|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UMR 7561 CNRS-Université Henri Poincaré Nancy 1, Faculté de Médecine, Vand
uvre-lès-Nancy, France
ABSTRACT
The importance of heparan- and chondroitin-sulfate proteoglycans in physiological and pathological processes led to the investigation of the regulation of ß1,3-glucuronosyltransferase I (GlcAT-I), responsible for the completion of glycosaminoglycan-protein linkage tetrasaccharide, a key step prior to polymerization of chondroitin- and heparan-sulfate chains. We have cloned and functionally characterized GlcAT-I 5'-flanking regulatory region. Mutation analysis and electrophoretic mobility shift assays demonstrated the importance of Sp1 motif located at 65/56 position in promoter activity. Furthermore, we found that elevation of intracellular calcium concentration by the calcium ionophore ionomycin stimulated GlcAT-I gene expression as well as glycosaminoglycan chain synthesis in HeLa cells. Bisanthracycline, an anti-Sp1 compound, inhibited GlcAT-I basal promoter activity and suppressed ionomycin induction, suggesting the importance of Sp1 in calcium induction of GlcAT-I gene expression. Nuclear protein extracts from ionomycin-induced cells exhibited an increased DNA binding of Sp1 factor to the consensus sequence at position 65/56. Signaling pathway analysis and MEK inhibition studies revealed the important role of p42/p44 MAPK in the stimulation of GlcAT-I promoter activity by ionomycin. The present study identifies, for the first time, GlcAT-I as a target of calcium-dependent signaling pathway and evidences the critical role of Sp1 transcription factor in the activation of GlcAT-I expression.Barré, L., Venkatesan, N., Magdalou, J., Netter, P., Fournel-Gigleux, S., Ouzzine, M. Evidence of calcium-dependent pathway in the regulation of human ß1,3-glucuronosyltransferase (GlcAT-I) gene expression: a key enzyme in proteoglycan synthesis.
Key Words: glycosyltransferase glycosaminoglycan promoter activation
PROTEOGLYCANS (PGS) ARE A FAMILY of complex macromolecules present in the extracellular matrix (ECM) and on the cell surface. PGs are characterized by the presence of one or multiple glycosaminoglycan (GAG) side chains covalently linked to a core protein (1)
. These GAG chains are important regulators in a wide range of biological events, such as matrix deposition, intracellular signaling, morphogenesis, cell migration, normal and tumor cell growth (2
,3)
. The heparan-sulfate (HS) GAG chains of PGs located in the plasma membrane are increasingly implicated in the regulation of signal transduction (4
,5)
. The key role played by HS in the control of the signaling of morphogens such as Hedgehog proteins as well as growth factors during development has been established in Drosophila melanogaster, mouse, and human (for a review, see ref 6
). On the other hand, investigation of the role of the chondroitin-sulfate (CS) GAG chains of neural PGs such as phosphocan has highlighted their importance in the development of mammalian brain (for a review, see ref 7
). Furthermore, CS chains have been shown to be crucial for both cytokinesis and morphogenesis during the development of Caenorhabditis elegans (8
, 9)
. Thus, the biological activity of PGs is intimately related to their GAG chains. Indeed, defects in the assembly of GAGs have severe biological consequences in both vertebrates and invertebrates. Mutations of the glycosyltransferase genes involved in biosynthesis of GAG chains such as galactosyltransferase I (ß4GalT7) and EXT1/EXT2 are associated with the human inherited Ehlers-Danlos and multiple exostoses syndrome, respectively (10
,11)
. Defects in GAG synthesis has been observed in several diseases such as cancer (12
, 13)
, atherosclerosis (14)
, osteoarthritis, and fibrosis (15
16
17)
.
Previous studies showed that intracellular calcium concentrations modulate PG synthesis in a variety of cells (18
19
20
21)
. Accordingly, several reports have amply demonstrated that calcium channel blockers altered PG synthesis by cells such as smooth muscle and Sertoli cells (21
,22)
. Furthermore, using p-nitrophenyl-ß-D-xyloside as an exogenous primer for GAG chain initiation (i.e., when the core protein is not rate-limiting in PG synthesis), it has been shown that GAG synthesis was inhibited by calcium channel blockers, suggesting that calcium may modulate the activity of glycosyltransferases of the GAG chain synthesis pathway. Moreover, these authors reported that both CS and HS GAG chains were affected, suggesting that an early step common to the synthesis of both types of GAGs was altered (22)
.
CS and HS GAG chain biosynthesis is initiated by the formation of a tetrasaccharide primer, GlcA-ß1,3-Gal-ß1,3-Gal-ß1,4-Xyl-ß1-O-Ser, covalently attached to specific serine residues of different core proteins. This linkage tetrasaccharide serves as a primer to build up GAG chains by the alternate addition of N-acetylhexosamine and glucuronic acid (23)
. The final step of the assembly process of the linkage tetrasaccharide sequence is catalyzed by GlcAT-I (24)
. This enzyme has received much attention because it plays a central role at a branching point common to both CS and HS GAG chains, and has been considered a regulatory factor in the biosynthesis of GAGs (25
26
27)
. Accordingly, we recently showed that antisense inhibition of GlcAT-I expression produced a dramatic decrease in GAG synthesis, whereas overexpression of the enzyme enhanced GAG anabolism (27)
.
To elucidate the molecular mechanisms that regulate GlcAT-I, we cloned the human GlcAT-I promoter and assessed promoter activity using luciferase assays in transiently transfected cells. We identified the role of both Sp1, Ets, and CREB factors in basal promoter activity and demonstrated the importance of Sp1 in response to intracellular calcium concentration by EMSA, in vitro mutagenesis, and pulldown assay. We also determined the essential role of the p42/p44 mitogen-activated protein kinase pathway in calcium-induced GlcAT-I gene expression.
MATERIALS AND METHODS
Cell culture and reagents
HeLa cells were cultured in Dulbeccos modified Eagle medium (DMEM) supplemented with 10% (v/v) heat-inactivated FBS and antibiotics (GIBCO/BRL-Life Technology, Gaithersburg, MD, USA). Unless otherwise indicated, all antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Chemicals were obtained from Sigma (St. Quentin-Fallavier, France). ExGen 500 reagent was from Euromedex (Souffelweyersheim, France) and Dual-Luciferase® Reporter Assay System was from Promega (Madison, WI, USA). GenomeWalkerTM kit was from Clontech (Palo Alto, CA, USA).
Glycosaminoglycan chain synthesis
HeLa cells were cultured in DMEM medium in 6-well plates until 90% confluency, then incubated for 6 h in 1 ml of fresh DMEM (supplemented with 2% v/v FBS) containing 0.5 mM 4-methylumbelliferyl-ß-D-xylopyranoside GAG primer (Sigma) and 1 µM ionomycin or 10 µM BAPTA-AM (Sigma) in the presence of 10 µCi/ml [35S]-sulfate (Amersham, Biosciences, Orsay, France). After incubation, the amount of [35S]-sulfate-labeled GAGs was determined by the cetylpyridinium chloride precipitation method (28)
. After solubilization in soluene-350 (Perkin Elmer, Courtaboeuf, France), the amount of radioactive GAGs was measured by liquid scintillation counting.
Real-time quantitative reverse transcription-PCR
Total RNA was isolated from HeLa or HepG2 cells treated or not with 1 µM ionomycin or 10 µM BAPTA-AM for 6 h using RNAeasy Kit (Qiagen, Cologne, Germany). cDNA was synthesized from 1 µg of total RNA using oligodT primer and Power Script Reverse Transcriptase (Clontech). Quantitative polymerase chain reaction (PCR) was performed by applying the real-time SYBR Green PCR technology with the use of LightCycler detection system (Roche, Mannheim, Germany). Human GlcAT-I and ribosomal protein S29 specific primers were designed based on the GenBankTM sequence of GlcAT-I (GenBankTM accession number AB009598, 5'primer TTACCCCCACCTATGCCAGGCT; 3'primer GTCATCGTCAGCAAAGTAAACGACTC) and of RP S29 (GenBankTM accession number U14973, 5'primer AAGATGGGTCACCAGCAGCTGTACTG; 3'primer AGACACGACAAGAGCGAGAA). Amplification reaction was performed with SYBR Green Master Mix (Qiagen) in a 20 µl reaction mixture containing one-tenth volume of 10-fold diluted cDNA preparation, 1x SYBR Green mix, and 10 pmol of each primer. Thermal cycling conditions were as follows: 15 min at 95°C, 40 cycles of 10 s at 95°C, 35 s at 65°C, and 15 s at 72°C. Melting curves analysis was performed after amplification to determine the melting temperature of the specific PCR products, and the specificity of PCR amplifications was examined by agarose gel electrophoresis. The expression of human GlcAT-I mRNA was normalized to RP S29 mRNA expression for each sample.
GlcAT-I activity
HeLa cells were cultured in DMEM medium in 6-well plates until 90% confluency, then incubated for 6 h in 1 ml of fresh DMEM (supplemented with 2% v/v FBS) containing 1 µM ionomycin or 10 µM BAPTA-AM. Cells were harvested and sonicated in 0.25 M sucrose, 5 mM HEPES buffer (pH 7.4), and GlcAT-I activity was evaluated as described previously (29)
.
Cloning and sequence analysis
The human GlcAT-I promoter region 2911 to +29 was cloned using a GenomeWalkerTM kit according to the suppliers recommendations (Clontech). This method is based on amplification by PCR of a genomic sequence from adaptor-ligated genomic DNA fragments using a 5' adaptor primer AP1: 5'-GTAATACGACTCACTATAGGGC-3' and a 3' gene specific primer. The following 3' gene specific primers were successively used GSP1, 5'-CTTCCTGGTGTCGATCGCCGGCCTCCTCTA-3' and GSP2, 5'-AGTTTGAGAAACAGC TATCTGACCTTATGGC-3' (corresponding to nucleotides 65 to 94 of the first exon and nucleotides 1655 to 1685, respectively) in combination with 5' AP1 adaptor primer (see
Fig. 2
). The PCR products were cloned into the TA-based vector (Invitrogen, Carlsbad, CA, USA) and their sequences were determined (Genome Express, Grenoble, France).
|
|
Promoter/reporter gene constructs
Various 5' deletion fragments of GlcAT-I promoter were generated by PCR using sense and antisense primers containing an adaptor with a NheI and a HindIII restriction sites at 5' and 3' end, respectively. Complete and truncated forms of GlcAT-I promoter were subcloned into NheI-HindIII sites of pGL3Basic vector (Promega). The GlcAT-I 302/+29 reporter construct with mutated Sp1 or Ets sites was generated by site-directed mutagenesis using QuickChange mutagenesis kit (Stratagene, La Jolla, CA, USA). A mutant of Sp1 site was generated at positions 65 to 56 (mSp1A) using forward and reverse primers 5'-CCGCTGCAGGGGCGGGGCCTG CGGACAG-3' and 5'-CTGTCCGCAGGCCCCCGCCCCTGCAGCGG-3', respectively. A mutation of the second Sp1 site was separately generated at position 33 to 24 (mSp1B) using forward and reverse primers 5'-AGCCGGGGTTTGGTTGGGGAACCCCTCGTC-3' and 5'-GACGAGGGGTTCCCCAACC AAACCCCGGCT-3', respectively. A mutation of the third Sp1 site was separately generated at position 6 to +4 (mSp1C) using forward and reverse primers 5'-CCTGCAGACCAACCCTGCTCGGGCGC-3' and 5'-GCGCCCGAGCAG GGTTGGTCTGCAGG-3', respectively. A double mutant in both Sp1A and Sp1B binding sites (mSp1A/B) was generated using forward and reverse primers 5'-AGCCGGGGTTTGGTTGGGGAACCCCTCGTC-3' and 5'-GACGAGGGGTTCCCCAAC CAAACCCCGGCT-3', respectively, and mSp1A as template. For the Ets binding sites, a mutation was generated at position 241 to 238 (mEtsA), using forward and reverse primers 5'-TGGCACGCCTTATGTGACGTC-3' and 5'-GACGTCACATAAGGCGTGCC-3', respectively. A mutation of the second Ets binding site was separately generated at position 193 to 190 (mEtsB) using forward and reverse primers 5'-GTGGGACCTTAAATCAAGT-3' and 5'-ACTTGATTTAAGGTCCCAC-3', respectively. A mutation of the third Ets binding site was separately generated at position 153 to 150 (mEtsC) using forward and reverse primers 5'-CACAGATGACCCTAAGCGTGCCCT-3' and 5'-AGGGCACGCTTAGGGTCA TCTGTG-3', respectively. A mutant of CREB site was generated at positions 236 to 230 (mCREB) using 5'-CGCCGGATGTCTGGACACCACCCGGTGGTT-3' and 5'-AACCACC GGGTGGTGTCCAGACATCCGGCG-3' forward and reverse primers, respectively. For STAT binding site, the oligonucleotides used to generate the mutant (mSTAT) at position 217 to 211 were 5'-CACCCGGTGGAACCTGGAACCTGGCGGTG-3' and 5'-CACCGCCAGG TTCCAGGTTCCACCGGGTG-3' forward and reverse primers. The structure of human GlcAT-I gene has been reported and has been assigned to 11q12.2 (accession number AC004230) (30)
.
Expression vectors
pSGEts1 and pSGEts2 vectors expressing human Ets1 and Ets2 were kindly provided by Dr. B. Wasylyk (University of Strasbourg, France); pSGErg3 vector expressing Erg3 was a gift from Dr. M. Duterque-Coquillaud (Institut Pasteur, Lille, France). Erg1, PEA3, Elk, and Sp1 cDNA sequences were cloned by PCR using HepG2 and HeLa cDNA libraries and appropriate primers. pSGErg1, pSGPEA3, pSGElk, and pSGSp1 expressing human Erg1, PEA3, Elk, and Sp1 proteins, respectively, were constructed by the insertion of the corresponding coding sequences into pSG5 vector (Stratagene). Ets2
N331 sequences coding for Ets2 deleted from 331 N-terminal amino acid residues was generated by PCR using Ets2 cDNA as template and primer pairs 5'-CAAGCTTGCCACCATGGATAAGGATTACAT CCAAGAGAGGA-3' and 5'-AGCGGCCGCACCTCAGTCCTCCGTGTC-3'. The sense and antisense primers contained HindIII and NotI restriction sites, respectively. The amplified fragment was inserted into HindIII-NotI sites of pcDNA3.1 (Invitrogen) to generate pcDNAEts2
N331.
In vitro transcription/translation
The vectors expressing full-length and truncated transcription factor cDNAs described above were analyzed in vitro using the transcription and translation-coupled reticulocyte lysate system and [35S]-methionine, according to the instructions of the manufacturer (Promega). The translation products were analyzed by SDS-PAGE. The gel was dried and subjected to autoradiography (31)
.
Transient transfection and promoter activity assays
HeLa cells were plated onto 24-well plates and grown to 80% confluency. Cells were transfected with 500 ng of GlcAT-I promoter constructs and 25 ng of pRL-TK vector (Promega) using ExGen 500 reagent, as described (32)
. An additional 100 ng of vector expressing different factors was used when specified. The corresponding empty vectors were used as control. Twenty-four hours after transfection, Firefly and Renilla luciferase activities in cells of each well were measured with the Dual-Luciferase Assay System (Promega) using a Berthold (Bad Wildbad, Germany) luminometer. Luciferase activities were normalized to pRL-TK vector activity and were expressed relative to the basal activity of empty pGL3Basic vector. The data presented were mean values (±SD) of duplicates repeated in three independent experiments.
To study the effects of ionomycin on promoter activity, cells were transfected with promoter construct and treated with 1 µM ionomycin in DMEM containing 2% FBS 4 h after transfection. When indicated, cells were pretreated for 30 min with the calcium chelator BAPTA-AM, WP 631, PKC inhibitors Go6976, calphostin C, or MEK inhibitor PD98059 prior to addition of ionomycin. After treatment, luciferase activities were measured as described above.
Nuclear extracts and EMSA
Nuclear extracts were prepared from HeLa cells using CelLytic NuCLEAR extraction kit according to the recommendation of the supplier (Sigma). Protein concentration was measured using the Bradford method (33)
. Gel shift assays were performed as described previously (34)
. Binding reactions were performed by mixing 10 µg of nuclear proteins with 500,000 cpm of 33P-labeled DNA probe in reaction buffer containing 0.05 mg/ml of poly(dI-dC), 10 mM Tris-HCl, pH 7.5, 0.5 mM dithiothreitol, 1 mM MgCl2, 0.5 mM EDTA, 4% glycerol, 50 mM NaCl. The binding reaction was incubated on ice for 30 min. Specificity of the DNA-protein complexes was analyzed by preincubation with unlabeled wild-type (WT) or mutant oligonucleotides for 15 min. When supershift assay was performed, 2 µg of specific antibodies were added to the binding reaction after 30 min incubation for an additional 30 min. The DNA-protein complexes were resolved on 6% (w/v) nondenaturing polyacrylamide gels at 200 V for 2 h. The gels were dried and subjected to autoradiography. The DNA probes used corresponded to nucleotides 73 to 46, 5'-CCGCTGCAGGGGCGGGGCCTGCGGAC AG-3' containing the Sp1A. For CREB binding site, the DNA probes used corresponded to nucleotides 248 to 224, 5'-GCACGCCGGATGTGACGTCACCACC-3' encompassing the CREB core sequences. The mutated probes used were obtained by introducing mutations in the core sequence of the binding sites.
Pulldown assay
Nuclear proteins (50 µg) from HeLa cells treated or not with ionomycin were incubated with 100 pmol of biotinylated Sp1A probe (oligonucleotide 73 to 46) or unrelated probe (control) in reaction buffer containing 0.05 mg/ml of poly(dI-dC), 10 mM Tris-HCl, pH 7.5, 0.5 mM dithiothreitol, 1 mM MgCl2, 0.5 mM EDTA, 4% glycerol, 50 mM NaCl. After 1 h incubation at room temperature, 100 µl of 4% streptavidin-agarose beads (Sigma) was added to the mixture, then placed under rotating agitation for 3 h at 4°C. Beads were then recovered by centrifugation at 12,000 g for 5 min at 4°C and washed with 100 µl of PBS containing 0.5% Triton X-100 and 5 mM EDTA. Proteins bound to the DNA probe were recovered after boiling the beads for 5 min in 20 µl of Laemmli buffer. Protein identification was performed by Western blot using anti-Sp1 primary antibodies followed by incubation with horseradish peroxidase-conjugated secondary antibodies. The blot was then developed using LumiGLOTM according to the instructions of the manufacturer (Cell Signaling Technology, Beverly, MA, USA). Band intensity was quantified using Scion Image Software (NIH Image).
Western blot analysis
Cells were seeded in 60 mm plates and grown to 80% confluency. After treatment, cells were washed with PBS and lysed in 100 µl SDS sample buffer (62.5 mM Tris HCl, pH 6.8, 2% w/v SDS, 10% glycerol, 50 mM DTT, 0.01% w/v bromphenol blue), sonicated for 10 s, then boiled for 5 min. In the case of Sp1 Western blot, 60 µg of nuclear extracts from induced and uninduced cells were used. Proteins were separated in 10% SDS-PAGE gels, transferred to a PVDF membrane (Millipore, Eschborn, Germany), and subsequently blocked in Tris buffer saline-Tween 20 containing 5% nonfat milk. Membranes were incubated overnight with primary antibody (Ab) directed against p44/42 MAPK, phospho-p44/42 MAPK, and Sp1, followed by incubation with horseradish peroxidase-conjugated secondary antibodies. The blot was then developed using LumiGLOTM according to the instructions of the manufacturer (Cell Signaling). To strip off the anti-Sp1 antibodies, the membrane was submerged in a buffer containing 100 mM 2-mercaptoethanol, 2% SDS, and 62.5 mM Tris HCl, pH 6.7, for 10 min at 60°C. After washing in PBS containing 0.1% Tween-20, the membrane was reprobed with antiphosphothreonine antibodies to detect the phosphorylation of Sp1.
RESULTS
GlcAT-I gene expression is induced by elevation of intracellular calcium
It has been shown that intracellular calcium concentration modulates synthesis of CS and HS PGs, suggesting that calcium may regulate an early step common to the synthesis of both CS and HS GAG chains. To determine whether calcium-dependent signaling can regulate GlcAT-I gene expression and activity, HeLa cells were treated or not with the calcium ionophore ionomycin or with the intracellular calcium chelator BAPTA-AM for 6 h, and expression levels of GlcAT-I mRNA were analyzed by real-time PCR. The results indicated that treatment of the cells by ionomycin increased GlcAT-I mRNA levels by
30% (Fig. 1
) whereas treatment by BAPTA-AM resulted in a
20% decrease (Fig. 1A
). Analysis of GlcAT-I activity showed an increase of 23% after treatment with ionomycin and a decrease of 16% after treatment with BAPTA-AM (Fig. 1B
). Ionomycin treatment of HeLa cells stimulated GAG chain synthesis by 35% after 6 h treatment whereas BAPTA-AM reduced the synthesis of GAG chains by 29% (Fig. 1C
). These results indicated that calcium-dependent signals modulate both GlcAT-I gene expression and GAG chain synthesis.
Characterization of human GlcAT-I promoter
To investigate further the molecular mechanisms whereby intracellular calcium concentration regulates GlcAT-I gene expression, the sequence of human GlcAT-I promoter (2911 bp) was cloned (Fig. 2
) using the Genome Walk technique described in Materials and Methods. Identification of potential transcription factor binding sites using TRANSFAC 3.5 matrices revealed the presence of canonical Sp1, Ets, STAT, and CREB binding sites. Other potential transcription factor binding sites were also found. However, neither initiator nor TATA boxes could be identified at consensus positions (Fig. 2)
.
To ascertain the transcriptional promoter activity, a series of 5'-deletion mutants of 2911/+29 GlcAT-I promoter sequence coupled to the Firefly luciferase reporter gene was constructed and transfected into HeLa cells (Fig. 3
). The shortest constructs 70/+29 and 100/+29 showed a very low promoter activity. However, when the length of the promoter sequence was extended to 302 bp, a high promoter activity was observed (Fig. 3)
.
|
Ionomycin induces GlcAT-I promoter activity
To study the mechanism of ionomycin effect on GlcAT-I transcription, the 2911/+29 promoter construct (pGL-2911) was transiently transfected into HeLa cells and exposed to ionomycin (1 µM). The results showed that transcriptional activity of the promoter was enhanced by
3-fold (Fig. 4
A). Similarly, the 302/+29 promoter construct (pGL-302) was fully responsive to ionomycin and exhibited a similar level of induction as observed for the 2911/+29 construct (Fig. 4A
). This clearly indicated that deletion of the promoter up to 320 bp did not alter the induction by ionomycin. Therefore, the 302/+29 construct was used for further studies.
|
The effect of intracellular calcium on GlcAT-I promoter activity was further analyzed by using BAPTA-AM, a chelator of intracellular calcium. Our data showed that BAPTA-AM completely suppressed the induction of 302/+29 promoter activity by ionomycin (Fig. 4B
). In addition, BAPTA-AM reduced GlcAT-I promoter activity by 20% when used at 1 µM and by 75% at a higher concentration (10 µM) (Fig. 4B
). These data suggest that intracellular calcium regulates GlcAT-I promoter activity.
Sp1 is involved in the intracellular calcium modulation of GlcAT-I promoter activity
The 302 bp sequence of the proximal promoter contains Sp1, Ets, CREB, and STAT consensus sequences (see Figs. 2
, 3
). To investigate the implication of Sp1 in the activity of GlcAT-I promoter, we used bisanthracycline (WP631), a potent inhibitor of Sp1 transcription factor (35)
. The presence of WP631 at a concentration of 1 µM significantly inhibited (50%) the basal promoter activity and completely suppressed the stimulatory effect of ionomycin (Fig. 5
A), thus suggesting the important role of Sp1 in both basal and ionomycin-induced GlcAT-I promoter activity.
|
Sp1 is a transactivator of GlcAT-I promoter
To clarify whether Sp1 activates GlcAT-I promoter, the 302/+29 promoter construct was cotransfected with pSG-Sp1 vector expressing Sp1 transcription factor. As shown in Fig. 5B
, pSG-Sp1 enhanced by 2-fold the transcriptional activity of the promoter, suggesting that Sp1 factor transactivates GlcAT-I promoter.
The role of Sp1 was further investigated by site-directed mutagenesis. The three potential Sp1 binding sites in the proximal region of the promoter were mutated separately by introducing base changes in Sp1 consensus sequence. Our data showed that mutation of Sp1 binding site at position 33/24 (mSp1B) or 6/+4 (mSp1C) did not affect promoter activity (Fig. 5C
), whereas mutation of the Sp1 binding site at position 65/56 (mSp1A) reduced the promoter activity by 52%. Mutation of both Sp1A and Sp1B (mSp1A/B) produced a similar effect as that of single Sp1A mutation (Fig. 5C
), confirming the primary importance of the Sp1A binding site. Next we examined the importance of Sp1 binding sites in the induction of the promoter by ionomycin. Mutational analyses indicated that disruption of Sp1B or Sp1C consensus sequences did not significantly affect the induction of the promoter by ionomycin, whereas mutation of Sp1A binding site reduced the ionomycin induction by 55%, suggesting the critical role of Sp1A in ionomycin-induced GlcAT-I promoter activity. Mutation of both Sp1A and Sp1B (mSp1A/B) also abolished the effect of ionomycin (Fig. 5C
).
Sp1 transcription factor binds to Sp1A consensus sequence
The importance of Sp1A binding site was further analyzed by EMSA studies. EMSA assays were performed with oligonucleotides corresponding to the region 73 to 46 of the WT promoter encompassing the Sp1A core sequence. The results showed a gel retardation of the probe when incubated with nuclear extract, indicating that nuclear proteins bind to the probe (Fig. 5D
, lane 2). The binding was Sp1A sequence-specific as it was competed away by an excess of unlabeled WT oligonucleotide, but not by Sp1A-mutated oligonucleotide (Fig. 5D
, lanes 3 and 4). In an attempt to determine the nature of the transcription factor that binds to this region, EMSA assays were performed in the presence of antibodies to Sp1 and its closely relative homologue Sp3 proteins. As shown in Fig. 5D
, lane 5, addition of Sp1 Ab affected the retardation of the complex and produced a supershifted band, whereas addition of Sp3 Ab failed to affect the migration of the complex (Fig. 5D
, lane 6). These results demonstrated that Sp1 protein binds to the Sp1A site on the GlcAT-I promoter.
We next evaluated the influence of ionomycin treatment on the binding of Sp1 transcription factor to the Sp1A probe by the pulldown assay using nuclear extracts prepared from HeLa cells treated with ionomycin for 4 h. The results revealed an increased Sp1 binding after ionomycin treatment (Fig. 5E
), suggesting that intracellular calcium concentration was able to increase the relative amounts of Sp1 on the Sp1A binding site of GlcAT-I promoter.
Ets factors are not critical for ionomycin induction of GlcAT-I promoter activity
The 302/+29 GlcAT-I promoter fragment contains three Ets core motifs, EtsA (241/238), EtsB (193/190), and EtsC (153/150) (see Fig. 3
), all of which could potentially interact with Ets transcription factors. Therefore, we investigated the role of these Ets binding sites in GlcAT-I promoter activity and ionomycin induction by mutation analyses. As shown in Fig. 6
A, mutation of EtsA affected neither basal nor ionomycin-induced GlcAT-I promoter activity. However, disruption of EtsB or EtsC core sequence resulted in a significant decrease (30%) in basal promoter activity but did not produce any significant effect on the induction by ionomycin.
|
The role of Ets proteins on the GlcAT-I promoter activity was determined using cotransfection experiments with the promoter construct and expression vectors for Ets1, Ets2, Elk1, Erg1, Erg3, and PEA3. These expression vectors were first tested in vitro in coupled transcription/translation system for their ability to express the Ets proteins (data not shown). Among the Ets members tested, both Ets1 and Ets2 stimulated GlcAT-I promoter activity, with a more pronounced effect for Ets1 (5.6- vs. 4-fold, respectively) (Fig. 6B
). To examine whether Ets factors have any effect on ionomycin-induced GlcAT-I promoter activity, Ets2
N331, which acts as a dominant negative mutant of Ets1 and Ets2, was expressed and the promoter activity evaluated. The data obtained showed that expression of Ets2
N331 did not prevent ionomycin induction of the promoter (Fig. 6C
). Indeed, in the presence of Ets2
N331, ionomycin was still able to induce by 3-fold GlcAT-I promoter activity. However, Ets2
N331 produced a significant inhibition (51%) on basal promoter activity (Fig. 6C
), suggesting that Ets factors are important for basal promoter activity but are not involved in the activation of the promoter by ionomycin.
CREB and STAT binding sites are not essential for ionomycin-mediated effect on GlcAT-I promoter activity
Shortening the upstream sequence from 302 to 170 lacking CREB and STAT motifs showed a significant decrease in promoter activity. Therefore, the role of CREB and STAT sites in promoter activity was investigated by site-directed mutagenesis. Mutation of CREB consensus sequence reduced promoter activity by 39% (Fig. 7
A), indicating the importance of CREB binding site in basal promoter activity. To gain insight into the transcription factor that binds to the CREB site, we performed EMSA using nuclear extracts from HeLa cells and a radiolabeled probe encompassing the CREB core sequence (248 to 224). The results showed that incubation of nuclear extract with the probe produced retardation (Fig. 7B
, lane 2), which was suppressed when an excess of WT unlabeled probe was added to the incubation mixture (Fig. 7B
, lane 3), whereas addition of an excess of unlabeled probe containing a mutated CREB site did not suppress the retardation (Fig. 7B
, lane 4). Furthermore, incubation of nuclear extract with a radiolabeled probe in the presence of anti-CREB Ab produced a supershifted band, demonstrating that CREB protein binds to the corresponding site on the probe (Fig. 7B
, lane 5). Next, the role of CREB in calcium induction of GlcAT-I promoter activity was analyzed. Figure 7A
shows that disruption of CREB binding site (mCREB) had no effect on ionomycin induction of GlcAT-I promoter activity. Indeed, mCREB promoter exhibited a similar level of induction as WT promoter (Fig. 7A
). Similarly, mutation of STAT (mSTAT) did not produce any significant effect on ionomycin-induced GlcAT-I promoter activity (data not shown).
|
Ionomycin-induced activation of GlcAT-I promoter is mediated by ERK MAP kinase
We next studied the signaling pathway by which ionomycin induced GlcAT-I promoter activity. It has been shown that Sp1 phosphorylation by ERK resulted in an enhancement of its DNA binding activity (36)
. Therefore, we investigated the importance of the ERK pathway in activation of the GlcAT-I promoter by ionomycin. We first analyzed the phosphorylation of ERK by phospho-specific antibodies. We found that ionomycin induced phosphorylation of ERK, which reached a maximum at 5 min and decreased 60 min after ionomycin stimulation of HeLa cells (Fig. 8
A). To determine whether MEK1/2 activity was necessary for ionomycin activation of the promoter, we analyzed the effect of a specific MEK inhibitor PD98059 on GlcAT-I promoter activity. The data showed that pretreatment with 30 µM PD98059 inhibited ERK phosphorylation mediated by ionomycin (Fig. 8B
). In addition, this treatment decreased both basal and ionomycin-induced GlcAT-I promoter activity by 42% and 57%, respectively (Fig. 8C
). Altogether, these data suggested that intracellular calcium induction of GlcAT-I promoter activity is dependent on the MEK/ERK cascade. The MEK/ERK signaling pathway was found to mediate Sp1 phosphorylation by several stimuli. To assess whether ionomycin treatment produced a change in the phosphorylation status of Sp1 factor, Sp1 expression and phosphorylation were analyzed by Western blot using nuclear extracts from HeLa cells treated with ionomycin for 15 min and 30 min. Sp1 expression was first detected by using anti-Sp1 antibodies, then the membrane was reprobed with antiphosphothreonine antibodies (Fig. 8D
). The results showed that ionomycin treatment led to a substantial increase in the relative amount of threonine phosphorylated Sp1 factor (Fig. 8D
). Hence, Sp1 phosphorylation may account for the enhanced DNA binding of Sp1 on GlcAT-I promoter after ionomycin stimulation.
|
DISCUSSION
GlcAT-I plays a key role in biosynthesis of GAG chains of PGs by catalyzing the final step of the tetrasaccharide primer linkage region (24)
. This step was suggested to be rate-limiting (25
, 26)
, and therefore may control synthesis of HS and CS GAG chains. Northern blot analysis of mRNA from different human tissues showed that GlcAT-I was expressed as a single transcript of 1.5 kb (30)
, suggesting the existence of a unique promoter region driving the expression of GlcAT-I gene in human cells. The transcriptional initiation site was identified by RACE-PCR analysis at 29 nucleotide (nt) from the initiation codon ATG (24)
. It was also shown that GlcAT-I was highly expressed in placenta and brain compared to other tissues such as lung, heart, and skeletal muscle. By using cancer profiling array, we found that GlcAT-I was differentially expressed in healthy and tumoral tissues (M. Ouzzine, unpublished data). Altogether, these data suggest a differential regulation of GlcAT-I gene expression among the various tissues as well as between normal and pathological conditions. Here we showed for the first time that stimulation of GAG synthesis by elevation of intracellular calcium parallels the up-regulation of GlcAT-I expression and activity in HeLa cells. To investigate the molecular mechanisms that regulate GlcAT-I gene expression, the 2.9 kb 5'-flanking DNA of the human GlcAT-I gene was cloned and expressed as a functional promoter in HeLa cells. The GlcAT-I proximal promoter contains GC-rich regions, characteristic of TATA-less promoters (37)
. In such genes, Sp1 consensus sites were shown to take the function of TATA boxes for polymerase II assembly (38)
. Deletion analysis demonstrated that the 302 bp of the immediate 5' flank is sufficient for a substantial promoter activity in reporter gene assays, suggesting that cis-acting elements minimally required for the human GlcAT-I gene transcription are present in this region. Thus, mutagenesis and functional analysis revealed that Sp1A binding site (at position 65/56) was critical for basal activity of GlcAT-I promoter. Indeed, introduction of point mutations to Sp1A motif dramatically decreased promoter activity. Furthermore, EMSA demonstrated the specific recognition of the Sp1A site by nuclear proteins and showed that Sp1 binds to the core sequence at positions 65/56. However, the fact that the minimal construct 100/+29 containing both Sp1A and Sp1B consensus sites exhibited a weak promoter activity indicated that these sites per se were not sufficient to achieve a constitutive promoter activity, and suggests that Sp1 may interact with other factors to promote activity. EMSA and site-directed mutagenesis experiments demonstrated that CREB protein bound the corresponding core sequence on the GlcAT-I promoter and was critical for its basal transcription activity. Mutation analysis of CREB and Sp1 consensus sequences clearly indicated that these sites are necessary for optimal promoter activity of GlcAT-I gene, suggesting that synergistic interactions between CREB and Sp1 factors may occur.
One of the features of the GlcAT-I promoter is the existence of several Ets binding motifs in the proximal region. Ets proteins have been found to play crucial roles in controlling transcription of a variety of genes involved in important cellular processes, such as proliferation and differentiation (39
, 40)
. The findings described in this study demonstrate that Ets binding sites at positions 193/190 (EtsB) and 153/150 (EtsC) participate in achieving optimal basal promoter activity. Indeed, disruption of EtsB or EtsC core sequence produced a large decrease in promoter activity. Functional analyses of both Sp1 and Ets binding sites suggested a possible cooperation between these sites in producing the optimal basal promoter activity. Accordingly, cooperation between Sp1 and Ets is essential for expression of TATA-less genes such as the megakaryocyte-specific alpha IIb gene (41)
. Ets1/Sp1 cooperation has also been demonstrated in regulating the promoter activity of parathyroid hormone-related protein (PTHrP) (42)
and Fas ligand (43)
as well as COL1A2 genes (44)
.
It has been shown that PG synthesis was stimulated by intracellular calcium concentration in various cells (18
19
20)
. Ca2+ is a highly versatile intracellular signal that can regulate many different cellular functions (45)
. Intracellular calcium concentration can be increased by action of growth factors and ion channels. Here, we showed that elevation of intracellular calcium concentration by the calcium ionophore, ionomycin, up-regulated GlcAT-I mRNA levels and activity as well as stimulated GAG anabolism. In contrast, no up-regulation of GlcAT-I mRNA expression by ionomycin was observed in HepG2 cell (data not shown), suggesting a cell type specificity of GlcAT-I calcium regulation. We then investigated the molecular mechanisms responsible for ionomycin up-regulation of human GlcAT-I in HeLa cells. We first showed that GlcAT-I promoter transcription activity was inducible by elevation of intracellular calcium and that the 302/+29 promoter sequence was as responsive to ionomycin as the full-length sequence 2911/+29, suggesting that the 302 bp sequence contained the cis-acting elements necessary for ionomycin induction of GlcAT-I promoter. In addition to the participation of Sp1 in maintaining basal transcription rate, evidence has accumulated to indicate that Sp1 mediates regulation of genes and often acts as an enhancer/modulator for different kinds of signals (46
47
48)
. We brought evidence that Sp1 was a crucial transactivator of GlcAT-I gene, because overexpression of Sp1 stimulated GlcAT-I promoter activity. Moreover, we found that WP631, the specific Sp1 inhibitor, completely suppressed GlcAT-I induction by ionomycin. Mutation of the Sp1A binding site dramatically affected the induction of promoter activity by ionomycin, demonstrating that Sp1A site plays a critical role in the activation of GlcAT-I promoter transcription via ionomycin-induced pathway. On the other hand, mutation of Sp1B binding site did not produce any significant effect either on basal or ionomycin-induced promoter activity. However, mutation of both Sp1A and Sp1B (mSp1A/B) abolished ionomycin activation of the promoter. Therefore, it cannot be ruled out that in the context where Sp1A binding site was inactivated, Sp1B site may compensate to some extent for this loss.
It is unlikely that Ets binding sites were involved in ionomycin stimulation of GlcAT-I promoter. Indeed, disruption of neither the EtsB nor EtsC binding sites affected ionomycin activation of the promoter. Moreover, we showed that expression of
Ets2N331, a dominant negative mutant of Ets (49)
, down-regulated basal promoter activity but had no significant effect on the induction of the promoter by ionomycin. Indeed, in the presence of
Ets2N331, ionomycin stimulated the promoter activity. However, we showed that Ets1 and Ets2 transcription factors are potent transactivators of GlcAT-I promoter, suggesting that they may be the targets of other factors regulating GlcAT-I gene expression.
Increased transcription rates observed as a consequence of Sp1 action have often been reported to be the consequence of its phosphorylation interaction with Sp3 as well as its increased DNA binding activity (50
, 51)
. Accordingly, we showed that ionomycin produced an increase in Sp1-DNA binding complex on the Sp1A site of GlcAT-I promoter. Using EMSA, we also demonstrated that Sp1A binding site interacted with Sp1, but not with Sp3, transcription factor, suggesting that Sp3 may not be involved in Sp1A-mediated induction of GlcAT-I promoter by ionomycin. Moreover, the results reported here demonstrated that ionomycin induction of GlcAT-I gene expression is mediated by the MEK/ERK kinase pathway. The implication of this pathway was suggested by demonstrating that MEK inhibitor PD98059 was able to strongly decrease ionomycin-stimulated GlcAT-I promoter activity. In contrast, the pharmacological inhibitors of protein kinase C, Go6976, and calphostin C, did not significantly inhibit the induction of GlcAT-I promoter by ionomycin (data not shown), indicating that calcium-regulated targets other than protein kinase C are responsible for GlcAT-I induction. On the other hand, ERK inhibition did not completely abrogate ionomycin-induced GlcAT-I promoter activity, suggesting that ionomycin may affect other signaling pathways to regulate GlcAT-I gene expression. The MEK/ERK signaling pathway was found to mediate Sp1 phosphorylation by several stimuli, thus promoting its binding to the target sites and increasing transcriptional activation (36
, 46
, 47
, 52)
. On the basis of our results we can suggest that ionomycin stimulates GlcAT-I promoter activity primarily via the MEK/ERK pathway by targeting the Sp1A binding site, which resulted in phosphorylation and increased binding of Sp1 factor and eventually activation of transcription. Our data identify, for the first time, GlcAT-I as a target of calcium-dependent signaling pathway and evidenced the critical role for Sp1 transcription factor in the induction of GlcAT-I expression. These data also propose that modulation of GlcAT-I promoter activity is a possible mechanism involved in the regulation of GAG synthesis by calcium-dependent pathway. Sp1 has been reported to regulate the expression of uridine diphosphate UDP-glucose dehydrogenase, which is responsible for the synthesis of UDP-glucuronic acid (component of GAG chains, cosubstrate of glucuronosyltransferases) (48)
as well as of PG core proteins such as aggrecan and biglycan (53
, 54)
. Thus, Sp1 could play a role in coordinating PG synthesis through a number of Sp1-dependent genes.
ACKNOWLEDGMENTS
This work was supported by grants from PRO-A INSERM, Ligue Contre le Cancer Région Lorraine, IT2B CNRS-INSERM program, PHRC Régional, Agence Nationale de la Recherche (ANR no. NT053 42251), and Région Lorraine.
FOOTNOTES
1 UMR CNRS 7561-Université Henri Poincaré Nancy 1, Faculté de Médecine, BP 184, Vand
uvre-lès-Nancy 54505, France. E-mail: ouzzine{at}medecine.uhp-nancy.fr ![]()
Received for publication December 30, 2005. Accepted for publication March 20, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
A. Hiyama, S. Gajghate, D. Sakai, J. Mochida, I. M. Shapiro, and M. V. Risbud Activation of TonEBP by Calcium Controls {beta}1,3-Glucuronosyltransferase-I Expression, a Key Regulator of Glycosaminoglycan Synthesis in Cells of the Intervertebral Disc J. Biol. Chem., April 10, 2009; 284(15): 9824 - 9834. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Venkatesan, L. Barre, J. Magdalou, D. Mainard, P. Netter, S. Fournel-Gigleux, and M. Ouzzine Modulation of xylosyltransferase I expression provides a mechanism regulating glycosaminoglycan chain synthesis during cartilage destruction and repair FASEB J, March 1, 2009; 23(3): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |