of embryos were living, and we observed an increasing amount of occluded blastulae and occluded prisms compared with the controls (Fig. 5B ).


Figure 4
View larger version (118K):
[in this window]
[in a new window]
 
Figure 4. Morphological alterations resulting by incubation of recombinant Aß42 during Paracentrotus lividus development. Control embryos cultured at 4 h, 7th cleavage (A), 24 h, mesenchyme blastula (B), and 48 h, pluteus (C). Representative phenotypes after 4 h (D, E), 24 h (F), and 48 h (G, H) of development in presence of recombinant Aß42. G) Occluded prism, H) Occluded blastula.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Dose dependence toxicity on sea urchin development. A) Percentage of survived embryos at 48 h of development after incubation with 0.03, 0.15, 0.6, and 3 µM of recombinant Aß42 (RAß42). B) The % of the defective phenotypes obtained with respect to the survived embryos is represented.

Different toxicity of Aß42 small oligomers and aggregates on Paracentrotus lividus development
To define a structure-activity relationship for the ß-peptide, we investigated possible differences in the toxicity of small oligomers and larger aggregates. As described before, when Aß42 is dissolved at pH 7 we have mainly small oligomers, whereas at pH 3, we have larger oligomers or aggregates. Paracentrotus lividus two cell stage was incubated with these two types of Aß42 solutions (pH 7 and pH 3) at different concentrations and the embryos were allowed to develop until control had reached the pluteus stage. Moreover, to compare the toxic effect, the same experiment was carried out utilizing commercially available Aß42. Depending on the dose concentration used (0.6 µM or 3 µM) and the different solutions, we obtained a different percentage of surviving embryos with different morphologies with respect to the controls (Fig. 6 ). In general, we found that the small oligomer form (pH 7) results in more toxic effects than the aggregate form (pH 3), as shown by the percentage of surviving embryos both for recombinant and commercial Aß42 (Fig. 6A ). With respect to the surviving embryos, major morphological defects were observed for the recombinant neutral pH Aß42 (Fig. 6B ). The toxic effect was lower for the commercial Aß42, but the same difference between oligomers and aggregates was observed. The IC50 was 1 µM for the recombinant and 2 µM for the commercial Aß42 when dissolved at pH 7, whereas the IC50 was higher than 3 µM for both the recombinant and commercial Aß42 dissolved at pH 3. For now we cannot exclude the possibility that the different toxicity between recombinant and synthetic peptides could be due to the presence of the six histidines in the recombinant one.


Figure 6
View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. Effect of recombinant (RAß42) or synthetic (SAß42) Aß42 under small oligomer or aggregates form on sea urchin embryos. P. lividus two cell stage were incubated with 0.6 and 3 µM recombinant or commercial Aß42 solved at pH 3 (RAß42pH3-SAß42pH3) or pH 7 (RAß42pH7-SAß42pH7) and left to develop for 48 h. A) Embryos’ survival measured by comparison with controls. Results are given as the % of survived embryos. B) Percentage of the defective phenotypes obtained both with recombinant or synthetic Aß42 with respect to the survived embryos is represented.

Finally, we tested the aggregates’ effects on P. lividus development at different growth times. Aß42 was dissolved at pH 3 and aliquots of growing aggregates were taken after 1, 2, 3, 4, or 5 days. Sea urchins at two cell stages were incubated with each of the different aliquots described above, and after 48 h of development the number of the surviving embryos was observed. As shown in Fig. 7 , the percentage of surviving embryos increased with the growth of the aggregates.


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Percentage of survived embryos vs. the Aß42 aggregates size.

DISCUSSION

In this report we describe the high-yield expression and purification of a recombinant Aß42. We have developed a procedure to improve purification of monomer, an essential condition in order to follow the kinetics of fibril formation and to test different biological activity. Kinetic measurements by static light scattering have demonstrated a similar aggregation behavior of the recombinant Aß42 with respect to the synthetic peptide under both conditions studied, physiological and acid pH. Different species are stabilized under the two conditions—small oligomers at physiological pH and larger aggregates at low pH, as shown by dynamic light scattering measurements. The toxicity of Aß42 peptide was tested on a classic powerful model system, the sea urchin, which can pass synchronously through different embryonal stages in only 48 h. Thus, it is possible to follow morphological changes in a living organism in a short time. Moreover, under perturbed conditions, using chemical agents, Fab fragments, or microsurgery, sea urchin displays changed phenotypes, making it suitable for toxicity studies (24 25 26) . As demonstrated by a morphological assay, the Aß42 toxic response, well documented in neuronal cells (34 35 36 37) , is also reproducible in the sea urchin system. As the utilized dose increased, the number of surviving embryos decreased. We obtained a large number of malformed embryos having difficulty in cell division. Moreover, within the surviving embryos, the extent of defective morphology was proportional to the peptide concentration. Thus, embryos unable to undergo correct cell division, polarity, and development were produced, suggesting that some of their biological and/or biochemical activity was altered.

In neuronal cells it has been demonstrated that apoptosis is induced by the intracellular component of Aß42 (8 , 10) , and we cannot exclude the possibility that a similar process occurred in some cells of the embryos. Since it is not yet well established that the toxicity of Aß in AD is due to the effect of plaque on the adjacent neuronal cell bodies or if it is related to events that occur within the neuronal cytoplasm when Aß is in the form of small oligomers (2 , 9 , 38 , 39) , we investigated the possible relationship between the state of Aß42 aggregation and its toxicity. Consistent with this idea, we observed that, compared with acid solution, neutral solution significantly increased the level of toxicity on sea urchin embryos, indicating that the state of Aß42 assembly appears to influence its biological activity. The presence of small oligomers of recombinant Aß42, stabilized at pH 7.2, leads to malformation and complete interruption of the embryos development, producing the so-called occluded blastula state observed after 48 h. In contrast, at the same stage, larger aggregates of recombinant Aß42, stabilized at pH 3, allow some embryos to reach normal development or the more advanced occluded prism state. In agreement with these results, incubation with growing aggregates increased the percentage of surviving embryos. However, sea urchin embryos were incubated with Aß42 aggregates in ASW, whose ionic strength (0.48 mol/l) is 3-fold larger than that of extracellular fluid (0.154 mol/l). The ionic strength does not affect the size of the aggregates responsible for toxicity during embryo incubation; it could change only the aggregation kinetics.

At pH 7.2 we find by dynamic light scattering that there is a dominant species with an average diameter of 5 nm. Some soluble oligomeric forms of Aß42 that have relevant implications in AD are the so-called Aß-derived diffusible ligands (ADDLs) (6) . ADDLs are spherical particles with diameters between 5 and 6 nm, showing neurotoxic activity against cultured neurons and also inhibiting long-term potentiation in cultured brain slices (40) . Even if the mechanism responsible for this different toxicity in our system is not yet definable, one possibility is that since the small oligomers are more diffusible with respect to larger aggregates or fibrils, they might more easily be inserted in the extracellular space or in the lipid bilayer, or be internalized within the cells of the developing embryos, altering their vital functions. It has been proposed that in the central nervous system of AD patients a fraction of Aß peptides, generated by APP processing, never leaves the membrane (4) . In this way the electric properties of the membrane could be modified, and some functions such as dimerization of receptors and signal transmission compromised. Moreover, it has been suggested that Aß peptides might change calcium homeostasis with consequent alteration of all the regulated signals (41) . Larger aggregates or fibrils in sea urchin could mimic the extracellular plaque of AD in neurons and compromise cell-cell interactions and all the processes related to cellular membrane functioning. Finally, the studies described in this paper on the sea urchin system firmly suggest that it can be used as an in vivo model to relate Aß composition with its toxicity, which may underlie AD pathology. For its practicality, it may also be used as an indicative tool for pharmacological evaluation of novel therapeutic agents.

ACKNOWLEDGMENTS

We thank D. Bulone, D. Giacomazza, V. Martorana, J. Newman, and R. Noto for relevant discussions and collaborations. We thank Dr. M. Cervello for the generous gift of neuroblastoma LAN5 RNA. The technical support of M Lapis, G. Lapis, and A. Pensato is also acknowledged. The present work is part of a research project "Neuropatie animali: analisi molecolari e funzionali della proteina prionica in razze bovine siciliane’ (project IZS SI 005/02) of the Italian Ministero della Salute.

FOOTNOTES

1 These authors contributed equally to this work.

Received for publication February 3, 2006. Accepted for publication April 17, 2006.

REFERENCES

  1. Hardy, J. A., Higgins, G. A. (1992) Alzheimer’s disease: the amyloid cascade hypothesis. Science 256,184-185[Free Full Text]
  2. Hardy, J., Selkoe, D. J. (2002) The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science 297,353-356[Abstract/Free Full Text]
  3. Walsh, D. M., Hartley, D. M., Fezoui, Y., Condron, M. M., Lomakin, A., Benedek, G. B., Selkoe, D. J., Teplow, D. B. (1999) Amyloid beta-protein fibrillogenesis. Structure and biological activity of protofibrillar intermediates. J. Biol. Chem. 274,25945-25952[Abstract/Free Full Text]
  4. Marchesi, V. T. (2005) An alternative interpretation of the amyloid Abeta hypothesis with regard to the pathogenesis of Alzheimer’s disease. Proc. Natl. Acad. Sci. U. S. A. 102,9093-9098[Abstract/Free Full Text]
  5. Hoshi, M., Sato, M., Matsumoto, S., Noguchi, A., Vasutoke, K., Yoshida, N., Sato, K. (2003) Spherical aggregates of beta-amyloid (amylospheroid) show high neurotoxicity and activate tau protein kinase I/glycogen synthase kinase-3beta. Proc. Natl. Acad. Sci. U. S. A. 100,6370-6375[Abstract/Free Full Text]
  6. Lambert, M. P., Barlow, A. K., Chromy, B. A., Edwards, C., Freed, R., Liosatos, M., Morgan, T. E., Rozovsky, I., Trommer, B., Viola, K. L., et al (1998) Diffusible, nonfibrillar ligands derived from Abeta1–42 are potent central nervous system neurotoxins. Proc. Natl. Acad. Sci. U. S. A. 95,6448-6453[Abstract/Free Full Text]
  7. Selkoe, D. J. (1998) The cell biology of beta-amyloid precursor protein and presenilin in Alzheimer’s disease. Trends Cell Biol. 8,447-453[CrossRef][Medline]
  8. Kienlen-Campard, P., Miolet, S., Tasiaux, B., Octave, J. N. (2002) Intracellular amyloid-beta 1–42, but not extracellular soluble amyloid-beta peptides, induces neuronal apoptosis. J. Biol. Chem. 277,15666-15670[Abstract/Free Full Text]
  9. Cleary, J. P., Walsh, D. M., Hofmeister, J. J., Shankar, G. M., Kuskowski, M. A., Selkoe, D. J., Ashe, K. H. (2005) Natural oligomers of the amyloid-beta protein specifically disrupt cognitive function. Nat. Neurosci. 8,79-84[CrossRef][Medline]
  10. Gouras, G. K., Tsai, J., Naslund, J., Vincent, B., Edgar, M., Checler, F., Greenfield, J. P., Haroutunian, V., Buxbaum, J. D., Xu, H., Greengard, P., Relkin, N. R. (2000) Intraneuronal Abeta42 accumulation in human brain. Am. J. Pathol. 156,15-20[Abstract/Free Full Text]
  11. Wilquet, V., De Strooper, B. (2004) Amyloid-beta precursor protein processing in neurodegeneration. Neurobiology 14,582-588
  12. Lue, L. F., Kuo, Y. M., Roher, A. E., Brachova, L., Shen, Y., Sue, L., Beach, T., Kurth, J. H., Rydel, R. E., Rogers, J. (1999) Soluble amyloid beta peptide concentration as a predictor of synaptic change in Alzheimer’s disease. Am. J. Pathol. 155,853-862[Abstract/Free Full Text]
  13. Fezoui, Y., Teplow, D. B. (2002) Kinetic studies of amyloid beta-protein fibril assembly. Differential effects of alpha-helix stabilization. J. Biol. Chem. 277,36948-36954[Abstract/Free Full Text]
  14. Fezoui, Y., Hartley, D. M., Harper, J. D., Khurana, R., Walsh, D. M., Condron, M. M., Selkoe, D. J., Lansbury, P. T., Jr, Fink, A. L., Teplow, D. B. (2000) An improved method of preparing the amyloid ß-protein for fibrillogenesis and neurotoxicity experiments. Amyloid: Int. J. Exp. Clin. Invest. 7,166-178
  15. Burdick, D., Soreghan, B., Kwon, M., Kosmoski, J., Knauer, M., Henschen, A., Yates, J., Cotman, C., Glabe, C. (1992) Assembly and aggregation properties of synthetic Alzheimer’s A4/beta amyloid peptide analogs. J. Biol. Chem. 267,546-554[Abstract/Free Full Text]
  16. Crescenzi, O., Tomaselli, P. A., Guerrini, R., Salvatori, S., D’Ursi, A. M., Temussi, P. A., Picone, D. (2002) Solution structure of the Alzheimer amyloid beta-peptide (1–42) in an apolar microenvironment. Similarity with a virus fusion domain. Eur. J. Biochem. 269,5642-5648[Medline]
  17. Shen, C. L., Fitzgerald, M. C., Murphy, R. M. (1994) Effect of acid predissolution on fibril size and fibril flexibility of synthetic beta-amyloid peptide. Biophys. J. 67,1238-1246[Abstract/Free Full Text]
  18. Carrotta, R., Manno, M., Bulone, D., Martorana, V., San Biagio, P. L. (2005) Protofibril formation of amyloid ß-protein at low pH via a non cooperative elongation mechanism. J. Biol. Chem. 280,30000-30008
  19. Bitan, G., Teplow, D. B. (2004) Rapid photochemical cross-linking–a new tool for studies of metastable, amyloidogenic protein assemblies. Acc. Chem. Res. 37,357-364[CrossRef][Medline]
  20. Jarret, J. T., Berger, E. P., Lansbury, P. T., Jr (1993) The carboxy terminus of the beta amyloid protein is critical for the seeding of amyloid formation: implications for the pathogenesis of Alzheimer’s disease. Biochemistry 32,4693-4697[CrossRef][Medline]
  21. Kammerer, R.A., Kostrewa, D., Zurdo, J., Detken, A., Garcia-Echeverria, C., Green, J. D., Muller, S. A., Meler, B. H., Winkler, F. K., Dobson, C. M., Steinmetz, M. O. (2004) Exploring amyloid formation by a de novo design. Proc. Natl. Acad. Sci. U. S. A. 101,4435-4440[Abstract/Free Full Text]
  22. Bondos, S. E., Bicknell, A. (2003) Detection and prevention of protein aggregation before, during, and after purification. Anal. Biochem. 316,223-231[CrossRef][Medline]
  23. Matsubara, K., Mizuguchi, M., Kawano, K. (2003) Expression of a synthetic gene encoding human transthyretin in Escherichia coli. Prot. Exp. Pur. 30,55-61[CrossRef][Medline]
  24. Giudice, G. (1973) Developmental Biology of the Sea Urchin Embryo Academic Press New York.
  25. Romancino, D. P., Montana, G., Dalmazio, S., Di Carlo, M. (2001) Bep4 protein is involved in patterning along the animal-vegetal axis in the Paracentrotus lividus embryo. Dev. Biol. 234,107-119[CrossRef][Medline]
  26. Di Carlo, M., Romancino, D. P., Ortolani, G., Montana, G., Giudice, G. (1996) "BEP" RNAs and proteins are situated in the animal side of sea urchin unfertilized egg, which can be recognized by female pronuclear localization. Biochem. Biophys. Res. Commun. 229,511-517[CrossRef][Medline]
  27. Nakajima, Y., Kaneko, H., Murray, G., Burke, R. D. (2004) Divergent patterns of neural development in larval echinoids and asteroids. Evol. Dev. 6,95-104[CrossRef][Medline]
  28. Edelhock, H. (1967) Spectroscopic determination of tryptophan and tyrosine in proteins. Biochemistry 6,1948-1954[CrossRef][Medline]
  29. Berne, B. J., Pecora, R. (1976) Dynamic Light Scattering Wiley Interscience New York, NY.
  30. Stepanek, P. (1993) Brown, W. eds. Dynamic Light Scattering: The Method and Some Applications Clarendon Press Oxford.
  31. Huglin, M. B. (1972) Light scattering from Polymer Solutions Academic Press New York, NY.
  32. Huang, T. H. J., Yang, D. S., Fraser, P. E., Chakrabartty, A. (2000) Alternate aggregation pathways of the Alzheimer beta-amyloid peptide. An in vitro model of preamyloid. J. Biol. Chem. 275,36436-36440[Abstract/Free Full Text]
  33. Bitan, G., Fradinger, E. A., Spring, S. M., Teplow, D. B. (2005) Neurotoxic protein oligomers-what you see is not always what you get. Amyloid 12,88-95[Medline]
  34. Bucciantini, M., Giannoni, E., Chiti, F., Baroni, F., Formigli, L., Zurdo, J., Taddei, N., Ramponi, G., Dobson, C. M., Stefani, M. (2002) Inherent toxicity of aggregates implies a common mechanism for protein misfolding diseases. Nature 416,507-511[CrossRef][Medline]
  35. Walsh, D. M., Klvubin, I., Fadeeva, J. V., Cullen, W. K., Anwyl, R., Wolfe, M. S., Rowan, M. J., Selkoe, D. J. (2002) Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature 416,535-539[CrossRef][Medline]
  36. Kayed, R., Head, E., Thompson, J. L., McIntire, T. M., Milton, S. C., Cotman, C. W., Glabe, C. G. (2003) Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science 300,486-489[Abstract/Free Full Text]
  37. Demuro, A., Mina, E., Kayed, R., Milton, S. C., Parker, I., Glabe, C. G. (2005) Calcium dysregulation and membrane disruption as a ubiquitous neurotoxic mechanism of soluble amyloid oligomers. J. Biol. Chem. 280,17294-17300[Abstract/Free Full Text]
  38. Carter, J., Lippa, C. F. (2001) Beta-amyloid, neuronal death and Alzheimer’s disease. Curr. Mol. Med. 1,733-737[CrossRef][Medline]
  39. Podlisny, M. B., Ostaszewski, B. L., Squazzo, S. L., Koo, E. H., Rydell, R. E., Teplow, D. B., Selkoe, D. J. (1995) Aggregation of secreted amyloid beta-protein into sodium dodecyl sulfate-stable oligomers in cell culture. J. Biol. Chem. 270,9564-9570[Abstract/Free Full Text]
  40. Wang, H. W., Pasternak, J. F., Kuo, H., Ristic, H., Lambert, M. P., Chromy, B., Viola, K. L., Klein, W. L., Stine, W. B., Krafft, G. A., Trommer, B. L. (2002) Soluble oligomers of beta amyloid (1–42) inhibit long-term potentiation but not long-term depression in rat dentate gyrus. Brain Res. 924,133-140[CrossRef][Medline]
  41. La Ferla, F. M. (2002) Calcium dyshomeostasis and intracellular signalling in Alzheimer’s disease. Nat. Rev. Neurosci. 3,862-872[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-5716fjev1
20/11/1916    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carrotta, R.
Right arrow Articles by San Biagio, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrotta, R.
Right arrow Articles by San Biagio, P. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS