|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1



,2
* Center for Neurodgenerative Disease, School of Medicine and
Department of Environmental and Occupational Health, Rollins School of Public Health, Emory University, Atlanta, Georgia, USA; and
School of Civil and Environmental Engineering, Georgia Institute of Technology, Atlanta, Georgia, USA
2Correspondence: Center for Neurodegenerative Disease, Emory University, Whitehead Biomedical Research, Bldg., Rm. 505, 615 Michael St., Atlanta, GA 30322, USA. E-mail: gary.miller{at}emory.edu
ABSTRACT
Exposure to pesticides has been suggested to increase the risk of Parkinsons disease (PD), but the mechanisms responsible for this association are not clear. Here, we report that perinatal exposure of mice during gestation and lactation to low levels of dieldrin (0.3, 1, or 3 mg/kg every 3 days) alters dopaminergic neurochemistry in their offspring and exacerbates MPTP toxicity. At 12 wk of age, protein and mRNA levels of the dopamine transporter (DAT) and vesicular monoamine transporter 2 (VMAT2) were increased by perinatal dieldrin exposure in a dose-related manner. We then administered MPTP (2x10 mg/kg s.c) at 12 wk of age and observed a greater reduction of striatal dopamine in dieldrin-exposed offspring, which was associated with a greater DAT:VMAT2 ratio. Additionally, dieldrin exposure during development potentiated the increase in GFAP and
-synuclein levels induced by MPTP, indicating increased neurotoxicity. In all cases there were greater effects observed in the male offspring than the female, similar to that observed in human cases of PD. These data suggest that developmental exposure to dieldrin leads to persistent alterations of the developing dopaminergic system and that these alterations induce a "silent" state of dopamine dysfunction, thereby rendering dopamine neurons more vulnerable later in life.Richardson, J. R., Caudle, W. M., Wang, M., Dean, E. D., Pennell, K. D., Miller, G. W. Developmental exposure to the pesticide dieldrin alters the dopamine system and increases neurotoxicity in an animal model of Parkinsons disease.
Key Words: PD pesticides MPTP
-synuclein dopamine transporter vesicular monoamine transporter 2
PARKINSONS DISEASE (PD)is a disabling neurodegenerative disorder estimated to affect >1% of all adults over the age of 65 worldwide (1)
. Several studies have identified pesticide exposure as a risk factor for PD (2
3
4
5
6)
, and elevated levels of the organochlorine pesticide dieldrin have been found in PD brains (79; our unpublished results). Although dieldrin has been banned in the U.S. for >20 years, it is ubiquitous in the environment (10)
and has been demonstrated to be neurotoxic to the dopamine system (11)
. The continued presence of dieldrin residues may be of particular concern to children and pregnant women because dieldrin has been shown to cross the placenta, has been detected in the fetus (12)
, and is readily excreted in breast milk (13)
. In 1981, dieldrin was found in >80% of breast milk samples from 1436 U.S. women sampled (14)
, and the use of dieldrin for residential termite control has also been directly correlated to levels of dieldrin in breast milk (15)
. Dieldrin residues have also been found by the FDA in 50% of pasteurized milk samples in 19901991. This may be of particular relevance to PD, as milk consumption was associated with a 2.3-fold increase in risk of PD in men who drank 16 oz. or more of milk per day (16)
.
Although PD is considered a disease of the aged, there is evidence that the neurodegenerative process begins long before clinical diagnosis (17
18)
. It has also been proposed that early life environment may contribute to sporadic PD (19
20)
. In animal studies, exposure of pregnant rats to the bacteriotoxin LPS results in a significant reduction of dopamine neurons in the offspring (21)
, and prenatal exposure to the fungicide maneb resulted in increased susceptibility of mice to dopaminergic damage elicited by paraquat in adulthood (22)
. Therefore, prenatal exposures may result in either direct damage to or enhanced vulnerability of the dopamine system to future toxic insult.
Recently, we reported that exposure of pregnant mice to the organochlorine pesticide heptachlor up-regulates the dopamine transporter (DAT) and the vesicular monoamine transporter 2 (VMAT2) in their offspring (23)
. Given the integral role of these transporters in maintaining dopamine homeostasis and their role in determining sensitivity to dopaminergic neurotoxicants (24)
, alteration of their levels during development could result in increased vulnerability of dopamine neurons later in life. In the present investigation, we sought to determine whether perinatal exposure to dieldrin causes persistent changes to the dopaminergic system and whether these changes result in increased susceptibility to the parkinsonism-inducing neurotoxin MPTP.
MATERIALS AND METHODS
Chemicals
Dieldrin (purity
98%) was obtained from Chem Service Inc. (West Chester, PA, USA). Monoclonal anti-DAT, polyclonal anti-aromatic amino acid decarboxylase (AADC), polyclonal anti-GABA transporter (GAT-1), and polyclonal anti-VMAT2 antibodies were purchased from Chemicon (Temecula, CA, USA). Monoclonal antibodies against
-tubulin and glial fibrillary acidic protein (GFAP) were purchased from Sigma (St. Louis, MO, USA). The monoclonal antibody (mAb) against
-synuclein was purchased from BD Transduction (Lexington, KY, USA). Secondary antibodies coupled to horseradish peroxidase were purchased from ICN (anti-rat; Costa Mesa, CA, USA) and Bio-Rad (anti-rabbit and anti-mouse; Hercules, CA, USA). SuperSignal West Dura Extended duration substrate and stripping buffer were obtained from Pierce (Rockford, IL, USA). Monoamine standards for dopamine (DA), serotonin (5-hydroxytryptamine, or 5-HT), 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and (5-HIAA) were obtained from Sigma. Mobile phase (MD-TM) was obtained from ESA Inc. (Chelmsford, MA, USA).
Experimental design
Eight-wk-old female and male C57BL/6J mice purchased from Jackson Laboratory (Bar Harbor, ME, USA) were used for developmental studies. Mice were maintained on a 12:12 light/dark cycle, and food and water were available ad libitum. All procedures were conducted in accordance with the Guide for Care and Use of Laboratory Animals (National Institutes of Health) and were previously approved by the Institutional Animal Care and Use Committee at Emory University.
Female mice were administered either 0.3, 1, or 3 mg/kg dieldrin dissolved in corn oil vehicle and mixed with peanut butter every 3 days for 2 wk prior to introduction of male mice for breeding. Control mice received an equivalent amount of corn oil vehicle in peanut butter. Mice were monitored to ensure total consumption of the treatment dose, which generally occurred within 10 min. Oral exposures were chosen since the most likely route of exposure to dieldrin in the human population is through the ingestion of contaminated food. The highest dosage chosen (3 mg/kg) is 20-fold less than the acute oral LD50 in mice. Peanut butter was chosen as the method of exposure to reduce stress to the dam during gestation, since stress from repeated injections during gestation has been shown to alter GABAA subunit development (25)
. Dosing continued on the same schedule throughout gestation and lactation, and ended upon weaning of the pups on postnatal day (PND) 22. Mice were then separated by litter and by sex into separate cages until 12 wk of age.
MPTP administration and determination of MPP+ levels
At 12 wk of age, male and female offspring of control and dieldrin-treated animals were administered 2 injections of saline or 10 mg/kg MPTP subcutaneously (s.c.) 10 h apart (total dosage 20 mg/kg) and sacrificed 2 days after the second injection (26)
. MPP+ levels in the striatum were determined after a single 20 mg/kg injection of MPTP essentially as described by Giovanni and co-workers (27)
. Briefly, mice were sacrificed 90 min after injection of MPTP (20 mg/kg i.p.) and both striata were removed, weighed, frozen in liquid nitrogen, and maintained at 80°C until analysis. For analysis of MPP+ levels, striata were sonicated in 5 vol of 5% TCA and centrifuged for 10 min at 14,000 g. MPP+ levels were determined in the supernatants by HPLC with UV detection at 290 nm after separation on a reverse-phase Altima C18 column (Alltech Associates Inc., Deerfield, IL, USA); a mobile phase consisting of 89% 50 mM KH2PO4 and 11% acetonitrile. MPP+ was identified by comparison of retention time with known standards and concentrations were calculated from a standard curve of known concentrations of MPP+.
Western blot analysis
Western blots were used to quantify the amount of DAT, VMAT2, GFAP,
-synuclein, and
-tubulin present in samples of striatal tissue from treated and control mice. Analysis was performed as described by Richardson and Miller (28)
. Briefly, samples (510 µg protein) were subjected to PAGE on 10% precast NuPage gels (Invitrogen, Carlsbad, CA, USA) and transferred to a polyvinylidene difluoride membrane. Membranes were then incubated overnight in a mAb to the NH2 terminus of DAT. DAT antibody (Ab) binding was detected using a goat anti-rat horseradish peroxidase secondary Ab and enhanced chemiluminescence. The luminescence signal was captured on an Alpha Innotech Fluorochem imaging system and stored as a digital image. Densitometric analysis was performed and calibrated to coblotted dilutional standards of pooled striata from all control samples. Membranes were stripped for 15 min at room temperature with Pierce Stripping Buffer and sequentially reprobed with additional antibodies.
-Tubulin was used to ensure equal protein loading across samples.
HPLC-EC determination of catecholamines
HPLC analysis of catecholamines by electrochemical detection (HPLC-EC) was performed as described by Richardson and Miller (28)
. Briefly, dissected striata were sonicated in 0.1 M perchloric acid (PCA) containing 347 µM sodium bisulfite and 134 µM EDTA. Homogenates were centrifuged at 15,000 g for 20 min at 4°C, the supernatant removed, and filtered through a 0.22 micron filter by centrifugation at 15,000 g for 20 min. The supernatants were then analyzed for levels of DA, DOPAC, and HVA, as well as for 5-HT and 5-HIAA. Catecholamine concentrations were determined using HPLC equipped with an eight-channel coulometric electrode array detector (ESA Coularray, Chelmsford, MA, USA). Quantification was made by reference to calibration curves obtained from individual monoamine standards.
RNA isolation and cDNA synthesis
RNA was isolated from whole brain or from ventral mesencephalon for 1 day and 12-wk-old animals, respectively. RNA was isolated using the Qiagen RNEasy Lipid Tissue Mini Kit (Valencia, CA, USA) according to instructions by the manufacturer. RNA concentration was determined by standard spectrophotmetric analysis and 1 µg of total RNA was used for cDNA synthesis with the Applied Biosystems High Capacity cDNA Archive kit (Bedford, MA, USA) according to the manufacturers protocol.
Quantitative reverse transcriptase polymerase chain reaction (real-time PCR)
Primers for mouse DAT, VMAT2, NURR1, and Pitx3 were designed using the Primer Select software program (Lasergene) and synthesized by MWG Biotech, Inc. (High Point. NC, USA): DAT (forward 5'-atcaacccaccgcagacaccagt; reverse 5'-ggcatcccggcaataaccat); VMAT2 (forward 5'-atgctatcggtccctctgctggtg; reverse 5'- gacggggtacggctggacattatt); NURR1 (forward5'-cgaagccgaagagcccacagg; reverse 5'-gagccggtcaggagatcgtagaac); Pitx3 (forward 5'- cgccgctcgccgccaagacc; reverse 5'-aggacactgccccggaggacacg). Primers for AADC have been reported previously (29)
and those for the 18s ribosomal subunit were obtained from Ambion (Austin, TX, USA). Real-time PCR was performed using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Bedford, MA, USA) to determine mRNA expression in ventral mesencephalon or whole brain samples from mice. Reactions were performed in a total volume of 25 µl using SyBr Green Master Mix reagent (Applied Biosystems); 2 µl of cDNA/sample was used as template for the reaction, with 10 µM forward and reverse primers. Both target and 18s amplifications were performed in duplicate. Thermal cycling conditions included 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 95°C for 15 s and 1 min at the appropriate annealing temperature for each primer set. To normalize the amount of total mRNA present in each reaction, levels of the 18s ribosomal subunit were monitored in parallel samples. Results are expressed as relative levels of mRNA, referred to as control samples (the calibrator), chosen to represent 1 x expression of the gene. The amount of target (treated sample), normalized to an endogenous reference (18s) and relative to the calibrator (control sample), was defined by the Ct method as described by Livak and Schmittgen (30)
. All primer sets yielded a single PCR product of expected size by agarose gel electrophoresis. Specificity was routinely monitored by checking product melting curves (dissociation curves) in each reaction well.
Determination of brain dieldrin levels by gas chromatography
Frozen tissue samples were homogenized in a 1:1 mixture of hexane and acetone to which hexachlorobenzene was added as an internal standard. The vials were sonicated and vortexed and the supernatant separated by centrifugation for 10 min at 1000 g and 22°C. This extraction sequence was repeated five times. The final extract solution was then reduced by heating the contents of each tube to 60°C, and the dry residue was weighed and dissolved in 1 µl of 1:1 hexane:acetone and transferred to a solid-phase extraction column (Alltech Assoc., Model no. 227950, Deerfield, IL, USA), containing 5 g of FlorisolTM and 1 g of anhydrous sodium sulfate that had been preconditioned with hexane. The FlorosilTM column was then eluted with 5 µl of hexane, and the process was repeated five times. The hexane extract was then reduced to
1.0 µl by heating to 60°C as described above. The 1.0 µl reduced hexane volume, plus two 0.4 µl hexane rinses, were transferred to glass autosampler vials, which were immediately sealed with crimp top caps and stored at 4°C in the dark. The sample vials, centrifuge tubes, and autosampler vials were weighed before and after each addition, extraction, and drying sequence using an analytical balance to obtain the wet and dry tissue weights, water content, lipid content, and final extract volume.
The sample extracts were analyzed for dieldrin and hexachlorobenzene using an Model 6890N gas chromatograph (Agilent Technologies, Palo Alto, CA, USA) equipped with an autosampler, micro electron capture detector (µECD), and 30 m x 0.25 mm DB-5 column (J&W Scientific, Folsom, CA, USA) with a 0.25 µm internal film thickness. At least five calibration standards were prepared in hexane over the relevant concentration range and analyzed at the beginning and end of each GC run. Chromatograph peaks were identified by comparison of retention times with independent standards and confirmed by analysis of selected samples using a Varian STAR 3400 GC equipped with a Saturn 2000 mass spectrometer (hexachlorobenzene=14.07 min, dieldrin=18.6 min). The limit of detection (LOD) for dieldrin was 0.06 ppb, and recovery of spiked hexachlorobenzene from the samples was >96% in all cases.
Statistical analysis
Litter was considered the smallest unit of analysis, with each litter representing an independent replication (n=46 litters per treatment group). Body weight gain for dams and pups was analyzed by repeated measures ANOVA. All other neurochemical data were analyzed using 1-way ANOVA. When a significant F was determined, post hoc comparisons were performed using the Student-Newman Keuls (SNK) test. Statistical significance is reported at the P
0.05 level unless otherwise noted.
RESULTS
Administration of dieldrin to female C57BL/6J mice prior to breeding and throughout lactation ending on PND 22 was utilized to simulate a likely human exposure scenario. This paradigm resulted in no overt toxicity to the dam or the offspring at any of the dosages tested, as evidenced by no change in weight gain of the dams or pups (data not shown) and no observation of tremors or overt behavioral abnormalities. In addition, there were no apparent differences in litter size or sex distribution between control and treated dams (data not shown). At 12 wk of age, striatal levels of dieldrin were 15.55 ± 4.75 and 10.25 ± 0.95 ng/g tissue (n=2) in male and female offspring of females exposed to 3 mg/kg dieldrin. When expressed based on lipid content, these values are equivalent to 36 and 22 ppb, lower levels than observed in human breast milk (31)
. Dieldrin residues were undetectable at this time point in the lower dosages and control groups.
Developmental dieldrin exposure alters levels of dopaminergic markers
To determine the effects of developmental dieldrin exposure on the dopamine system, we analyzed the levels of the dopamine transporter (DAT) and the vesicular monoamine transporter 2 (VMAT2) at 12 wk of age. At this time point, DAT protein levels were significantly increased by 30% (P<0.01), 41% (P<0.001), and 52% (P<0.001) in the male offspring of dams exposed to 0.3, 1, or 3 mg/kg of dieldrin, respectively, throughout gestation and lactation (Fig. 1
A). DAT protein levels were also increased in the female offspring (Fig. 1B
) by 36% (P<0.01), 42% (P<0.01), and 61% (P<0.001) from the same treatment groups (Fig. 1B
). DAT mRNA levels were increased in a dose-related manner in the male offspring (Fig. 1C
) by 23%, 24% (P<0.05), and 54% (P<0.05). DAT mRNA levels were increased in the female offspring as well (Fig. 1D
) by 31%, 32%, and 54%, although this did not quite reach statistical significance (P=0.06). VMAT2 levels were also increased at this time in the male offspring (Fig. 2
A) by 16%, 16%, and 27% (P<0.01) and in female offspring (Fig. 2B
) by 29% (P<0.05), 38% (P<0.05), and 59% (P<0.01). Concordant with the increase in VMAT2 protein level, VMAT2 mRNA levels were increased by 34%, 72% (P<0.05), and 88% (P<0.05) in male offspring (Fig. 2C
) and by 27%, 29%, and 47% (P<0.01) in female offspring (Fig. 2D
).
|
|
The effects of developmental dieldrin exposure appear to preferentially target the dopaminergic system, as we observed no change in striatal GABA transporter levels or in cortical norepinephrine and serotonin transporter levels (data not shown). In addition, analysis of 1-day-old whole brain mRNA levels, a time before a significant amount of exposure through breast milk is observed, revealed no significant changes in mRNA levels of DAT or VMAT2 (data not shown). This finding suggests that the effects of dieldrin on the dopaminergic system are most likely the result of lactational exposure.
Developmental dieldrin exposure increases NURR1 and Pitx3 expression
Because we observed alterations in DAT and VMAT2 protein and mRNA levels, we assessed the mRNA levels of NURR1 and Pitx3, two nuclear transcription factors known to regulate DAT and VMAT2 expression during development. At 12 wk of age, NURR1 mRNA levels were increased in the ventral mesenchephalon of the male offspring by 34% (P<0.05), 72% (P<0.05), and 121% (P<0.05; Fig. 3
A), and by 28% (P<0.05), 50% (P<0.01), and 41% (P<0.01) in female offspring (Fig. 3B
). Similar to that observed with DAT and VMAT2, NURR1 levels were not increased at 1 day of age (data not shown). In contrast to the dose-related increases in NURR1, Pitx3 mRNA levels were only increased in the highest dosage group by 202% (P<0.001) in the male offspring (Fig. 3C
) and by 106% (P<0.01) in the female offspring (Fig. 3D
). To further explore the role of NURR1 in the effects on DAT and VMAT2, we determined protein and mRNA levels of aromatic amino acid decarboxylase (AADC), a component of the dopaminergic system not regulated by NURR1. We found that developmental dieldrin exposure had no significant effect on AADC protein or mRNA levels (data not shown). These results suggest that the increase in DAT and VMAT2 protein and mRNA levels may be mediated through enhanced expression of NURR1 and that Pitx3 may play a role only at the highest dosage tested.
|
Developmental dieldrin exposure increases striatal DOPAC levels and increases turnover
Because we have observed that heptachlor, an organochlorine pesticide from the same class as dieldrin, is an inhibitor of VMAT2 (32)
, and VMAT2 inhibition has been demonstrated to increase DOPAC levels (33)
, we assessed DOPAC levels in the striatum by HPLC. Striatal DOPAC levels were significantly increased (Table 1
) in male offspring by 34% (P<0.05), 46% (P<0.01), and 57% (P<0.001). There was no significant increase of striatal DOPAC levels in the female offspring. The ratio of DOPAC:dopamine was also significantly increased only in the male offspring by 52% (P<0.001), 52% (P<0.001), and 75% (P<0.001). No significant effects were observed on homovanillic acid (HVA) levels or the HVA:dopamine ratio (data not shown). There were also no effects on total dopamine levels (Table 2
). These results suggest that developmental dieldrin exposure may cause persistent dysfunction of VMAT2 resulting in elevation of DOPAC and DOPAC:dopamine ratio.
|
|
Alterations of DAT and VMAT2 by dieldrin exacerbates MPTP toxicity in male but not female offspring
Since DAT and VMAT2 play a crucial role in the toxicity of MPTP, we sought to determine whether the alterations of DAT and VMAT2 by developmental dieldrin exposure would exacerbate the neurotoxicity of a moderate dose of MPTP. Administration of MPTP (2x10 mg/kg s.c.) to the offspring of control mice resulted in a decrease of 62% (P<0.001) of striatal dopamine in the males and a decrease of 67% (P<0.001) in the females assessed 48 h after administration (Table 2)
. In the offspring of dieldrin-treated animals, MPTP caused significantly greater reductions of dopamine in the male offspring (74%, 76%, and 74%; all P<0.05) than in the male offspring of controls. However, the female offspring of dieldrin-treated animals did not exhibit significantly greater dopamine loss than the offspring of control animals (67% for control offspring and 69%, 71%, and 64% in dieldrin-treated offspring). To determine whether the greater loss of dopamine in dieldrin-treated offspring was the result of altered MPP+ metabolism, we assessed MPP+ levels in the striatum of animals administered MPTP and found no significant differences in either the male or female offspring of control and dieldrin-treated animals (Table 3
). While the greater effect of MPTP in the male offspring of dieldrin-treated animals cannot be explained by alterations in MPP+ metabolism, we found that the DAT to VMAT2 ratio was significantly increased in the male offspring by 18%, 22%, and 22% (all P<0.01), while there was no significant alteration in this ratio in the female offspring (Fig. 4
A, B). These data suggest that the DAT to VMAT2 ratio is the principal determinant of the enhanced toxicity of MPTP in the male offspring of dieldrin-treated animals.
|
|
Administration of MPTP decreases striatal dopamine through a dual mechanism of neuronal damage and TH inhibition. In the past, we have used Western blots of DAT, VMAT2, and TH to assess neuronal damage after MPTP exposure (26)
. However, these markers were significantly altered in dieldrin-treated offspring before the administration of MPTP (Figs. 1
, 2
; data not shown). To circumvent these problems, we assessed the levels of GFAP, an indicator of astroglial proliferation, and
-synuclein, a protein involved in PD, both of which have been shown to be up-regulated and indicative of neuronal damage after MPTP exposure (34
35)
. Basal levels of GFAP were not significantly different between control offspring and dieldrin offspring. MPTP significantly increased GFAP levels by 26% (P<0.001) in the offspring of control animals (Fig. 4C
). This effect was significantly potentiated in the offspring of dieldrin-treated animals, whose GFAP levels were increased by 54%, 60%, and 73% (all P<0.001 vs. control offspring). Similarly, basal
-synuclein levels were not significantly different between control and dieldrin offspring, but MPTP treatment increased levels by 27% (P<0.001) in the male offspring of control animals (Fig. 4D
). This effect was significantly potentiated in the offspring of dieldrin-treated animals by 47%, 45%, and 46% (all P<0.001 vs. control offspring). These results suggest that developmental dieldrin exposure results in enhanced neurotoxicity from MPTP treatment, demonstrated by both greater loss of striatal dopamine and potentiation of GFAP and
-synuclein induction.
DISCUSSION
Epidemiological studies have repeatedly indicated that pesticide exposure is a significant risk for PD. However, a mechanistic link between increased risk for PD and exposure to pesticides remains to be established. Here, we report that developmental exposure to dieldrin results in alterations of the dopaminergic system and increased susceptibility to the dopaminergic neurotoxin MPTP later in life. The effects observed on the dopaminergic system were present at all doses tested and persisted when no detectable levels of dieldrin were found in striatal tissue of the offspring. In addition, the male offspring were more affected by developmental dieldrin exposure. These results suggest that the developmental period is especially vulnerable to dopaminergic insult by pesticide exposure and that pesticides may promote or accelerate the pathogenic process in PD through persistent alteration of dopamine neuron homeostasis.
The most striking effects observed in this study are the long-term enhancement of dopamine transporter (DAT) and vesicular monoamine transporter 2 (VMAT2) levels in the striatum of the offspring of mice exposed to dieldrin throughout gestation and lactation. These effects were similar to what we have observed at an earlier time point (28 days of age) in the offspring of mice exposed to heptachlor during the same developmental periods (23)
and similar to that observed by others in rats (36)
. Here, we report novel data on the effects of dieldrin on the dopamine system by demonstrating that the increases in DAT and VMAT2 are accompanied by increased mRNA levels, suggesting that effects of dieldrin occurred at the level of transcription. These effects appear to be relatively selective for the dopaminergic system, as we observed no changes in levels of the GABA transporter in the striatum or alterations of the serotonin and norepinephrine transporters in the cortex. Because we observed no neurochemical effects at 1 day of age in our mice, the effects we observed may have been mediated primarily through lactational exposure, as has been observed with other lipophilic organochlorine compounds such as polychlorinated biphenyls (37)
. These results suggest that developmental dieldrin exposure preferentially alters dopaminergic neurochemistry in a manner that persists into adulthood even in the absence of detectable levels of the pesticide in brain tissue.
Dieldrin exerts neurotoxicity primarily through inhibition of GABAA receptor-mediated chloride flux and subsequent hyperactivity of the nervous system (38)
. Thus, the question arises as to how dieldrins effect on the GABAergic system leads to alterations of the dopaminergic system. First, GABA has been demonstrated to serve as a trophic signal in the development of monoaminergic systems (39)
, and dieldrin has been demonstrated to disrupt brain-stem monoamine neuron formation in vitro (25)
. Second, the
2 subunit of the GABAA receptor is highly expressed in dopamine neurons in the substantia nigra pars compacta and ventral tegmental area (40)
, and it has been shown in culture that this subunit is required for potentiation of current by dieldrin (41)
. Picrotoxin, another GABAA receptor antagonist that acts at the same site as dieldrin, has also been shown to increase burst firing of dopamine neurons (42)
. Thus, dieldrin appears to increase neuronal activity in dopaminergic neurons.
We hypothesize that the net increase of neuronal activity in dopamine neurons by dieldrin may be directly responsible for the alterations in dopaminergic neurochemistry we observed at the protein level. To test this, we determined mRNA levels of the nuclear transcription factor NURR1, known to regulate DAT and VMAT2 (43
, 44)
and whose transcription is enhanced by increased neuronal activity (45
, 46)
. We found dose-dependent increases in NURR1 transcription in the offspring that were highly correlated to the increases observed in DAT (r2=0.89) and VMAT2 (r2=0.82) protein levels. To test the specificity of NURR1 for DAT and VMAT2 in our system, we analyzed the protein and mRNA levels of aromatic amino acid decarboxylase (AADC), whose induction is independent of NURR1 during development (44)
. We found no significant increases in either AADC protein or mRNA, providing further evidence that persistent NURR1 induction may be responsible for the alterations observed in DAT and VMAT2. The long-term induction of NURR1 even after there are no detectable levels of dieldrin in the brain may represent an example of "fetal programming" or "imprinting" in accordance with the Barker hypothesis of the developmental basis of adult diseases (47)
. Thus, early life exposure to dieldrin may persistently alter the dopamine system through regulatory gene expression, which may increase susceptibility to future neurotoxic insult or to PD.
Studies from our laboratory have found that heptachlor, another organochlorine pesticide, alters levels of the dopamine transporter (DAT) and vesicular monoamine transporter 2 (VMAT2) in adult and developing mice and can also inhibit VMAT2 activity (23
, 32)
. Based on the crucial role of VMAT2 in maintaining low cytosolic concentrations of dopamine, inhibition of VMAT2 by dieldrin may result in enhanced oxidative stress and susceptibility to neurotoxicity by increasing free cytosolic dopamine. Indeed, we found increased DOPAC levels and dopamine turnover in the striatum of mice exposed to dieldrin during the perinatal period (Table 1)
. These data are consistent with those observed in animals exposed to reserpine (33)
, and interference with VMAT2 function may lead to increased concentrations of the neurotoxic dopamine adduct, 5-cysteinyl dopamine (48)
. This may have relevance to the pathogenic process in PD, as elevated levels of 5-cysteinyl dopamine adducts have been seen in postmortem PD brains (49)
, and 5-cysteinyl dopamine is thought to mediate increased oxidative damage in dopamine neurons (50
51)
. Indeed, we recently found levels of 5-cysteinyl dopamine to be elevated in adult mice repeatedly exposed to dieldrin (unpublished data).
In addition to disruption of proper dopamine compartmentalization, alterations in the expression and ratio of DAT to VMAT2 can greatly affect the vulnerability of the dopamine neuron to neurotoxins such as the parkinsonism-inducing neurotoxin MPTP, as well as methamphetamine (24
, 52
53
54)
. The ratio of DAT to VMAT2 predicts the susceptibility of dopamine neurons to degeneration in PD, with regions containing a higher ratio of DAT to VMAT2 (substantia nigra) suffering more degeneration than those containing a lower ratio (ventral tegmental area; 24, 55). Thus, environmental factors that alter the delicate balance of DAT to VMAT2 may increase the susceptibility of dopamine neurons to neurotoxic compounds by altering the DAT:VMAT2 ratio, which may result in increased risk of PD. Indeed, overexpression of DAT in mice leads to increased MPTP toxicity (56)
. Here, we found that MPTP produced significantly greater reductions in striatal dopamine levels only in the male offspring of dieldrin-treated mice. This was accompanied by evidence of enhanced neurotoxicity manifested by significantly greater increases GFAP and
-synuclein levels after MPTP treatment in the dieldrin-exposed mice. Although we observed alterations in both DAT and VMAT2 in the female offspring, this did not result in a significant alteration in the DAT:VMAT2 ratio, providing a mechanism to explain the lack of increased neurotoxicity of MPTP in the female offspring. Although estrogen is neuroprotective against many dopaminergic neurotoxicants (57)
, we did not observe significant differences in dopamine depletion by MPTP, suggesting that estrogen was not a likely contributor to the gender differences observed in this study. Gender differences have been consistently observed in PD in the human population, with males having a higher incidence (58)
. In animal studies, male mice exhibited greater dopaminergic damage in response to adult paraquat exposure after prenatal maneb exposure (7)
. In addition, pesticide exposure has been reported to be a risk factor for PD in men but not women (59)
.
Taken in concert, the results from this study provide potential neurochemical mechanisms responsible for the association between pesticide exposure and increased risk of PD. Our data suggest there are long-term alterations in the dopamine system after developmental pesticide exposure that lead to enhanced vulnerability of the dopamine system. Furthermore, these effects follow a gender pattern of increased male susceptibility consistent with that observed in PD. Finally, our results suggest that potential epigenetic effects on genes that regulate the proper formation and maintenance of function of the dopamine system may induce a "silent" state of dopamine dysfunction, thereby rendering dopamine neurons more vulnerable later in life.
ACKNOWLEDGMENTS
This work was supported by the National Institutes of Health (NIH) grant R21 ES012315 (G.W.M.) and as part of the Collaborative Centers for Parkinsons Disease Environmental Research under grant U54 ES012068 (G.W.M.). Additional support was provided by NIH F32ES013457 (J.R.R.), R21ES013828 (J.R.R.), and T32 ES012870 (E.D.D.). Opinions, interpretations, conclusions, and recommendations are those of the authors and are not necessarily endorsed by NIH. The authors wish to thank Dr. Terrilyn Richardson for assistance with primer sequence design.
FOOTNOTES
1 Present address: Department of Environmental and Occupational Medicine, University of Medicine and Dentistry-New Jersey/Robert Wood Johnson Medical School and Environmental and Occupational Health Sciences Institute, Piscataway, NJ 08854, USA. E-mail: jricha3{at}eohsi.rutgers.edu ![]()
Received for publication February 3, 2006. Accepted for publication March 20, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
K. P. Stillerman, D. R. Mattison, L. C. Giudice, and T. J. Woodruff Environmental Exposures and Adverse Pregnancy Outcomes: A Review of the Science Reproductive Sciences, September 1, 2008; 15(7): 631 - 650. [Abstract] [PDF] |
||||
![]() |
J. R. Richardson, W. M. Caudle, T. S. Guillot, J. L. Watson, E. Nakamaru-Ogiso, B. B. Seo, T. B. Sherer, J. T. Greenamyre, T. Yagi, A. Matsuno-Yagi, et al. Obligatory Role for Complex I Inhibition in the Dopaminergic Neurotoxicity of 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) Toxicol. Sci., January 1, 2007; 95(1): 196 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N.P. Kelada, H. Checkoway, S. L.R. Kardia, C. S. Carlson, P. Costa-Mallen, D. L. Eaton, J. Firestone, K. M. Powers, P. D. Swanson, G. M. Franklin, et al. 5' and 3' region variability in the dopamine transporter gene (SLC6A3), pesticide exposure and Parkinson's disease risk: a hypothesis-generating study Hum. Mol. Genet., October 15, 2006; 15(20): 3055 - 3062. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |