|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute of Pharmacology, Department of Biological Sciences & Biotechnology, State Key Laboratory of Biomembrane and Membrane Biotechnology, Institutes of Biomedicine, School of Medicine, Tsinghua University, Beijing, China
2Correspondence: GIBH, Chinese Academy of Sciences Guangzhou 510663, China. E-mail: pei-duanqing{at}gibh.ac.cn
ABSTRACT
Embryonic stem (ES) cells possess the ability to renew themselves while maintaining the capacity to differentiate into virtually all cell types of the body. Current evidence suggests that ES cells maintain their pluripotent state by expressing a battery of transcription factors including Oct4 and Nanog. However, little is known about how ES cells maintain the expression of these pluripotent factors in ES cells. Here we present evidence that Oct4, Nanog, and FoxD3 form a negative feedback loop to maintain their expression in pluripotent ES cells. First, Oct4 maintains Nanog activity by directly activating its promoter at sub-steady-state concentration but repressing it at or above steady-state levels. On the other hand, FoxD3 behaves as a positive activator of Nanog to counter the repressive effect of Oct4. The expression of Oct4 is activated by FoxD3 and Nanog but repressed by Oct4 itself, thus, exerting an important negative feedback loop to limit its own activity. Indeed, overexpression of either FoxD3 or Nanog in ES cells failed to increase the concentration of Oct4 beyond the steady-state concentration, whereas knocking down either FoxD3 or Nanog reduces the expression of Oct4 in ES cells. Finally, overexpression of Oct4 or Nanog failed to compensate the loss of Nanog or Oct4, respectively, suggesting that both are required for ES self-renewal and pluripotency. Our results suggest the FoxD3-Nanog-Oct4 loop anchors an interdependent network of transcription factors that regulate stem cell pluripotency.Pan, G., Li, J., Zhou, Y., Zheng, H., Pei, D. A negative feedback loop of transcription factors that controls stem cell pluripotency and self-renewal.
Key Words: embryonic stem cells
THE SUCCESSFUL DERIVATION and establishment of human embryonic stem (ES) cell lines have generated strong interest in harnessing the therapeutic potential of these pluripotent cells to treat human diseases (1)
. Derived from the inner cell masses of blastocysts, these pluripotent ES cells retain two key characteristics found in embryonic progenitor cells: self-renewal and pluripotency, i.e., the ability of a ES cell to generate exact copies of itself and the capacity of ES cells to differentiate into all cell types in the body (2
3
4
5)
. At the present, there are considerable challenges in maintaining these ES cells in a pluripotent state or triggering ES cells to differentiate into a particular cell type (2
, 6)
. In fact, the precise mechanism that regulates stem cell self-renewal and pluripotency remains largely unknown (6)
. Thus, investigation into the molecular and cellular mechanisms of stem cell self-renewal and pluripotency should help meet these challenges and provide the necessary tools to harness the regenerative potential of embryonic stem cells for therapeutical purposes (2
3
4
5)
.
The homeodomain transcription factors Oct4 and Nanog have been proposed as master regulators of stem cell self-renewal and pluripotency (2
, 7
8
9
10)
. Oct4-deficient embryos fail to develop pluripotent inner cell mass (ICM) cells, which in fact differentiate along the extraembryonic trophoblast lineage (7)
. Unlike those transcription factors that act in a binary on-off mode, Oct4 appears to regulate cell fates in a quantitative fashion (11)
. Oct4 must be maintained at a critical concentration to sustain ES cell self-renewal (11)
. For example, over-expression of Oct4 causes differentiation into endoderm lineage, while its suppression triggers ES cells to become trophectoderm (11)
. In contrast, over-expression of Nanog, a self-renewal transcription factor isolated by expression cloning, did not induce ES cell differentiation but actually augmented the self-renewal capacity of ES cells in the absence of LIF (9
,10)
. Ablation of Nanog in ICMs or ES cells, on the other hand, led to the loss of self-renewal and the differentiation of endoderm-like cells (10)
. Recently, it has been reported that these two master regulators, along with the HMG-containing transcription factor Sox2, co-occupy a substantial portion of their target genes in human ES cells and thus may collaborate to regulate downstream genes important for stem cell self-renewal and differentiation (12)
. However, it is not clear how ES cells maintain the critical activity of these two and other potential master regulators at the transcription concentration.
Analysis of individual promoters of Oct4 and Nanog revealed a complex set of cis-acting elements and transcription factors that may control their levels of expression. For example, Oct4 promoter contains conserved distal and proximal enhancers that can either repress or activate its expression depending on the binding factors occupying these sites (for review, see ref 2
). On the other hand, the Nanog promoter has been suggested as a direct target of the Oct4/Sox2 complex through ChiP analysis, in vitro binding experiments, and RNAi-mediated knockdowns (12
13
14)
. However, the functional outcome of these potential regulatory potentials remains undefined. Furthermore, the dynamic relationship between Oct4 and Nanog has not been explored enough to explain their purported collaboration to regulate stem cell self-renewal and pluripotency.
Nanog was originally proposed as a transcription repressor that inhibits the expression of genes important for cell differentiation (9
, 10)
. Our recent studies revealed that it actually contains two unusually strong transactivators at the C-terminus, suggesting that it primarily acts to activate those genes directly involved in maintaining stem cell pluripotency (15
, 16)
. On the other hand, the Oct4 protein appears to have a dual role in mediating both activation and repression of target genes, mostly through interactions with other protein factors such as Sox2 and FoxD3 (2
, 17
, 18)
. The winged helix protein FoxD3, isolated as a transcription repressor with restrictive expression in embryonic stem cells (19)
, is also required for the maintenance of embryonic cells in early mouse embryos (20)
, suggesting that it may play a role in regulating stem cell self-renewal and pluripotency alongside Oct4 and Nanog. Despite the fact that these transcription factors are all required for the identity of early embryonic progenitor cells, little is known about how Oct4, Nanog, and FoxD3 can regulate the activity of each other and coordinate the expression of genes required for stem cell self-renewal and pluripotency.
Here we present the first such attempt to construct a regulatory loop anchored by Oct4, Nanog, and FoxD3. We found that Oct4 regulates Nanog activity in a dose- dependent fashion. Oct4 activates Nanog promoter when expressed below steady-state yet represses it at or above steady-state concentration in ES cells, thus, offering a mechanism to explain the observed dose dependence of Oct4 to regulate stem cell pluripotency (11)
. We also identified FoxD3 as a novel activator of Nanog, apparently to counteract the repressive activity of Oct4 on Nanog promoter at the steady-state. On the other hand, Nanog and FoxD3 were found to activate Oct4 promoter. Interestingly, Oct4 appears to serve as its own repressor, thus, exerting a negative feedback pressure in the FoxD3-Nanog-Oct4 regulatory loop. Given the established roles of both Nanog and Oct4 in maintaining stem cell pluripotency, we propose that this negative feedback loop anchors a large regulatory network of transcription factors that control stem cell pluripotency.
MATERIALS AND METHODS
Cell lines and plasmids
NIH3T3, P19, and F9 cells were cultured in Dulbeccos modified Eagles medium (DMEM; Invitrogen) supplemented with 10% FBS (Hyclone) and antibiotics (penicillin and streptomycin, 100 µg/ml) as described previously (16
, 21)
. Mouse embryonic stem cells or ESCs were maintained on MEFs in ESC medium, which contains DMEM supplemented with 20% FBS, nonessential amino-acids (100 mM), and 0.55 mM 2-mercaptothanol (Invitrogen). The expression plasmids pCR3.1-NanogF and pCR3.1-Oct4 were prepared as described previously (16
, 21)
. The FoxD3 expression plasmid was prepared by inserting its coding sequence obtained by reverse transcription (RT)-polymerase chain reaction (PCR) to the EcoRV site in frame to a FLAG coding sequence as described previously (16
, 21)
. Nanog and Oct4 promoter fragments were amplified by PCR from the mouse liver genome DNA and inserted to the Sma lI site of a promoter less luciferase reporter vector pGL-basic (Promega). The primers were as follows: forward: 5'-acagacaggactgctgggctgcagg-3', reverse: 5'-tggaaagacggctcacctaggg-3' for Oct4 promoter, for a product of 2170 bp; and forward: 5'-tggaaataggaagatcaggagt-3', reverse: 5'-acagtggtagcaacggtggtagtggca-3' for Nanog promoter with a product of 1120 bp. Nanog siRNA and Oct4 siRNA constructs were prepared by inserting annealed oligonucleiotides, which encode the double strands RNA toward the Oct4 and Nanog mRNA to pBSU6 vector, respectively, as described previously (22)
. The target sequences are gggtggattctcgaacctggc for Oct4 and gggaacgcctcatcaatgcct for Nanog. A complete GFP expression cassette including cytomeglovirus promoter, GFP coding sequence, and poly(A) was obtained by PCR from a GFP expression vector-pCR3.1 (21)
and inserted to the siRNA vectors or to the parental pBSU6 vector (U6-GFP). TK-3(E2)-luci, which contain three copies of ES cell-specific like elements from Nanog promoter, were made by the method as described previously (21)
.
Transfection, RT-PCR, reporter assay, and stable line selection
For RT-PCR analysis of lineage markers, ES-R1 cells cultured on 6 cm dishes were transfected with siRNA-GFP expression vector (8 µg), Oct4, or Nanog or FoxD3 constructs (8 µg each) plus U6-GFP (2 µg). GFP-positive cells were sorted 4 days after transfection by FACS and lysed by Trizon (Invitogen), and the lineage markers were detected by RT-PCR. The endogenous transcripts of Nanog and FoxD3 in NIH3T3, P19, F9, ES-R1 cells, and EBs were determined by RT-PCR using GAPDH as a total RNA control. For reporter assay, cells seeded in 24-well plate were transiently transfected with Nanog promoter or Oct4 promoter reporters (0.1 µg each) and effector plasmids with increasing doses (0.10.4 µg) using Lipofectamine2000 (Invitrogen) according to the manufacturers instruction. pCMV-Renilla plasmids (0.005 µg per transfection, Promega) were cotransfected in each well as internal references, and the DNA concentrations for all transfections were normalized to equal amounts by adding pCR3.1 empty vector. Thirty-six hours later, cells were washed by PBS and lysed in 70 µl of 1x PLB buffer (Promega). Luciferase activity was measured using the Dual-luciferaseReporter Assay System (Promega) and TD2020 Luminometer (Turner Design). Each transfection was carried out in duplicate and repeated at least twice. For the ES stable line selection, feeder free ES cells maintained in ES medium containing 103 unit/ml LIF (Chemicom) were seeded in 3.5 cm dishes and transfected with 2 µg of each expression plasmid. Twenty-four hours after transfection, the cells were divided by 1:15 and seeded to new 10 cm dishes for selection. G418 (500 µg/ml, Invitrogen) was added to the medium for the selection.
Chromatin immunoprecipitation assay
For chromatin immunoprecipitation (Chip) assays, ES-R1 cells cultured in 6 cm dishes were transfected with 8 µg of indicated expression constructs. Thirty-six hours later, cells were washed twice with PBS and crosslinked by incubation in 1% formaldehyade for 10 min. The crosslink was then stopped by adding glycine to a final concentration of 0.125 M. The cells were then washed twice with PBS and lysed in 0.5 ml lysis buffer (0.25% SDS, 200 mM NaCl, 50 mM Tris, pH 8.0, 100 µg/ml salmon sprerm DNA, and 1x proteinase inhibitor cocktail from Sigma, St. Louis, MO). Crosslinked chromatin was then sonicated to an average fragment length of 600 bp. The sonicated chromatin was cleared by centrifugation and preabsorbed with 30 µl protein A agarose. The preabsorbed chromatin solutions was diluted with two volumes chip buffer (1% Nonidet P-40, 350 mM NaCl) and divided to three portions. One was incubated with 1 µg of anti-Oct4 antibody (Ab; 21
), one with 1 µg of antiflag Ab (Sigma), and the other without any first Ab as control at 4°C overnight. The complexes were absorbed by adding 30 µl protein A resin to each tube and incubated for 1 h. The resin was then washed three times by wash buffer (1% TrionX100, 1% deoxycholate 0.2 M Tris, pH 8.1, 0.1 M EDTA, and 0.25 M NaCl) and two times by TE buffer. The complexes were eluted by 250 µl elution buffer (1% SDS, 0.1 M NaHCO3), and the crosslink was reversed by adding 20 µl of 5 M NaCl and a further incubation at 65°C for 4 h. After treatment with proteinase K for 1 h at 45°C, the DNA was analyzed by PCR using the following primers: forward: 5'-cttttgcattacaatgtccatgg-3', reverse: 5'-gtcagtgtgatggcgagggaagggat-3' for the amplification of the Chip product by anti-Oct4; and forward: 5'ttgggcatggtggtagacaagc3', reverse: 5'-gtcagtgtgatggcgagggaaggg-3' for the Chip product by anti-Flag. Three separate PCR reactions were performed, analyzed, and presented in Fig. 1
E and Fig. 2
F to demonstrate consistency.
|
|
RESULTS
Oct4 induced mouse ES cells differentiation by suppressing Nanog
Oct4 has been shown to determine the fate of embryonic progenitor cells in vivo and stem cells in vitro (8
, 11
, 18)
. Specifically, down-regulation of Oct4 triggers the mouse ES cells to differentiate into trophectoderm, while over-expression of Oct4 causes the differentiation of mouse ES cells into endoderm tissues (11)
. However, the precise mechanism through which Oct4 mediates such diverse effects remains unknown. To this end, we compared the phenotypes of ES cells that either over-express Oct4 or underexpress Nanog. As shown in Fig. 1A
, ES cells over-expressing Oct4 are morphologically identical to those underexpressing Nanog, suggesting that both factors may have opposing functions inside ES cells. Indeed, analysis of pluripotent and differentiation markers revealed that these two cell populations expressed identical markers of endoderm origin (Fig. 1B
), suggesting that ES cells over-expressing Oct4 phenocopy those with Nanog knockdown. Interestingly, we also noticed that the expression of Nanog was suppressed in ES cells with elevated Oct4 (Fig. 1B
, top panel), arguing that over-expressed Oct4 mediates its effect via repressing Nanog directly.
To test this possibility, we cloned the promoter region of Nanog and investigated its regulation by Oct4 in pluripotent cells. A 926 bp fragment upstream the transcription start site was cloned into a reporter vector, pGL-basic, as shown in Fig. 1C
. As shown in Fig 1C
, Nanog promoter functioned as expected with high activities in F9 and ES cells and low and no activities in P19 and NIH3T3, respectively, paralleling the endogenous levels of Nanog in these cells. To see if Oct4 can suppress Nanog promoter directly, we cotransfected Oct4 with this Nanog reporter into F9 cells. As a control, we also included a reporter that carries six copies of Oct4-binding sites. As shown in Fig. 1D
, Oct4 suppressed the activity of Nanog promoter in a dose-dependent fashion, while it activated the control reporter bearing Oct4 binding sites. As these assays were performed transiently within 48 h before the expected differentiation triggered by Oct4 over-expression, these data suggested that over-expressed Oct4 act as a repressor of Nanog, consistent with our prediction from Fig. 1A and B
.
There is one Oct4 binding site at 181 position within the Nanog promoter (12
13
14)
, and we subsequently confirmed its occupation by Oct4 by ChiP as shown in Fig. 1E
. Two deletion constructs were made, one deleting sequences upstream of 554 position and another deleting upstream of the 181 position but all retaining the Oct4 binding site. As expected, both constructs were repressed by Oct4 in non pluripotent NIH3T3 cells (Fig. 1F
). However, a mutation at the Oct4 binding site rendered the 926 bp promoter insensitive to coexpressed Oct4 or Oct4 siRNA, suggesting that Oct4 regulates Nanog promoter specifically (Fig. 1G
). These data strongly suggested a negative role of Oct4 in regulating Nanog. Indeed, the concentration of Nanog in ES cells over-expressing Oct4 is also reduced significantly as monitored by Western blot to detect endogenous Nanog (Fig. 1H
, upper panel) and transfected Oct4 (Fig. 1H
, middle panel). Together, these data demonstrate that elevated Oct4 induces ES cell differentiation by suppressing Nanog.
Biphasic regulation of Nanog by Oct4 in ES cells
The repressive effect of Oct4 we observed on Nanog promoter appears to be contradictory to the recent report that Oct4 is required to maintain Nanog activity in ES cells by RNAi-mediated knockdown (14)
. To reconcile this difference, we monitored Nanog promoter activity in a range of Oct4 siRNA concentrations. As shown in Fig. 1I
, an initial up-regulation of Nanog was observed at lower doses of Oct4 siRNA (lanes 3, 4 vs. 2), while higher doses suppressed Nanog activity as reported previously (14)
. These data demonstrated that Oct4 is essential in maintaining the expression of Nanog. To further confirm this observation, we compared the activities of reporter plasmids carrying the wild-type promoter or a mutated one at the Oct4 binding site in pluripotent cells. As shown in Fig 1J
, the mutant plasmid has much lower activity than the wild-type promoter (Fig. 1J
, lanes 3 vs. 2), suggesting that Oct4 does play an essential role in maintaining Nanog expression at steady-state concentration. Taken all these observations together, we can conclude that Oct4 regulates Nanog biphasically, i.e., a steady-state concentration maintains its expression, while an elevated concentration suppresses its expression.
FoxD3 as an activator of Nanog
The fact that Oct4 represses Nanog activity in ES cells raises the possibility that there must be positive activators in ES cells to sustain the expression of Nanog. Indeed, Nanog is expressed in Oct4 deficient embryos (10)
. One of the candidate transcription factors is FoxD3, a forkhead family transcription factor highly expressed in mouse ES cells and pluriopotent cells in early embryos (19
, 20)
. FoxD3 null embryos died shortly after implantation with a loss of epiblast, a phenotype similar to Nanog deficient embryos (20)
, suggesting a likely regulatory relationship between these two factors. We analyzed the expression pattern of FoxD3 in pluripotent cells and differentiated EBs. As shown in Fig. 2A
, upper panel), FoxD3 is expressed among pluripotent cells such as P19, F9, and ES cells but not in nonpluripotent NIH3T3 cells. During the differentiation of embryonic bodies, FoxD3 is expressed from day 0 to day 4 and then downregulated in days 5 and 6 (Fig. 2A
, lower panels). These data suggest that FoxD3 may play an important role in maintaining ES cell pluripotency in a similar fashion as Nanog. It is also apparent that FoxD3 and Nanog are coexpressed from day 0 to day 3 (Fig. 2A
, lower panel), indicating a likely regulatory relationship between them.
To test this possibility, we performed cotransfection of Nanog promoter reporter with FoxD3 expression vector in F9 EC cells. As shown in Fig. 2B
, FoxD3 activated Nanog promoter in a dose-dependent fashion in F9 cells (Fig. 2B
). To further confirm this finding, we performed the same experiments in ES cells and NIH3T3 cells. As expected, FoxD3 strongly up-regulated the activity of Nanog in ES cells (Fig. 2C
), but surprisingly, had no effect on the same reporter in nonpluripotent NIH3T3 cells (Fig. 2D
). These findings suggest that FoxD3 may activate Nanog in a pluripotency-specific manner.
FoxD3 was originally identified as a transcription repressor through binding an AT rich cis-element (20)
. To map the cis-elements that FoxD3 utilizes to activate Nanog, a series of deletions were made in Nanog promoter and their activities analyzed. As shown in Fig. 2E
, FoxD3 strongly activated reporters bearing 554, 676, and 733 deletions but failed to activate a construct deleting sequences upstream of 269, suggesting that there is a FoxD3 binding site between 269 and 544 in Nanog promoter. Indeed, ChiP analysis confirmed the binding of FoxD3 within this region in vivo in F9 cells (Fig. 2F
). A closer examination of the sequences in the 269 and 554 region identified an AT rich element, which is highly homologous to the identified ES specific enhancer (Fig. 2G, H
). This enhancer was shown as a FoxD3 binding site in vitro (20)
. To further investigate this AT element, we inserted three copies of this element upstream of a minimal TK promoter driving a luciferase reporter (Fig. 2H
). When coexpressed with FoxD3, we found that this element is indeed regulated by FoxD3, albeit negatively as reported previously (Fig. 2H
; ref 19
). Given our finding that FoxD3 activates Nanog expression transcriptionally, we suggest that FoxD3 may assume a dual role in regulating downstream genes, either activation or repression, depending on the context of the target promoter. In the case of Nanog, we showed here that FoxD3 is an activator and, thus, may play an important role in sustaining the expression of Nanog in ES cells.
Oct4 activity is maintained at the steady-state concentration by a negative feedback loop in ES cells
It is well established that Oct4 must be maintained at a rigid concentration for ES cells to remain pluripotent (8
, 11)
. To date, there has been no attempt to understand how ES cells achieve such a rigid control over Oct4 expression. The apparent biphasic regulation of Nanog by Oct4 observed in Fig. 1
prompted us to investigate the regulation of Oct4 by FoxD3 and Nanog. To this end, we cloned the promoter region of Oct4 and analyzed its expression in the context of Nanog, FoxD3, and Oct4 itself. First, we evaluated the activity of this promoter in the P19 and F9 cells and NIH3T3 cells (P19 and F9 are positive for Oct4 and NIH3T3 negative by RT-PCR, data not shown). As expected, the Oct4 promoter has robust activity in pluripotent P19 and F9 cells but not in NIH3T3 cells (Fig. 3
A), suggesting that this promoter region is regulated similarly as endogenous Oct4. When analyzed with Nanog and FoxD3, the Oct4 promoter was activated strongly by both factors in a dose-dependent fashion (Fig. 3B and C
). Interestingly, when cotransfected with Oct4, we found that Oct4 protein appeared to be a repressor of its own promoter (Fig. 3D
). These data suggested that Oct4 had a feedback loop to limit its own quantity. We then performed siRNA knockdown experiment to down-regulate endogenous Oct4 and confirmed the inhibitory effect of Oct4 even at the endogenous concentration (Fig. 3E
). Thus, we concluded that Oct4 behaves as a persistent repressor of its own promoter in contrast to its biphasic regulation of Nanog (see Fig. 1
).
|
The negative autoregulation of Oct4 promoter by Oct4 protein raises the possibility that Oct4 works as a negative feedback mechanism to ensure its own expression set at a steady state in ES cells. To test this possibility, we examined the concentration of Oct4 expression in ES cells over-expressing both FoxD3 and Nanog. As shown in Fig. 3F
, neither FoxD3 nor Nanog was able to increase the expression concentration of Oct4 in ES cells (lanes 3 and 4 vs. 2). On the other hand, knockdown of either FoxD3 or Nanog by siRNAs significantly reduced the expression of Oct4 as expected (Fig. 3F
, lanes 5, 6 vs. 2). Similar results were also obtained in F9 cells (data not shown). These data demonstrate a potential feedback inhibitory loop that counterbalances the activation potential of FoxD3 and Nanog on Oct4. The suppression of Oct4 by Oct4 itself is sufficient to achieve the critical concentration of Oct4 at equilibrium, a hallmark function of Oct4 in regulating stem cell pluripotency. Taken together, our results demonstrate a regulatory circuitry among FoxD3, Nanog, and Oct4, which ensures the proper expression of Oct4 in ES cells.
Neither Oct4 nor Nanog is dispensable in sustaining the self-renewal of mouse ES cells
The interdependence between Nanog and Oct4 to maintain their transcription activity suggest that both master regulators may cooperate to sustain stem cell pluripotency. Indeed, either gene is required for early embryo development and stem cell pluripotency (7
, 9
, 10)
. Unlike Oct4, overexpression of Nanog has been demonstrated to positively promote stem cell self-renewal by bypassing the requirement of LIF/Stat pathway (9
, 10)
, raising the possibility that over expression of Nanog may be able to compensate the activity of Oct4. Alternatively, Oct4 and Nanog may function in parallel or tandem as master regulators of stem cell pluripotency. To test these possibilities, we attempted to rescue the loss of Oct4 activity by overexpressing Nanog and vice versa. We cotransfected the RNAi vectors for Oct4 or Nanog either alone or with Nanog or Oct4 expression vectors, respectively, and then analyzed the self-renewal activity of these transfected cells. As expected, stem cells expressing siRNAs for Oct4 or Nanog failed to undergo self-renewal (Fig. 4
A,b, c vs. a). Interestingly, the overexpressed Nanog failed to compensate the loss of Oct4 in sustaining self-renewal (Fig. 4A
, d vs. a). Conversely, overexpression of Oct4 also failed to rescue the loss of Nanog (Fig. 4A
, e vs. a). These data demonstrate that two master regulators, Oct4 and Nanog, need to function in parallel in maintaining ES cell self-renewal and that neither is dispensable and nor capable of compensating the role of the another.
|
DISCUSSION
We report here that Oct4, Nanog, and FoxD3 form an interactive and interdependent circuit for the regulation of stem cell pluripotency. Nanog is a direct target of Oct4, and the suppression of Nanog by Oct4 can help explain the previous observation that overexpression of Oct4 leads to endoderm-like differentiation in ES cells (11)
. Furthermore, we demonstrated that FoxD3 also participates in the regulation of stem cell self-renewal and pluripotency by activating the expression of the two known master regulators, Nanog and Oct4, in ES cells. We propose that this FoxD3-Nanog-Oct4 circuit may anchor a much larger network of transcription factors dedicated to stem cell self-renewal and pluripotency.
Self-renewal and pluripotency are two critical properties of embryonic progenitor cells in vivo and embryonic stem cells in vitro, which should be under strict control at the molecular concentration. Given their significant role in development, considerable amount of resources must have been devoted to maintain these two important properties and ensure the continuity of life. At the core of this investment, transcriptional factors such as Oct4 and Nanog have been shown to play a critical role at the individual basis in controlling stem cell self-renewal and pluripotency. Yet, the regulatory logic among these important factors remains unresolved. To this end, the interdependent relationship among Oct4, Nanog, and FoxD4 illustrated in Fig. 4B
represents the first step toward a rational understanding of stem cell self-renewal and pluripotetncy. This regulatory circuit also reveals an important negative feedback loop. Whereas a positive feedback system leads to unsustainable escalation or downward spiral of activities, a negative feedback system is destined to achieve a state of equilibrium and a sustaining fixed concentration of output. Most of the biological processes tend to adapt a negative feedback loop. In the case of ES cell self-renewal and pluripotency, a negative feedback loop presented in Fig. 4B
appears to evolve to control these important properties for animal development. Anchored by Oct4, this negative feedback loop may also serve as an integrator or converter for all intracellular and extracellular signals that destined to regulate stem cell pluripotency. This is in agreement with a previous report that only a "critical" concentration of Oct4 can maintain stem cells at pluripotent state, both under- and overexpression of Oct4 lead to cell differentiation (11)
. In contrast, Nanog does not have a self-regulatory loop (data not shown). Its overexpression has been shown to further enhance the stemness of ES cells and prevent the differentiation of ES cells induced by retinoic acid (9)
, suggesting that it may regulate other critical genes in addition to Oct4. This will also explain why they can not rescue each other because this loop is interrupted when one of them is missing from the circuit. We believe that this circuit operates in the ES cells to ensure the activity of the critical master regulators, namely Nanog and Oct4.
ACKNOWLEDGMENTS
This work was supported in part by the Tsinghua University BaiRen Scholar Program, NSFC 30270287 and 30470839, the 973 Project-2001CB5101 (P.I. Lingsong Li) from The Ministry of Science and Technology of China, and the Tsinghua Yue-Yuen Medical Fund. D. Pei is a CheungKong (Changjiang) Scholar of the Li Ke-Shing Foundation and Ministry of Education, China. We acknowledge the support of Professor Nanming Zhao at Tsinghua University. The assistance from M. Chen, Y.Q. Guo, and the rest of the Pei laboratory made this study possible.
FOOTNOTES
1 These authors contributed equally to this work. ![]()
Received for publication January 15, 2006. Accepted for publication March 20, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
C. L. Kerr and L. Cheng The Dazzle in Germ Cell Differentiation J Mol Cell Biol, February 1, 2010; 2(1): 26 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Baglioni, M. Francalanci, R. Squecco, A. Lombardi, G. Cantini, R. Angeli, S. Gelmini, D. Guasti, S. Benvenuti, F. Annunziato, et al. Characterization of human adult stem-cell populations isolated from visceral and subcutaneous adipose tissue FASEB J, October 1, 2009; 23(10): 3494 - 3505. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Chen, A. Raval, A. J. Johnson, E. Hertlein, T.-H. Liu, V. X. Jin, M. H. Sherman, S.-J. Liu, D. W. Dawson, K. E. Williams, et al. Epigenetic changes during disease progression in a murine model of human chronic lymphocytic leukemia PNAS, August 11, 2009; 106(32): 13433 - 13438. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ma, Z. Wang, Y. Guo, and D. Pei The C-terminal Pentapeptide of Nanog Tryptophan Repeat Domain Interacts with Nac1 and Regulates Stem Cell Proliferation but Not Pluripotency J. Biol. Chem., June 12, 2009; 284(24): 16071 - 16081. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Douglas, C. A. VandeVoort, P. Kumar, T.-C. Chang, and T. G. Golos Trophoblast Stem Cells: Models for Investigating Trophectoderm Differentiation and Placental Development Endocr. Rev., May 1, 2009; 30(3): 228 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Baltus, M. P. Kowalski, A. V. Tutter, and S. Kadam A Positive Regulatory Role for the mSin3A-HDAC Complex in Pluripotency through Nanog and Sox2 J. Biol. Chem., March 13, 2009; 284(11): 6998 - 7006. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pei Regulation of Pluripotency and Reprogramming by Transcription Factors J. Biol. Chem., February 6, 2009; 284(6): 3365 - 3369. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, J. Zhang, T. Wang, M. A. Esteban, and D. Pei Esrrb Activates Oct4 Transcription and Sustains Self-renewal and Pluripotency in Embryonic Stem Cells J. Biol. Chem., December 19, 2008; 283(51): 35825 - 35833. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.S. Zaret, J. Watts, J. Xu, E. Wandzioch, S.T. Smale, and T. Sekiya Pioneer Factors, Genetic Competence, and Inductive Signaling: Programming Liver and Pancreas Progenitors from the Endoderm Cold Spring Harb Symp Quant Biol, November 26, 2008; (2008) sqb.2008.73.040v2. [Abstract] [PDF] |
||||
![]() |
J. Wang, D. N. Levasseur, and S. H. Orkin Requirement of Nanog dimerization for stem cell self-renewal and pluripotency PNAS, April 29, 2008; 105(17): 6326 - 6331. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, T. Ma, X. Chi, and D. Pei Aromatic Residues in the C-terminal Domain 2 Are Required for Nanog to Mediate LIF-independent Self-renewal of Mouse Embryonic Stem Cells J. Biol. Chem., February 22, 2008; 283(8): 4480 - 4489. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Kang, D. H. Adams, A. Simen, B. B. Simen, G. Rajkowska, C. A. Stockmeier, J. C. Overholser, H. Y. Meltzer, G. J. Jurjus, L. C. Konick, et al. Gene Expression Profiling in Postmortem Prefrontal Cortex of Major Depressive Disorder J. Neurosci., November 28, 2007; 27(48): 13329 - 13340. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, S. D. Pope, A. R. Jazirehi, J. L. Attema, P. Papathanasiou, J. A. Watts, K. S. Zaret, I. L. Weissman, and S. T. Smale Pioneer factor interactions and unmethylated CpG dinucleotides mark silent tissue-specific enhancers in embryonic stem cells PNAS, July 24, 2007; 104(30): 12377 - 12382. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, G. Pan, K. Cui, Y. Liu, S. Xu, and D. Pei A Dominant-negative Form of Mouse SOX2 Induces Trophectoderm Differentiation and Progressive Polyploidy in Mouse Embryonic Stem Cells J. Biol. Chem., July 6, 2007; 282(27): 19481 - 19492. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Boer, J. Kopp, S. Mallanna, M. Desler, H. Chakravarthy, P. J. Wilder, C. Bernadt, and A. Rizzino Elevating the levels of Sox2 in embryonal carcinoma cells and embryonic stem cells inhibits the expression of Sox2:Oct-3/4 target genes Nucleic Acids Res., March 27, 2007; (2007) gkm059v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Niwa How is pluripotency determined and maintained? Development, February 15, 2007; 134(4): 635 - 646. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |