FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grotendorst, G. R.
Right arrow Articles by Duncan, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grotendorst, G. R.
Right arrow Articles by Duncan, M. R.
(The FASEB Journal. 2005;19:729-738.)
© 2005 FASEB

Individual domains of connective tissue growth factor regulate fibroblast proliferation and myofibroblast differentiation

Gary R. Grotendorst1 and Matthew R. Duncan

Lovelace Respiratory Research Institute, Albuquerque, New Mexico, USA

1 Correspondence: Lovelace Respiratory Research Institute, 2425 Ridgecrest Drive, S.E., Albuquerque, NM 87108, USA. E-mail: ggrotend{at}lrri.org


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
All members of the Ctgf, Cyr61, and Nov (CCN) family share a high degree of sequence homology and conservation of structural motifs and domains. Here, we present data about a structure function analysis of connective tissue growth factor (CTGF), a prototypic member of the CCN family, which has been shown to be a downstream mediator of transforming growth factor-ß activities on fibroblasts. Our findings demonstrate the two domains of CTGF function to mediate two distinct biological effects. The N-terminal domain of CTGF mediates myofibroblast differentiation and collagen synthesis. The C-terminal domain of CTGF mediates fibroblast proliferation. These data provide a molecular basis for the divergence of CTGF actions on connective tissue cell types and suggest a model for functional analysis of all of the CCN family gene products.—Grotendorst, G. R., Duncan, M. R. Individual domains of connective tissue growth factor regulate fibroblast proliferation and myofibroblast differentiation.


Key Words: fibrosis • cytokine • cell proliferation


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
CONNECTIVE TISSUE growth factor (CTGF; ref 1 ) along with Cyr61 (2) and Nov (3) are the original members of a family of proteins, the Ctgf, Cyr61, and Nov (CCN) family (4) . CTGF has been shown to be an autocrine mediator of transforming growth factor-ß (TGF-ß) on fibroblasts (5 6 7) . Members of the TGF-ß superfamily have been demonstrated to play key regulatory roles in normal development and numerous pathological disorders (8 9 10) . The biological activities of TGF-ß include growth stimulation (11) , growth inhibition (12) , and differentiation (13 , 14) . The molecular basis for these mutually exclusive activities has remained elusive but is clearly based in post-TGF-ß receptor pathways (8 , 15) . We previously reported that TGF-ß stimulation of fibroblast proliferation (6) , collagen synthesis (7) , and most recently, myofibroblast differentiation (16) is mediated via CTGF-dependent pathways. CTGF synthesis is selectively induced by TGF-ß in fibroblasts (17 , 18) via a unique TGF-ß response element contained in the CTGF promoter (19) , and blockade of CTGF synthesis or action effectively inhibits these TGF-ß effects on fibroblasts (6 , 7) .

CCN proteins are characterized by an extraordinarily high content of cysteine (>10%) and an absolute conservation of the position of the 38 cysteine residues in the peptide sequence (4) . With the exception of one newly identified member of the family, Cop-1/Wisp-2 (20 , 21) , each CCN protein is composed of four conserved sequence motifs present in two independent, cysteine-rich N-terminal and C-terminal domains linked by a cysteine-free hinge region (4 , 22) . Cop-1/Wisp-2 lack the most C-terminal motif present in the C-domain. Regarding the biological activities of the CCN family proteins, as with the TGF-ß superfamily members, investigators have reported a wide array of biological activities, including stimulation of cell migration, proliferation, extracellular matrix synthesis, adhesion, survival, differentiation, and apoptosis (22 23 24 25) . Many of these reports contradict others. For example, in contrast to the reports of CTGF acting as a potent mitogen for fibroblasts and smooth muscle cells (1 , 6 , 26) , including a detailed molecular description of a CTGF-dependent G1 arrest point in the fibroblasts cell cycle (27) , other investigators have reported that CTGF acts as an inhibitor for smooth muscle cell proliferation and can induce apoptosis in these cells (28) . Similarly, although the Nov gene was initially identified as a transforming oncogene (3) and has been shown to be overexpressed in tumors (29 , 30) , recent studies have indicated that overexpression of Nov can also lead to growth inhibition of glioma cells (31) . Last, Cyr61, which has been documented to act as an angiogenic factor (32) and to play a role in breast cancer progression (33) , has been reported to function as a tumor suppressor in small-cell lung cancer (34) . These studies illustrate that CCN proteins appear to stimulate proliferation and cell survival as well as induce differentiation and apoptosis.

Recently, we reported that combinatorial signaling pathways determine whether fibroblasts respond to TGF-ß or CTGF as a mitogen or differentiation-inducing factor (16) . In these studies, we found that the presence or absence of other growth factors, such as epidermal growth factor (EGF) or insulin-like growth factor-2 (IGF-2), was essential to determine the biological response of the target cell. For example, when cells were stimulated with TGF-ß or CTGF in the presence of EGF or another co-mitogen, nearly all the cells were stimulated to undergo DNA synthesis and cell proliferation. In marked contrast, if the same cells were stimulated with TGF-ß or CTGF in the presence of Thus, IGF-2, nearly all the cells responded by differentiating into myofibroblasts and increasing collagen synthesis. If EGF were added to the culture media when the cells were activated in the presence of IGF-2, all the cells responded with DNA synthesis, and no differentiation or elevation of collagen synthesis was detected. Thus, TGF-ß and CTGF are capable of stimulating cell proliferation or cellular differentiation depending on other environmental conditions, such as the presence or absence of other growth factors and cytokines. Nonetheless, the basis for the divergence of these biological responses to TGF-ß and CTGF remains unclear.

We reasoned that because TGF-ß was a potent inducer of CTGF production and because CTGF induced responses similar to those induced by TGF-ß, the molecular basis for these divergent biological responses might be determined in part by CTGF structure. As stated above, all members of the CCN family have a highly conserved structure, which appears to consist of two independent domains connected by a conspicuous cysteine-free linker or hinge region. Here, we report the results of our investigation of the relationship of CTGF structure to biological activities. Our findings demonstrate that different domains of the CTGF protein are responsible for the mediation of the proliferation and differentiation/collagen synthesis activities of CTGF. The N-terminal domain of CTGF mediates differentiation and collagen synthesis in concert with IGF-2. The C-terminal domain of CTGF mediates cell proliferation in concert with EGF. These data provide for the first time proof that individual domains of a CCN family member retain specific biological functions when separated. Furthermore, these data provide a basis for distinct signaling pathways for TGF-ß/CTGF control of the mutually exclusive cellular responses of proliferation and differentiation.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Sources of growth factors and antibodies
Recombinant human (rh)CTGF was prepared in our laboratory using a baculovirus expression system (5) . rhTGF-ß1 was obtained from Gibco-BRL (Gaithersburg, MD, USA), rhEGF from Upstate Biotechnology (Lake Placid, NY, USA), and rhIGF-2 from Collaborative Biomedical (Bedford, MA, USA). Goat anti-rhCTGF was raised against rhCTGF and purified as described by Duncan et al. (7) . Commercial antibodies and immunological reagents were obtained as follows: anti-{alpha}-smooth muscle actin ({alpha}-SMA) mouse monoclonal immunoglobulin G (IgG; clone 1A4, Sigma Chemical Co., St. Louis, MO, USA); biotinylated horse anti-mouse IgG secondary antibody (Vector Laboratories, Burlingame, CA, USA); alkaline phosphatase-conjugated streptavidin-biotin complex (Dako, Carpenteria, CA, USA); and Vector Red alkaline phosphatase visualization substrate (Vector Laboratories).

Cell cultures
Normal rat kidney (NRK) fibroblasts, clone NRK-49F, a continuous line of cultured NRK fibroblasts, were originally obtained from American Type Culture Collection (Manassas, VA, USA). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 2.5% fetal bovine serum (FBS) and 2.5% Nu-Serum I (NS; Collaborative Biomedical) and passaged prior to confluence. We used a selected strain of NRK cells directly responsive to CTGF for the studies reported herein.

Mitogenic assay
NRK fibroblasts were seeded at 10,000 cells/well in 48-well plates and grown to a confluent monolayer over a 6-day period in DMEM + 2.5% FBS/NS. Media were then changed to DMEM containing 25 mM HEPES and insulin, transferrin, selenium premix (Collaborative Biomedical), and cells were cultured for 8 or 9 days to permit NRK monolayers to become quiescent. The mitogenic effect of growth factors and CTGF domains was determined by their direct addition, along with EGF (0.5 ng/mL) and ascorbic acid (50 µg/mL), to the starved culture media. DNA synthesis was determined during the terminal 24 h of a 48 h treatment period by measuring 3H-thymidine incorporation into trichloroacetic acid-precipitated DNA (5) .

Collagen synthesis assay
Quiescent NRK fibroblasts, identical to those used in the mitogenic assay, were used to evaluate the effect of growth factors and CTGF domains on fibroblast collagen synthesis, which was determined during the terminal 24 h of a 48 h treatment period by measuring 3H-proline incorporation into pepsin-resistant, salt-precipitated extracellular collagen as described previously (7) . In the collagen assays, rhIGF-2 (10 ng/mL) was added along with ascorbic acid (50 µg/mL) to the starved culture media.

Immunological assays
The myofibroblasts present in NRK cultures were detected by immunostaining using a standard avidin-biotin amplification method (35) using a specific monoclonal antibody for {alpha}-SMA actin. Western blot assays were preformed using standard methods with antigens detected with alkaline phosphatase-conjugated secondary antibodies and a nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate alkaline phosphatase substrate mixture (Sigma Chemical Co.).

Production of rCTGF domains and domain-specific antibodies
Individual CTGF domains were produced using two independent methods. First, pure, intact rCTGF was subjected to limited proteolysis with chymotrypsin or plasmin, depending on the experiment. Protease activity was blocked using the irreversible protease inhibitors tosylphenylalanine chloromethyl ketone for chymotrypsin and tosyllysine chloromethyl ketone for plasmin. Electrophoretic separation of domains from intact CTGF and smaller fragments was achieved using standard methods for polyacrylamide gel electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS). Duplicate samples were run on discontinuous SDS-PAGE using a 3% stacking gel and a 12% separating gel. Samples were loaded in standard SDS gel-loading buffers without reducing agents or boiling. The pattern of peptides present in the samples was detected by Coomassie blue staining. Biological activity was determined by extraction of the peptides from frozen, 5 mm gel slices in the unstained samples.

Large-scale isolation of pure individual domains was accomplished by exploiting domain-specific, binding activities. The C-terminal domain binds heparin with high-affinity and was readily separated from the N-terminal domain by affinity chromatography using heparin Sepharose (Amersham Biosciences, Piscataway, NJ, USA). The N-terminal domain, which was present in the flow-through of the heparin Sepharose column, was isolated by affinity chromatography using concanavalin A Sepharose (Amersham Biosciences) and eluted with {alpha}-methylmannoside. Domain-specific antibodies were prepared from the IgG fraction of goat anti-rhCTGF antisera by affinity chromatography using pure individual domains coupled to Affi-Gel 10 (Bio-Rad, Hercules, CA, USA). Western blot analysis confirmed the purity of the domains and the specificity of the antibodies.

Pure CTGF N- and C-terminal domains were produced by expressing the N- or C-terminal domains individually by molecular biological engineering expression of only a limited region of the CTGF open reading frame. This was accomplished by polymerase chain reaction (PCR) amplification of the regions of the CTGF open reading frame that encoded the CTGF signal peptide and N-terminal domain or the C-terminal domain linked in-frame downstream of a suitable viral signal peptide to ensure secretion. By simple introduction of an in-frame stop codon in the cysteine-free region just prior to the sequence encoding the amino acid AYRLED, we were able to produce the CTGF N-terminal domain. Similarly, we cloned the portion of the open reading frame encoding only the C-terminal domain beginning at the sequence AYRLED in the cysteine-free region in-frame downstream of the viral signal peptide into the baculovirus shuttle vector GP67. This produced a chimeric protein, which contains a signal peptide from the GP67 virus gene that directs synthesis of the desired recombinant protein (or fragment) to the endoplasmic reticulum and ensures secretion. The individual domains were purified using the same methods to isolate the domains after proteolytic digestion of the intact CTGF.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Protein structural organization of CTGF and other CCN family members
The structural organization of CTGF and the other CCN family members suggested to us the possibility that the different domains of CTGF could be responsible for differential signaling of biological activities. The domain structure of the CCN family of gene products is summarized in Fig. 1 . The N-terminal domain contains two distinct structural motifs. The first motif is similar to one found in IGFBP responsible for binding IGF (4) , albeit studies with rCTGF have demonstrated that the interaction of CTGF with IGF has a much lower affinity than authentic IGFBPs (36) . A second motif present in this domain is related to the VWC motif, which has been implicated as a binding site for TGF-ß-related bone morphogenetic proteins (BMPs), and CTGF has been reported to bind BMPs and modulate their activity (37) . The C-terminal domain contains a motif related to the TSP-1 motif (38) , which is likely involved in binding to sulfated glycoconjugates (4 , 39) , and a cysteine knot similar to that found in TGF-ß, platelet-derived growth factor, and nerve growth factor, which allows dimerization of these proteins (40) . The high degree of sequence conservation in the various CCN family members suggests a commonality of function in these different gene products. Cop-1/Wisp-2 lack the cysteine knot motif and the transforming form of Nov lacks an intact IGFBP motif.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Diagram of CCN family members indicating the domain and motif structure of these proteins. Each motif is encoded by a separate exon. The transforming form of Nov lacks an intact IGF-binding proteins (IGFBP) motif, and the COP1/WISP2 gene product lacks the cysteine-knot motif (CYS-KNOT). Proteolytic cleavage sites in human CTGF for chymotrypsin (bold arrow) and plasmin (small arrows) are indicated. VWC, von Willebrand factor type C; TSP-1, thrombospondin-1.

Retention of biological activities of CTGF domains
Initially, we determined whether CTGF could retain biological activity after limited proteolytic digestion and if so, how small a fragment could be generated that exhibited activity in our biological assays. This would be essential for us to proceed in our structure/function analysis using biochemical methodologies. We first subjected CTGF to digestion with various proteases and evaluated their digestion pattern. Because of the high number of disulfide bridges, the domains of CTGF are resistant to digestion, and most proteases primarily cleaved only in the cysteine-free region, producing, almost exclusively, intact N- and C-terminal domains. However, plasmin cleaved not only in the hinge region but could also cleave the domains into fragments that represented the individual motifs. Initial testing revealed that digestion with plasmin did not destroy the biological activity of the CTGF protein. To determine the size of the peptides responsible for the activity, we purified intact, nondigested CTGF and plasmin-digested CTGF using SDS-PAGE under nonreducing conditions. Two samples of each preparation were run on parallel lanes of the gel: One lane was stained with Coomassie blue for protein detection, and the adjacent, duplicate lane was frozen on dry ice and cut into 5 mm slices, and the protein in the slices was extracted and tested in our biological assays for induction of DNA synthesis and collagen synthesis. As seen in Fig. 2 A, the nondigested CTGF sample contained exclusively a doublet of protein bands, which migrated with an apparent molecular weight (MW) of 36–38 kDa and were present in slice number 4. The plasmin-digested CTGF sample did not contain any material that migrated with the intact CTGF. All of the plasmin-digested CTGF had been converted to intact N- and C-terminal domains that migrated with an apparent MW of 20 kDa (slice 7) and a mixture of motifs that migrated at ~9 kDa (slice 9).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. Demonstration that CTGF domains but not smaller fragments retain biological activities of intact CTGF. A) CTGF and plasmin-digested CTGF were run on SDS-PAGE and stained with Coomassie blue. Plasmin cleaved at three internal sites in CTGF at the positions indicated by the small arrows in Fig. 1 . These are between amino acid numbers 98 and 99, 183 and 184, and 251 and 252, relative to the initiation methionine. The sites between the motifs in the domains (98 and 99, 251 and 252) were cleaved much less effectively than the site in the hinge region (183 and 184), most likely a result of steric restrictions. Portions of gel that were sliced are indicated. B, C) Extracted peptides from the indicated slices were tested for stimulation of DNA synthesis (B) or collagen synthesis (C), as described in Materials and Methods. In both assays, all activity in the nonplasmin-digested sample comigrated with the intact CTGF detected in slice 4. In contrast, after plasmin digestion (DG), all activity in either assay was detected in slice 7, which comigrated with the intact CTGF domains. In all samples, no activity comigrated with the smaller fragments of the CTGF domains.

The extracts of each slice of the SDS-PAGE were then processed and tested for biological activity, the results of which are shown in Fig. 2B, C . In both biological assays of the nondigested sample, all of the CTGF biological activities were present in slice 4, which represented the intact CTGF doublet detected by Coomassie staining. In contrast, after plasmin digestion, all of the biological activities shifted from slice 4 to slice 7, comigrating with the doublet that represented the intact N- and C-terminal domains of the CTGF molecule. No activity was detected in slice 4 (intact CTGF), and no activity was detected in slice 9, where the individual motifs migrated. These studies demonstrate that intact CTGF is biologically active, and domain-sized but not smaller fragments of CTGF retain sufficient biological activity to be detected under these assay conditions.

Domain-specific, biological activities of CTGF
To further characterize the specific activities of the individual domains, we used two approaches. First, we evaluated whether domain-specific antibodies could selectively block specific biological activities of the intact CTGF molecule, and second, we tested the biological activity of the purified individual domains. Initially, intact domains were prepared from native, biologically active rCTGF by digestion with chymotrypsin, which was chosen, as it preferentially cleaves in the cysteine-free hinge region, generating a C-terminal domain with its N-terminal sequence beginning at position 181 (AYRLED) relative to the initiation methionine. The N- and C-terminal domains are then readily separated from each other by affinity chromatography on heparin Sepharose. The N-terminal domain does not bind to heparin, whereas the C-terminal domain of CTGF is retained on heparin Sepharose and elutes at ~0.8 M NaCl, as characteristic of true heparin-binding growth factors such as fibroblast growth factor. This method yields pure domains that have less than 0.05% contamination with intact CTGF based on Western blot analysis with anti-CTGF IgG (Fig. 3 A). We then prepared domain-specific anti-CTGF antibodies by affinity chromatography using the purified N- or C-terminal domains of CTGF. As seen in Fig. 3B , the affinity-purified IgGs immunoreact with only their respective N- or C-terminal domain of CTGF. We next evaluated the affinity-purified antibodies in our biological assays for neutralization of CTGF biological activities by mixing the affinity-purified antibody with CTGF prior to addition to the target cell culture media. The results of these studies demonstrate that antibodies that are directed against the N-terminal domain of CTGF selectively inhibit collagen synthesis (Fig. 3C ) but not DNA synthesis (Fig. 3D ). In contrast, antibodies that are directed against the C-terminal domain of CTGF selectively inhibit DNA synthesis (Fig. 3D ) but not collagen synthesis (Fig. 3C ). These data indicate that different regions of the CTGF molecule are responsible for signaling different biological activities.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Domain-specific antibodies selectively block CTGF-stimulated DNA synthesis or collagen synthesis. A) Western blot analysis of pure, intact CTGF, chymotrypsin-digested CTGF, and purified N- and C-terminal CTGF domains. Samples were analyzed by SDS-PAGE followed by transfer to nitrocellulose and Western blot analysis using goat anti-rhCTGF IgG as described in Materials and Methods. Only the intact CTGF doublet is detected in the CTGF sample (as a result of glycosylation differences between the two peptides). After proteolytic digestion, no intact CTGF protein is detected in the chymotrypsin-digested sample (Chy-Digest) or in either of the purified samples of the CTGF N-terminal (N-Term) or C-terminal (C-Term) domains. B) Antibodies purified by affinity chromatography on CTGF domain Affi-Gel 10 were analyzed by Western blot for domain-specific immunoreactivity. Both antibodies exhibit domain-specific reactivity with no detected reactivity of the other CTGF domain. C) Inhibition of CTGF-stimulated collagen synthesis by N-terminal-specific but not C-terminal-specific antibodies. NRK cells were assayed for CTGF-stimulated collagen synthesis as described in Materials and Methods. The antibodies were added to the CTGF immediately prior to addition of the CTGF to the culture medium. D) Inhibition of CTGF-stimulated DNA synthesis by C-terminal-specific but not N-terminal-specific antibodies. NRK cells were assayed for CTGF-stimulated DNA synthesis as described in Materials and Methods, and the antibody was added to the CTGF immediately prior to CTGF addition to the culture medium.

To confirm these observations and to compare the specific activities of the domains with intact CTGF, we tested the purified CTGF N- and C-terminal domains in our biological assays. Initially, we used domains of CTGF that were prepared by chymotrypsin digestion of biologically active, intact CTGF. The rationale for this was that these domains retained activity based on the previous experiments using plasmin digestion followed by electrophoretic purification of the domains using SDS-PAGE. The N-terminal domain stimulated collagen synthesis (Fig. 4 A) and myofibroblast formation (Fig. 4C ). The C-terminal CTGF domain was inactive in these assays. Conversely, the C-terminal domain was active as a mitogen, and the N-terminal domain of CTGF was inactive in the mitogenic assay (Fig. 4B ). The results of these studies support our observations with the domain-specific, anti-CTGF antibodies. In all biological assays, the purified, individual CTGF domains stimulated similar fold induction of the biological response compared with intact CTGF or TGF-ß. Although both individual domains stimulated the same fold induction of their respective biological response as intact CTGF or TGF-ß, they exhibited a reduced specific activity (~10-fold) compared with intact CTGF.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Domain-specific, biological activities of CTGF. The biological activity of purified CTGF domains was compared with intact CTGF in collagen synthesis (A), DNA synthesis (B), and myofibroblast induction (C) assays. The N-terminal domain of CTGF is active to induce collagen synthesis and myofibroblast phenotype in the NRK fibroblasts, and the C-terminal domain has no activity in either of these biological assays. In contrast, the C-terminal domain is active in the DNA synthesis assay, whereas the N-terminal domain has no activity. Although both domains stimulate a similar magnitude of response in their respective assays, the individual domains are ~ 10-fold less active on a molar basis compared with intact CTGF, which with the domains stimulated a response of comparable magnitude with TGF-ß (solid bar). Anti-CTGF antibody blocks TGF-ß induction of myofibroblasts (C, lower middle panel). See Materials and Methods for assay details.

We next tested the biological activity of domains that were produced by recombinant expression of individual domains as discussed in Materials and Methods. Here, the intact N-terminal domain or the intact C-terminal domain was expressed using the same baculovirus system we had developed for expression of intact CTGF (5) . The location and primer sequences for the selective expression of the two domains are illustrated in Fig. 5 A. Western blots with anti-CTGF IgG and Coomassie blue staining of pure recombinant domains and intact CTGF are shown in Fig. 5B to illustrate the purity of these samples. The domains produced by recombinant expression appear to be similar to those produced by chymotrypsin digestion. We then tested the biological activity of these peptides and compared the dose response curves of the recombinant domains with intact CTGF and with chymotrypsin-digested, intact CTGF, which was not further purified to separate the individual domains. A positive control with TGF-ß (5 ng/mL) is included to illustrate the maximal response of the cells in the assays. As seen in Fig. 6 , the purified rCTGF domains retain biological activity in the collagen synthesis assay (Fig. 6A ) and the mitogenic assay (Fig. 6B ). The rN-terminal domain stimulated {alpha}-SMA expression with a similar specific activity as that of the N-terminal domain produced by chymotrypsin digestion (data not shown). Intact CTGF and the individual domains are capable of stimulating a maximal response comparable with that of TGF-ß (5 ng/mL). As with the domains purified from chymotrypsin-digested CTGF, the rN-terminal domain was only active in the collagen synthesis and myofibroblast-induction assays, whereas the rC-terminal domain was only active in the mitogenic assay. As seen with the domains produced by chymotrypsin digestion, the rCTGF domains have a specific activity that is ~ one-tenth the activity of intact CTGF. A similar reduction in the biological activity dose-response curve is seen with the sample of chymotrypsin-digested CTGF, which is not further purified to produce separated, individual domains. Thus, the basis for the reduction in specific activity appears to be largely related to the cleavage of the intact CTGF into individual domains. However, the molecular mechanism for this reduced specific activity remains to be determined. Collectively, these observations indicate that individual domains of CTGF are sufficient to signal the biological activities of CTGF. Whether the reduced, specific activity of these domains is of physiological relevance is not clear at the present time.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Recombinant expression and purification of individual CTGF domains. A) Portions of the open reading frame of CTGF were created by PCR amplification using specific primers to amplify only the intact N-terminal domain or C-terminal domain. Primers HO1B (5'cgggatccgcagtgccaaccatgacc3') and N1B (5'cgcggatccttactaagccgcgaggccaggccc3') were used to amplify the N-terminal domain, including the signal peptide, and create a stop codon in the cysteine-free hinge region just prior to the sequence AYRLED. Primers C1(5'cgcgaattcgcttaccgactggaagacacg3') and HO2 (5'ccgaattcttaatgtctctcactctc3') were used to amplify the C-terminal domain, including a portion of the cysteine-free hinge region beginning at the sequence AYRLED. These fragments were chosen, as in naturally occurring CTGF, which has been fragmented by proteases in vitro and in cell culture media, the N-terminal sequence determined by amino acid sequence analysis of the C-terminal domain is AYRLED. These amplified regions were cloned, sequenced to determine fidelity, and packaged into the baculovirus expression vectors as described previously for intact CTGF. B) SDS-PAGE of purified C- and N-terminal domains and intact CTGF. Samples were run on 12% acrylamide gels containing SDS, and the CTGF was detected by Coomassie blue staining for protein (lanes 2, 4, 7) or by Western blot analysis with goat polyclonal anti-CTGF IgG (lanes 1, 3, 5, 6).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Collagen synthesis and mitogenic assays of rCTGF domains. A) Dose response of CTGF domains, intact CTGF, and chymotrypsin-digested CTGF (CHT-DG-rCTGF) in the collagen synthesis assay. Intact CTGF, chymotrypsin-digested CTGF, and the rN-terminal domain were active in the collagen synthesis assay, and the rC-terminal domain was not active. It is noteworthy that the activity of the chymotrypsin-digested CTGF is greatly reduced from that of intact CTGF and more similar to that of the N-terminal domain. B) Dose response of CTGF domains, intact CTGF, and chymotrypsin-digested CTGF (CHT-DG-rCTGF) in the mitogenic assay. Intact CTGF, chymotrypsin-digested CTGF, and the rC-terminal domain were active in the mitogenic assay, and the rN-terminal domain was not active. Again, it is noteworthy that the activity of the chymotrypsin-digested CTGF is similar to that of the rC-terminal domain and greatly reduced from that of intact CTGF.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The studies presented here demonstrate that the two domains of CTGF can function independent of each other to stimulate myofibroblast differentiation and increased collagen synthesis or increased fibroblast proliferation. These data provide a molecular basis for the multifunctional activity of CTGF and explain the various observations, demonstrating TGF-ß can act to stimulate cellular proliferation and differentiation (8) . Furthermore, our observations are consistent with and provide a molecular basis for a number of observations regarding other members of the CCN family. For example, in the original identification of Nov, it was reported that the N-terminal, truncated form of Nov exhibited transforming activity on chick embryo fibroblasts, whereas the full-length form acted to inhibit fibroblast growth (3) . Our studies would predict that without an intact N-terminal domain, the truncated Nov could only act as a mitogen, as only the C-terminal proliferation signaling domain was intact. We feel that other studies, which have reported CTGF acts to limit smooth muscle cell proliferation (28) , are measuring the differentiating activity of CTGF and can now be resolved with the studies reporting mitogenic activity of CTGF (1 , 6 , 26 , 27) . The newest CCN family member (Cop-1/Wisp-2) lacks the fifth exon and encodes a protein that is truncated after the TSP-1 motif (21) . Based on the CTGF data presented here, it would be predicted that these peptides could only act as differentiation-inducing factors and would be incapable of stimulating proliferation, as only the N-terminal domain is intact. Future experiments directed at this question will help to refine this hypothesis.

CTGF and the individual domains of CTGF have high, specific activities, and whether the reduced activity of the individual domains is physiologically important remains to be determined. Our data indicate that intact CTGF is the most potent, biologically active form of the protein in tissue culture. How this relates to in vivo situations is not clear at present. Previous studies about CTGF and Cyr61 indicate synthesis of intact proteins with some limited processing to intact domains in cell culture (2 , 41) . Degraded fragments of CTGF have been isolated from tissues (42) , and that diabetic patients with nephropathy have elevated plasma levels of CTGF N-domain but not intact CTGF (43) . Pulse-chase studies, which we have conducted with TGF-ß-activated NRK fibroblasts using 35S-cysteine to follow CTGF synthesis and processing, confirm processing of the intact protein to domains, but it is not clear whether this processing is relevant to the biological response. One can envision selective degradation of one domain versus the other as a potential mechanism to select for proliferation or differentiation. Thus, the relationship of processing intact CTGF to individual domains with respect to the biological activities of CTGF remains a topic of intense interest.

The dose-response curves for intact CTGF and the individual CTGF domains are highly unusual. Instead of the typical sigmoidal dose response seen in growth factors and cytokines, these dose-response curves are more like a square wave. This would be indicative of strong, positive cooperativity for interaction of CTGF with its receptor(s) and possibly the other cofactors (EGF or IGF-2), essential for receptor activation and the involvement of multiple binding sites or interactions. Our unpublished observations indicate that CTGF is rapidly internalized into the endosomes and appears to signal from an endosomal location. We speculate that CTGF may function to organize the assembly of the cofactors (EGF or IGF-2) with their cognate receptors into a macromolecular signaling complex. The formation of this complex is more dependent on the ratio of the amounts of CTGF to cofactor and receptors rather than the actual concentration, as the relative concentrations of each of these components increase several orders of magnitude with the shift of location from the cell membrane and extracellular space to the endosomal vesicle lumen and its restricted membrane. Thus, once a certain amount threshold is reached, signaling occurs at an optimal level. Because of the need for trafficking CTGF into the signaling endosome, the typical dose-response curve between binding to cell-surface receptor and biological response is not evident. Further investigations into the basis for these complex interactions are needed to develop a clearer understanding of how CTGF acts at the molecular level in concert with the cofactors that have been identified.

CTGF can be viewed as two cytokines that have been linked into a single gene product. To our knowledge, this is the first time such an observation has been made in eukaryotes and suggests a genetic organization similar to that of prokaryotic polycistronic messages. As each motif in the CTGF gene is encoded by a distinct exon, it is possible that evolution selected for the functional linkage of these exons as a regulatory mechanism. This hypothesis is supported by other biological data indicating TGF-ß can function akin to an embryonic inducer (44) , with CTGF mediating the effects of the inducer long after it has been removed (16) . In connective tissue formation and regeneration, cell proliferation precedes but is closely followed by differentiation. The biological activities of the CTGF domains appear to be designed to control these mutually exclusive biological responses independently. In this manner, TGF-ß initiates a cascade response, priming and activating cells in the tissue to initiate a preprogrammed set of gene inductions, one of which is the long-term induction of the CTGF gene (17 , 19) . This process is fine-tuned by the production of other growth factors that regulate the balance between proliferation and differentiation in the local tissue environment and in this manner, the overlapping gradients of growth factors and other regulatory molecules in the tissue control pattern formation and tissue architecture.

Our findings indicate that CTGF acts as a pivotal switch-point in the cascade for connective tissue formation. CTGF alone is not responsible for determining whether cells respond to TGF-ß by proliferation or differentiation. Rather, as we have reported previously (16) , CTGF acts in concert with other growth factors such as EGF and IGF to control these events. Our model for the signaling pathway from TGF-ß through CTGF, resulting in cell proliferation or differentiation, is summarized in Fig. 7 . In this model, TGF-ß induces CTGF expression as well as other events that are not mediated by CTGF and serve to activate the cell and make it responsive to CTGF (6) . The response of the cell is then determined by the relative levels of cofactors such as EGF to support cell proliferation or IGF-2 to support differentiation. The proliferation signaling is mediated by the CTGF C-terminal domain in concert with EGF and EGF receptors. Differentiation and increased collagen synthesis are mediated by the N-terminal domain in concert with IGF via an IGF receptor. Because of the high degree of conservation of sequence and structural motifs, we suggest that most CCN family members function in a manner analogous to CTGF. That is, they would function downstream of an inducing cytokine, most likely another member of the TGF-ß superfamily, with their C-terminal domains supporting a proliferative response in target cells and the N-terminal domains supporting cell differentiation. Members that lack various motifs would be limited to one or the other biological action. For example, Cop-1 and Wisp-2, which lack the cysteine knot motif, would be predicted to function only as differentiation-inducing factors and could not support cell proliferation. Alternatively, other family members may function as antagonists to CTGF or some other CCN family member. Future studies directed at elucidating the actions of the CCN gene family should provide interesting and important insights into the molecular control mechanisms of a wide array of developmental systems and pathological disorders.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 7. Schematic diagram of TGF-ß/CTGF signaling pathways. TGF-ß induces synthesis of CTGF and activates cells via a CTGF-independent pathway, priming cells to become responsive to CTGF (6) . CTGF domains then signal in concert with EGF to stimulate DNA synthesis and cell proliferation or with IGF to stimulate differentiation and collagen synthesis.


   ACKNOWLEDGMENTS
 
This work was supported by National Institutes of Health Grant (GM 65603) to G. R. G. The authors acknowledge the excellent technical assistance of Shawn Williams and Helene Klapper.

Received for publication November 11, 2004. Accepted for publication January 7, 2005.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Bradham, D. M., Igarashi, A., Potter, R. L., Grotendorst, G. R. (1991) Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J. Cell Biol. 114,1285-1294[Abstract/Free Full Text]
  2. O’Brien, T. P., Yang, G. P., Sanders, L., Lau, L. F. (1990) Expression of cyr61, a growth factor-inducible immediate-early gene. Mol. Cell. Biol. 10,3569-3577[Abstract/Free Full Text]
  3. Joliot, V., Martinerie, C., Dambrine, G., Plassiart, G., Brisac, M., Crochet, J., Perbal, B. (1992) Proviral rearrangements and overexpression of a new cellular gene (nov) in myeloblastosis-associated virus type 1-induced nephroblastomas. Mol. Cell. Biol. 12,10-21[Abstract/Free Full Text]
  4. Bork, P. (1993) The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327,125-130[CrossRef][Medline]
  5. Frazier, K., Williams, S., Kothapalli, D., Klapper, H., Grotendorst, G. R. (1996) Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J. Invest. Dermatol. 107,404-411[CrossRef][Medline]
  6. Kothapalli, D., Frazier, K. S., Welply, A., Segarini, P. R., Grotendorst, G. R. (1997) Transforming growth factor ß induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ. 8,61-68[Abstract]
  7. Duncan, M. R., Frazier, K. S., Abramson, S., Williams, S., Klapper, H., Huang, X., Grotendorst, G. R. (1999) Connective tissue growth factor mediates transforming growth factor ß-induced collagen synthesis: down-regulation by cAMP. FASEB J. 13,1774-1786[Abstract/Free Full Text]
  8. Roberts, A. B. (2002) The ever-increasing complexity of TGF-ß signaling. Cytokine Growth Factor Rev. 13,3-5[CrossRef][Medline]
  9. McCartney-Francis, N. L., Frazier-Jessen, M., Wahl, S. M. (1998) TGF-ß: a balancing act. Int. Rev. Immunol. 16,553-580[Medline]
  10. Derynck, R., Akhurst, R. J., Balmain, A. (2001) TGF-ß signaling in tumor suppression and cancer progression. Nat. Genet. 29,117-129[CrossRef][Medline]
  11. Anzano, M. A., Roberts, A. B., Smith, J. M., Sporn, M. B., De Larco, J. E. (1983) Sarcoma growth factor from conditioned medium of virally transformed cells is composed of both type {alpha} and type ß transforming growth factors. Proc. Natl. Acad. Sci. USA 80,6264-6268[Abstract/Free Full Text]
  12. Tucker, R. F., Shipley, G. D., Moses, H. L., Holley, R. W. (1984) Growth inhibitor from BSC-1 cells closely related to platelet type ß transforming growth factor. Science 226,705-707[Abstract/Free Full Text]
  13. Joyce, M. E., Roberts, A. B., Sporn, M. B., Bolander, M. E. (1990) Transforming growth factor-ß and the initiation of chondrogenesis and osteogenesis in the rat femur. J. Cell Biol. 110,2195-2207[Abstract/Free Full Text]
  14. Desmouliere, A., Geinoz, A., Gabbiani, F., Gabbiani, G. (1993) Transforming growth factor-ß 1 induces {alpha}-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. 122,103-111[Abstract/Free Full Text]
  15. Roberts, A. B., Derynck, R. (2001) Meeting report: signaling schemes for TGF-ß. SciSTKE 2001,PE43
  16. Grotendorst, G. R., Rahmanie, H., Duncan, M. R. (2004) Combinatorial signaling pathways determine fibroblast proliferation and myofibroblast differentiation. FASEB J. 18,469-479[Abstract/Free Full Text]
  17. Igarashi, A., Okochi, H., Bradham, D. M., Grotendorst, G. R. (1993) Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Mol. Biol. Cell 4,637-645[Abstract]
  18. Soma, Y., Grotendorst, G. R. (1989) TGF-ß stimulates primary human skin fibroblast DNA synthesis via an autocrine production of PDGF-related peptides. J. Cell. Physiol. 140,246-253[CrossRef][Medline]
  19. Grotendorst, G. R., Okochi, H., Hayashi, N. (1996) A novel transforming growth factor ß response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ. 7,469-480[Abstract]
  20. Pennica, D., Swanson, T. A., Welsh, J. W., Roy, M. A., Lawrence, D. A., Lee, J., Brush, J., Taneyhill, L. A., Deuel, B., Lew, M., Watanabe, C., Cohen, R. L., Melhem, M. F., Finley, G. G., Quirke, P., Goddard, A. D., Hillan, K. J., Gurney, A. L., Botstein, D., Levine, A. J. (1998) WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors. Proc. Natl. Acad. Sci. USA 95,14717-14722[Abstract/Free Full Text]
  21. Zhang, R., Averboukh, L., Zhu, W., Zhang, H., Jo, H., Dempsey, P. J., Coffey, R. J., Pardee, A. B., Liang, P. (1998) Identification of rCop-1, a new member of the CCN protein family, as a negative regulator for cell transformation. Mol. Cell. Biol. 18,6131-6141[Abstract/Free Full Text]
  22. Grotendorst, G. R. (1997) Connective tissue growth factor: a mediator of TGF-ß action on fibroblasts. Cytokine Growth Factor Rev. 8,171-179[CrossRef][Medline]
  23. Lau, L. F., Lam, S. C. (1999) The CCN family of angiogenic regulators: the integrin connection. Exp. Cell Res. 248,44-57[CrossRef][Medline]
  24. Ayer-Lelievre, C., Brigstock, D., Lau, L., Pennica, D., Perbal, B., Yeger, H. (2001) Report and abstracts on the first international workshop on the CCN family of genes. Mol. Pathol. 54,105-120[Free Full Text]
  25. Perbal, B. (2001) NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol. Pathol. 54,57-79[Abstract/Free Full Text]
  26. Fan, W. H., Pech, M., Karnovsky, M. J. (2000) Connective tissue growth factor (CTGF) stimulates vascular smooth muscle cell growth and migration in vitro. Eur. J. Cell Biol. 79,915-923[CrossRef][Medline]
  27. Kothapalli, D., Grotendorst, G. R. (2000) CTGF modulates cell cycle progression in cAMP-arrested NRK fibroblasts. J. Cell. Physiol. 182,119-126[CrossRef][Medline]
  28. Hishikawa, K., Oemar, B. S., Tanner, F. C., Nakaki, T., Fujii, T., Luscher, T. F. (1999) Overexpression of connective tissue growth factor gene induces apoptosis in human aortic smooth muscle cells. Circulation 100,2108-2112[Abstract/Free Full Text]
  29. Hirasaki, S., Koide, N., Ujike, K., Shinji, T., Tsuji, T. (2001) Expression of Nov, CYR61 and CTGF genes in human hepatocellular carcinoma. Hepatol. Res. 19,294-305[CrossRef][Medline]
  30. Manara, M. C., Perbal, B., Benini, S., Strammiello, R., Cerisano, V., Perdichizzi, S., Serra, M., Astolfi, A., Bertoni, F., Alami, J., Yeger, H., Picci, P., Scotlandi, K. (2002) The expression of ccn3 (nov) gene in musculoskeletal tumors. Am. J. Pathol. 160,849-859[Abstract/Free Full Text]
  31. Gupta, N., Wang, H., McLeod, T. L., Naus, C. C., Kyurkchiev, S., Advani, S., Yu, J., Perbal, B., Weichselbaum, R. R. (2001) Inhibition of glioma cell growth and tumorigenic potential by CCN3 (NOV). Mol. Pathol. 54,293-299[Abstract/Free Full Text]
  32. Babic, A. M., Kireeva, M. L., Kolesnikova, T. V., Lau, L. F. (1998) CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc. Natl. Acad. Sci. USA 95,6355-6360[Abstract/Free Full Text]
  33. Tsai, M. S., Bogart, D. F., Castaneda, J. M., Li, P., Lupu, R. (2002) Cyr61 promotes breast tumorigenesis and cancer progression. Oncogene 21,8178-8185[CrossRef][Medline]
  34. Tong, X., Xie, D., O’Kelly, J., Miller, C. W., Muller-Tidow, C., Koeffler, H. P. (2001) Cyr61, a member of CCN family, is a tumor suppressor in non-small cell lung cancer. J. Biol. Chem. 276,47709-47714[Abstract/Free Full Text]
  35. Hsu, S. M., Raine, L., Fanger, H. (1981) Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J. Histochem. Cytochem. 29,577-580[Abstract]
  36. Yang, D. H., Kim, H. S., Wilson, E. M., Rosenfeld, R. G., Oh, Y. (1998) Identification of glycosylated 38-kDa connective tissue growth factor (IGFBP-related protein 2) and proteolytic fragments in human biological fluids, and up-regulation of IGFBP-rP2 expression by TGF-ß in Hs578T human breast cancer cells. J. Clin. Endocrinol. Metab. 83,2593-2596[Abstract/Free Full Text]
  37. Abreu, J. G., Ketpura, N. I., Reversade, B., De Robertis, E. M. (2002) Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-ß. Nat. Cell Biol. 4,599-604[Medline]
  38. Lawler, J., Hynes, R. O. (1986) The structure of human thrombospondin, an adhesive glycoprotein with multiple calcium-binding sites and homologies with several different proteins. J. Cell Biol. 103,1635-1648[Abstract/Free Full Text]
  39. Holt, G. D., Pangburn, M. K., Ginsburg, V. (1990) Properdin binds to sulfatide [Gal(3-SO4)ß 1-1 Cer] and has a sequence homology with other proteins that bind sulfated glycoconjugates. J. Biol. Chem. 265,2852-2855[Abstract/Free Full Text]
  40. Murray-Rust, J., McDonald, N. Q., Blundell, T. L., Hosang, M., Oefner, C., Winkler, F., Bradshaw, R. A. (1993) Topological similarities in TGF-ß 2, PDGF-BB and NGF define a superfamily of polypeptide growth factors. Structure 1,153-159[Medline]
  41. Ryseck, R. P., Macdonald-Bravo, H., Mattei, M. G., Bravo, R. (1991) Structure, mapping, and expression of fisp-12, a growth factor-inducible gene encoding a secreted cysteine-rich protein. Cell Growth Differ. 2,225-233[Abstract]
  42. Brigstock, D. R., Steffen, C. L., Kim, G. Y., Vegunta, R. K., Diehl, J. R., Harding, P. A. (1997) Purification and characterization of novel heparin-binding growth factors in uterine secretory fluids. Identification as heparin-regulated Mr 10,000 forms of connective tissue growth factor. J. Biol. Chem. 272,20275-20282[Abstract/Free Full Text]
  43. Roestenberg, P., van Nieuwenhoven, F. A., Wieten, L., Boer, P., Diekman, T., Tiller, A. M., Wiersinga, W. M., Oliver, N., Usinger, W., Weitz, S., Schlingemann, R. O., Goldschmeding, R. (2004) Connective tissue growth factor is increased in plasma of type 1 diabetic patients with nephropathy. Diabetes Care 27,1164-1170[Abstract/Free Full Text]
  44. Hogan, B. L. (1999) Morphogenesis. Cell 96,225-233[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
Y. Kanno, E. Kawashita, M. Minamida, A. Kaneiwa, K. Okada, S. Ueshima, O. Matsuo, and H. Matsuno
{alpha}2-Antiplasmin Is Associated with the Progression of Fibrosis
Am. J. Pathol., January 1, 2010; 176(1): 238 - 245.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
D. Abraham
Connective tissue growth factor: growth factor, matricellular organizer, fibrotic biomarker or molecular target for anti-fibrotic therapy in SSc?
Rheumatology, October 1, 2008; 47(suppl_5): v8 - v9.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
S. He, Y. Chen, R. Khankan, E. Barron, R. Burton, D. Zhu, S. J. Ryan, N. Oliver, and D. R. Hinton
Connective Tissue Growth Factor as a Mediator of Intraocular Fibrosis
Invest. Ophthalmol. Vis. Sci., September 1, 2008; 49(9): 4078 - 4088.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Fernandez, S. Trzaska, T. Wilder, L. Chiriboga, M. R. Blackburn, B. N. Cronstein, and E. S. L. Chan
Pharmacological Blockade of A2A Receptors Prevents Dermal Fibrosis in a Model of Elevated Tissue Adenosine
Am. J. Pathol., June 1, 2008; 172(6): 1675 - 1682.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. A. Jaffa, W. R. Usinger, M. B. McHenry, M. A. Jaffa, S. R. Lipstiz, D. Lackland, M. Lopes-Virella, L. M. Luttrell, P. W. F. Wilson, and the Diabetes Control and Complications Trial/Epide
Connective Tissue Growth Factor and Susceptibility to Renal and Vascular Disease Risk in Type 1 Diabetes
J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1893 - 1900.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P.-P. Kuang, X.-H. Zhang, C. B. Rich, J. A. Foster, M. Subramanian, and R. H. Goldstein
Activation of elastin transcription by transforming growth factor-beta in human lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L944 - L952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Kidd, I. M. Modlin, G. N. Eick, R. L. Camp, and S. M. Mane
Role of CCN2/CTGF in the proliferation of Mastomys enterochromaffin-like cells and gastric carcinoid development
Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G191 - G200.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Leask and D. J. Abraham
All in the CCN family: essential matricellular signaling modulators emerge from the bunker
J. Cell Sci., December 1, 2006; 119(23): 4803 - 4810.
[Abstract] [Full Text] [PDF]


Home page
Arch OphthalmolHome page
E. J. Kuiper, M. D. de Smet, J. C. van Meurs, H. S. Tan, M. W. T. Tanck, N. Oliver, F. A. van Nieuwenhoven, R. Goldschmeding, and R. O. Schlingemann
Association of Connective Tissue Growth Factor With Fibrosis in Vitreoretinal Disorders in the Human Eye
Arch Ophthalmol, October 1, 2006; 124(10): 1457 - 1462.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Dornhofer, S. Spong, K. Bennewith, A. Salim, S. Klaus, N. Kambham, C. Wong, F. Kaper, P. Sutphin, R. Nacalumi, et al.
Connective Tissue Growth Factor-Specific Monoclonal Antibody Therapy Inhibits Pancreatic Tumor Growth and Metastasis
Cancer Res., June 1, 2006; 66(11): 5816 - 5827.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
T. Aikawa, J. Gunn, S. M. Spong, S. J. Klaus, and M. Korc
Connective tissue growth factor-specific antibody attenuates tumor growth, metastasis, and angiogenesis in an orthotopic mouse model of pancreatic cancer
Mol. Cancer Ther., May 1, 2006; 5(5): 1108 - 1116.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
C. Boxall, S. T. Holgate, and D. E. Davies
The contribution of transforming growth factor-{beta} and epidermal growth factor signalling to airway remodelling in chronic asthma
Eur. Respir. J., January 1, 2006; 27(1): 208 - 229.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grotendorst, G. R.
Right arrow Articles by Duncan, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grotendorst, G. R.
Right arrow Articles by Duncan, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS