| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,1
# Max-Delbrück-Center for Molecular Medicine, Berlin-Buch;
Johannes-Müller-Institute for Physiology, University Medicine Berline (Charité), Berlin; and
* Medical Clinic I, Department of Cardiology, University Medicine Berlin (Charité), Berlin, Germany
1Correspondence: Max-Delbrück-Center for Molecular Medicine, Robert-Rössle-Str. 10, 13122 Berlin-Buch, Germany. E-mail: imorano{at}mdc-berlin.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
50%. This suggests that the Ca2+-calmodulin-calcineurin-NFAT pathway is involved in human ALC-1 promoter activation. However, inhibition of multifunctional Ca2+-calmodulin-dependent protein kinases (CaMK) by KN-93 decreased human ALC-1 promoter activity to almost basal levels. CaMK regulation of ALC-1 promoter activity effect could well be mediated by CaMKIV, which accumulated in the nucleus upon vasopressin stimulation. Inhibition of protein kinase C (PKC) isoforms by bisindolylmaleimide had no significant influence on human ALC-1 promoter activity. Thus, our results demonstrate a dominant role of Ca2+-calmodulin-dependent signaling pathways in the regulation of human ALC-1 expression.—Woischwill, C., Karczewski, P., Bartsch, H., Luther, H.-P., Kott, M., Haase, H., Morano, I. Regulation of the human atrial myosin light chain 1 promoter by Ca2+-calmodulin-dependent signaling pathways.
Key Words: atrial myosin light chain • H9c2 • promoter regulation • Ca2+ signaling
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 2)
. Each MyHC is associated with a regulatory (phosphorylatable) MyLC with 18–19 kDa (MLC-2) and an essential MyLC with an apparent mass of 28 kDa (MLC-1) (1
, 2)
. The normal adult human ventricle expresses preferentially the ß-MyHC gene and ventricular-specific MLC-2 (VLC-2) and MLC-1 (VLC-1) isoforms (3
4
5)
. However, the overloaded hypertrophied human ventricle re-expressed the atrium-specific MLC-1 (ALC-1), which is reversed upon surgical normalization of the hemodynamic state of the patients (6)
. Hypertrophied ventricles of patients with hypertrophic cardiomyopathy or congenital heart diseases expressed large amounts of ALC-1, while patients with terminal heart failure revealed no or only small amounts of ALC-1 in their ventricles (5)
. We recently demonstrated that replacement of VLC-1 by ALC-1 of human ventricular myosin obtained from hypertrophied ventricles improved the function of the myosin molecule as well as the contractile state and power output of "skinned" human ventricular preparations (7)
. Overexpression of the human ALC-1 in the ventricles of transgenic rats (8)
as well as mouse ALC-1 in the ventricle of transgenic mice (9)
induced significant increases in contractility of isolated perfused intact heart preparations.
Despite the significance of ALC-1 for myosin function and functional adaptation of the human heart to different work demands, little information is available concerning its expression regulation. Recently, we reported the existence of endogenous ALC-1 antisense mRNA expressed in the hypertrophied human ventricle, which inversely correlated with the amount of expressed ALC-1 (10)
. There was a linear relationship between expression levels of human ALC-1 and cardiac-specific basic helix-loop-helix transcription factors eHAND and dHAND in the hypertrophied human ventricle (10)
, suggesting regulation of ALC-1 expression by the E-box element present in the promoter region of the ALC-1 gene (11)
. To characterize the regulation of the human ALC-1 gene expression in more detail, we generated a construct consisting of the human ALC-1 promoter cloned in front of the luciferase reporter gene. Subsequently, we transfected the cardiomyocyte cell line H9c2, a permanent cell line derived from embryonic rat heart tissue (12)
with this construct, leading to stably transfected cell lines (H9c2T1 and H9c2T2) as models.
Recently, the significance of Ca2+-calmodulin- and protein kinase C (PKC) -activated intracellular signal transduction pathways in the generation of cardiac hypertrophy was introduced. Thus, massive cardiac hypertrophy upon constitutive activation of calcineurin or NFAT in transgenic mouse models (13)
could be elicited. Calcineurin activity was indeed found to be increased in the hypertrophied human heart (14)
. Cardiac-specific multifunctional Ca2+-calmodulin-dependent protein kinases CaMKIV (15)
and CaMKII
(16)
mediate a hypertrophic phenotype of the hearts of transgenic animals. Activity of the cardiac-specific CaMKII isoenzyme was found to be increased in the hypertrophied heart of animals (17)
and humans (18)
. Transgenic overexpression of a PKC-dependent MAPkinase that activates ERK1/2 evoked a hypertrophic phenotype of the heart (19)
. We concentrated on the role of distinct Ca2+-calmodulin and PKC-activated signaling pathways on regulation of the promoter of the human ALC-1 gene. We elicited the hypertrophic response by incubating H9c2T1 cells with vasopressin (20)
, which evokes an initial brief Ca2+ peak (phasic response) followed by a sustained enhanced Ca2+ plateau (tonic response), and stimulates the V1 receptor/Gq-protein/PLC pathways in this cell line. The brief phasic Ca2+ response is elicited by activation of intracellular Ca2+ sources whereas the tonic Ca2+ response depends on extracellular Ca2+ (21)
. We dissected the signaling pathways, which could regulate human ALC-1 promoter activity in H9c2T1 cells by using pharmacological inhibitory molecules and specific antibodies for intracellular localization analysis. We found that stimulation of the hypertrophic response of H9c2T1 cells by vasopressin and subsequent activation of the Ca2+-calmodulin-calcineurin-NFAT as well as the Ca2+-calmodulin-CaMK (in particular, the CaMKIV) represented the major pathways regulating human ALC-1 promoter activity. In contrast, activation of the PKC-dependent pathways remained without effect on human ALC-1 promoter activity. This is in line with the close correlation between cardiac hypertrophy and ALC-1 expression in patients with different heart diseases.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; EMBL accession no. X55000 and X58851) using human genomic DNA and specific primers (sense: 5'attggtaccTTGCCTGTAAAACAGCATG3'; antisense: 5'ctcccatggTGTCTTGTTGGGATCTTTGGC3'; ALC-1 promoter sequence in capital letters). After verification of the resulting PCR fragment by DNA sequencing, we cloned the PCR fragment into the luciferase reporter vector pGL3-Basic (Promega GmbH, Mannheim, Germany) using the restriction enzyme site KpnI in the multiple cloning site and the NcoI site situated at the start codon of the luciferase reporter gene in pGL3-Basic, resulting in the construct hALC-1 promoter luciferase. To obtain a selection marker for stable expression, we excised the neomycin resistance cassette composed of SV40 promoter, neomycin resistance gene, and SV40 polyadenylation signal from the pcDNA3.1 vector (Invitrogen Life Technologies, Karlsruhe, Germany), using restriction enzymes AseI at the 5' end and SalI at the 3' end. The hALC-1 promoter luciferase plasmid was linearized with SalI and ligated with the isolated neomycin resistance cassette using the compatible ends of the Sal I restriction enzyme site. After polishing of the remaining AseI and SalI ends, a second ligation was performed with blunt ends. The hALC-1 promoter of the resulting hALC-1 promoter Luciferase-SV40-Neo clone was confirmed by sequencing and used to establish a stable cell line (see below).
Generation of stably transfected H9c2 cell lines
Two stably transfected clonal H9c2 cardiomyocyte cell lines (H9c2 T1 and T2) were generated. 105 H9c2 cells derived from embryonic rat heart tissue (12)
and obtained from European Collection of Animal Cell Cultures were seeded/well of a 6-well plate. The next day cells were transfected with 5.0 and 7.5 µg of the hALC-1 promoter Luciferase-SV40-Neo reporter gene construct using a calcium phosphate transfection kit according to the manufacturer’s protocol (Invitrogen Life Technologies). The next day a change of medium stopped the overnight transfection. 48 h later, cells were split into selective medium using the antibiotic G418 (Invitrogen Life Technologies) in a concentration of 0.7 mg/mL. Cells were kept under these conditions for the next 25 days, after which they were subcloned, finally leading to the clonal stably transfected cardiomyocyte cell lines H9c2T1 and H9c2T2.
Genotyping of the stably transfected H9c2 cells
DNA extraction from the H9c2T1 and H9c2 cells was performed using the Invisorb Twin Prep DNA/RNA Kit (InViTek, Berlin, Germany). Briefly, cells were harvested, washed with PBS, and homogenized in the lysis buffer. After addition of adsorbin to the cell lysate, incubtion on ice, and vortexing, the lysate was centrifuged. The adsorbin bound DNA pellet was then washed several times with wash buffer (buffer concentrate supplied by the company dissolved in distilled water and 96% ethanol). The DNA was eluted and stored at –20°C. PCR was performed using standard buffer conditions and the following construct-specific primers in a final concentration of 0.5 µM: sense 5'acacccgagggggatgataa3' (located in the luciferase reporter gene); antisense 5'cggcacttcgcccaatagca3' (located in the neomycine resistance gene). Subsequent gel electrophoresis revealed the predicted amplification product of 1579 bp.
Immunoblotting
Cells were harvested, homogenized in lysis buffer (50 mM HEPES, 200 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% glycerol, 0.1% Tween-20, 10 mM ß-glycerophosphate, 1 mM NaF, 2 mM Na3VO4, 1 mM DTT, 0.2 mM PMSF, 5 µg/mL leupeptin), and incubated on ice for 90 min with intervening vortexing. After centrifugation of the homogenate, the supernatant was recovered and its protein content was analyzed with a modified Lowry assay (DC Protein Assay, Bio-Rad Laboratories GmbH, Munich, Germany). Frozen tissue of the right atrium and ventricle of a WKY rat heart was homogenized in buffer (10 mM HEPES, 0.1 mM PMSF, 0.2 mM DTT, 5 µL of a protease inhibitor cocktail; Sigma, Taufkirchen, Germany) using an Ultra-Turrax TM (homogenizer). Protein content was determined as mentioned above. 10 µg of protein was loaded onto a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane according to standard procedures. An isoform-specific or panspecific ALC-1 antibody (2 µg/mL each) was applied as a first antibody (for a detailed description of antibodies, see below). An anti-rabbit-POD antibody was used in a 1/1000 dilution. Immunodetection was performed with the ECL system (Amersham Biosciences Europe GmbH, Freiburg, Germany).
Antibodies raised against ALC-1 were generated in New Zealand white rabbits by immunization with synthetic peptides coupled to keyhole limpet hemocyanin according to standard protocols. The isoform-specific ALC-1 antibody was raised against the peptide PAPAPAPEPLRDSAFDPKS, corresponding to amino acids 21-39 of rat ALC-1 (accession no. P17209). The panspecific antibody was raised against the peptide APKKPEPKKEAAK, corresponding to amino acids 2-14 of human ALC-1 (accession no. P12829). This region is highly homologous in rat and human ALC-1 and in VLC-1. The antibody-containing serum fractions were affinity purified on the respective peptide antigen columns.
Luciferase assay
The amount of luciferase was analyzed with a commercially available luciferase assay system (Promega GmbH) according to the manufacturer. Briefly, cells were harvested, washed with PBS, and lysed in 1x reporter lysis buffer (RLB). To ensure complete lysis, one freeze-and-thaw cycle was carried out using liquid nitrogen. After homogenization of the cell lysate and subsequent centrifugation, the supernatant was collected and stored at –70°C. Luminescence analysis was carried out using the Fluoroskan Ascent FL Type 374 (Labsystems, Frankfurt, Germany). The luminometer was programmed to perform a delay of 2 s and a data acquisition interval of 10 s. Serial dilutions of recombinant luciferase (Promega GmbH) were prepared as standards in a RLB mix (1xRLB, 1 mg/mL BSA) and the probes were measured undiluted or diluted (1:10 in a mix of 1xRLB, 1 mg/mL BSA). 20 µL of the probes or the standards was loaded onto a 96-well plate and luminescence was measured using 100 µL of the luciferase assay reagent/well. Data were analyzed with Fluoroskan Ascent FL software.
Cell culture and treatments
H9c2T1 and H9c2T2 cells were maintained in the myoblast state in DMEM (PAA Laboratories, Cölbe, Germany) supplemented with 10% fetal bovine serum (FBS) (Invitrogen Life Technologies). Cells were grown to near confluence at 37°C and 5% CO2 in a humidified atmosphere. Typically, experiments were performed in triplicates in a 6-well plate. For induction of hypertrophy by vasopressin, 2.5 x 105 cells were seeded/well of a 6-well plate. After 24 h, serum starvation was induced and maintained until the end of the experiment. After another 24 h, [Arg8]vasopressin (Sigma, Munich, Germany) dissolved in water was added in a concentration of 1 µM. Cells were cultured for 48 h and harvested for the luciferase assay as described above. All inhibitors were purchased from Calbiochem (Schwalbach, Germany) except for cyclosporin A (Sigma, Taufkirchen, Germany). Cyclosporin A (CspA) was solubilized in ethanol. The CaMK inhibitor KN93 and its inactive analog KN92 were solubilized in sterile H2O and DMEM, respectively. Bisindolylmaleimide-hydrochloride (BIM) was used as a PKC inhibitor and dissolved in H2O. Cells were pretreated with inhibitors 30 min (CspA) or 1 h (KN92, KN93, BIM) before addition of vasopressin and remained in the medium during the experiment. Protein content of the cell cultures was analyzed with a modified Lowry assay (DC Protein Assay, Bio-Rad Laboratories GmbH).
Immunofluorescence analysis
For immunofluorescence analysis, H9c2T1 cells were washed twice with PBS. Fixation of the cells was performed for 5 min at –20°C in methanol. The cells were incubated with antibodies raised against NFAT (NFATc4, Santa Cruz Biotechnology, Santa Cruz, CA, USA), CaMKII (cf. ref 22
), or CaMKIV (BD Biosciences PharMingen, San Diego, USA). Secondary antibodies conjugated with Cy3 or Alexa 594 (Molecular Probes, Eugene, OR, USA) were used. Fluorescence was detected using an Axioplan II fluorescence microscope (Zeiss, Jena, Germany) or a confocal microscope LSM 510 META (Zeiss, Jena, Germany). For evaluation of the percentage of nuclear NFAT localization, a number (n) of untreated (–V) or vasopressin-treated (+V) H9c2T1 cells from more than one experiment were analyzed by visual inspection. Cytoplasmic or nuclear localization of NFAT was an all-or-none phenomenon (and could therefore be analyzed and quantitated by immunofluorescence).
Statistics
Values are expressed as means ± SE. Luciferase expression experiments were performed in triplicate, each measured three or four times (i.e., 9 to 12 measurements/treatment). Significance analysis was performed using the unpaired Student’s t test or ANOVA with Bonferroni as post test. Promoter sequence analysis to detect consensus binding sites was performed using Genomatix Matinspector.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A). The hALC-1 promoter Luciferase-Neo reporter gene construct was then transfected into the H9c2 cells as described in Materials and Methods. Selection of the transfectants with G418 (geneticin) and subcloning of the surviving cells led to the stably transfected cell lines H9c2T1 and H9c2T2. To verify integration of the reporter gene construct into the genomic DNA of the stably transfected cells, we isolated DNA from the H9c2T1 and wild-type H9c2 cells and performed PCR using construct-specific primers (see arrows Fig. 1A
). Figure 1B
shows the specific amplification products using the construct itself as a positive control (1579 bp, lane 1) and DNA obtained from H9c2T1 cells (lane 3). DNA prepared from wild-type H9c2 cells showed no amplification product (lane 2). The same results could be obtained with H9c2T2 (not shown).
|
Vasopressin activates the hALC-1 promoter but not the endogenous rat ALC-1 expression
Unstimulated H9c2T1 cells revealed a detectable luciferase signal even under serum-free conditions (Fig. 2
). In contrast, there were undetectable luciferase signals in the wild-type H9c2 cells (data not shown), indicating basal activity of the hALC-1 promoter in H9c2T1. The luciferase level rose 4.4-fold upon addition of vasopressin (1 µM) under serum-free conditions (Fig. 2A
), indicating that vasopressin stimulation of the H9c2T1 cells leads to a statistically significant (P<0.001) activation of hALC-1 promoter activity. Similar results could be obtained with H9c2T2 (i.e., basal luciferase signal in unstimulated cells and a 4.3-fold increase of the luciferase signal upon vasopressin stimulation; not shown).
|
To analyze endogenous rat ALC-1 expression in H9c2T1 cells, we performed SDS-PAGE and Western blot of the cells using an isoform-specific antibody raised against rat ALC-1 (Fig. 2B.1
) or a panspecific ALC-1 antibody (Fig. 2B.2
.). The isoform-specific antibody reacted selectively with the rat ALC-1 in a SDS extract of rat atrium but not of rat ventricle. Using the same antibody, the rat ALC-1 could not be detected in unstimulated rat cardiomyoblast H9c2T1 cells. Nor could expression of the endogenous rALC-1 gene be induced in the cells upon vasopressin (1 µM) stimulation. Using the panspecific ALC-1 antibody, rat ALC-1 and rat VLC-1 could be detected according to its homology with VLC-1 (see Materials and Methods). Using this panspecific antibody, we did not detect the expression of endogenous rat ALC-1 or VLC-1 in H9c2T1 cells. In accordance with the observation using the isoform-specific antibody, vasopressin stimulation did not induce rat ALC-1 or rat VLC-1 expression (Fig. 2B.2
).
Protein concentration rose 1.7-fold from 54.7 ± 2.3 µg/well (6)
in unstimulated to 95.6 ± 2.6 µg/well (6)
in vasopressin (1 µM)-stimulated H9c2T cardiomyocytes: 2.5 x 105 cells/well; means ± SE, number of cell cultures (wells) in parentheses.
PKC inhibition has no effect on the activity of the hALC-1 promoter
We wanted to elucidate the regulatory pathways activated upon vasopressin stimulation (1 µM). We analyzed the involvement of protein kinase C (PKC) in regulating the hALC-1 promoter by using the PKC inhibitor bisindolylmaleimide (BIM) in two different concentrations (200 and 400 nM). BIM is especially useful since the 200 nM dose completely inhibits the 
and ß PKC isoform, whereas the 400 nM dose leads to a considerable repression of the and 
isoforms. We detected no change in luciferase activity when vasopressin-stimulated cells were treated with 200 nM BIM (Fig. 3
). The higher concentration of 400 nM BIM lead to a minor but statistically nonsignificant decrease of luciferase activity compared with H9c2T1 cells stimulated solely with vasopressin.
|
Vasopressin causes nuclear translocation of NFAT in H9c2T1 cells
The Ca2+-calmodulin-calcineurin-NFAT pathway plays an important role in regulating hypertrophic genes. We determined whether this pathway is involved in hALC-1 promoter activation. We stimulated H9c2T1 cells with vasopressin (1 µM) and analyzed NFAT localization after immunofluorescent staining of the cells with an antibody raised against NFAT3. NFAT3 in untreated H9c2T1 cells generally revealed a predominant cytoplasmic localization whereas only 7% of the nuclei contained NFAT3 (Fig. 4
). However, upon vasopressin stimulation of H9c2T1 cells, almost all (93%) nuclei became NFAT3 positive. This demonstrates that NFAT3 translocation from the cytoplasm to the nucleus takes place in response to vasopressin stimulation. Inhibition of vasopressin-stimulated cells with the calcineurin inhibitor CspA (1 µM) caused a statistically significant suppression of the luciferase signal compared with untreated vasopressin-stimulated H9c2T1 cells (Fig. 5
). This indicates that calcineurin is involved in vasopressin-induced activation of the hALC-1 promoter.
|
|
Extracellular Ca2+ is not involved in vasopressin induced hALC-1 promoter activation
We investigated the role of phasic and tonic changes of intracellular free Ca2+, which are elicited by intracellular and extracellular Ca2+ sources, respectively (12)
, on hALC-1 promoter activity. We incubated H9c2T1 cells either with or without Ca2+ in the culture medium. We could not detect any statistically significant change in luciferase levels of vasopressin-treated H9c2T1 cells with or without extracellular Ca2+ (Fig. 6
).
|
CaMK inhibition suppresses vasopressin-stimulated hALC-1 promoter activity
To study the role of multifunctional Ca2+-calmodulin-dependent kinases (CaMK) on hALC-1 promoter activation, we used the inhibitor KN93, which blocks the activity of all CaMKs, and its inactive analog KN92 as control. H9c2T1 cells were stimulated with vasopressin (1 µM) and treated with KN93 or KN92 (10 µM each). Compared with unstimulated H9c2T1 cells, vasopressin stimulation (1 µM) significantly activated hALC-1 promoter activity. Treatment with KN93 significantly suppressed the vasopressin effect (Fig. 7
). A similar inhibition of the vasopressin effect by KN93 could be observed using H9c2T2 cells (not shown). The inactive KN93 analog KN92 had no significant influence on the vasopressin effect of H9c2T1 (Fig. 7)
. These results suggest an important role of the Ca2+-calmodulin-CaMK pathway in the regulation of the hALC-1 promoter.
|
Localization of CaMK forms
Having demonstrated a role of CaMK isoenzymes in hALC-1 promoter regulation (see Fig. 7
), we analyzed the involvement of the different forms of the CaMK family. H9c2T1 cells were stimulated with vasopressin (1 µM). Subsequently, immunofluorescence staining was performed with antibodies raised against CaMKII and CaMKIV. Figure 8
(top) shows that CaMKII is located exclusively in the cytoplasm; it remained there even after vasopressin stimulation. In contrast, CaMKIV is located in the cytoplasm and nucleus. We observed a pronounced accumulation of CaMKIV in the nucleus upon vasopressin stimulation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and animal heart (8
, 9)
, little information is available on the expression regulation of the ALC-1 gene.
To investigate the intracellular pathways that control human ALC-1 promoter activity, we used the H9c2 rat cardiomyocyte cell line to generate stably transfected rat cardiomyocyte cell lines with a construct containing the human ALC-1 promoter cloned in front of the luciferase gene as reporter gene (H9c2T1 and H9c2T2) for analysis of promoter activity regulation. Expression levels of luciferase then provide a selective measure of human ALC-1 promoter activity. Some experiments were verified using a second stably transfected cardiomyocyte cell line (H9c2T2) to exclude unspecific effects due to possible site effects upon random integration of the hALC-1-promoter luciferase gene construct. We detected basal luciferase expression levels in unstimulated cells, demonstrating that H9c2T1 cells contained the relevant activated transcription factors involved in human ALC-1 promoter regulation. Likewise, detectable amounts of ALC-1 mRNA could be found in the normal human ventricle (10)
, demonstrating basal activity of the ALC-1 promoter, albeit the ALC-1 protein is not expressed in the normal human ventricle (4
, 5
, 10)
.
For the first time we show here that hypertrophic responses (verified by increased protein accumulation) of H9c2T1 cells induced by vasopressin strongly increased human ALC-1 promoter activity. This effect on the human promoter seems to be specific, since the same vasopressin stimulation of H9c2T1 cells did not activate the expression of the endogenous rat ALC-1 gene. In fact, the cardiac hypertrophy of the rat is characterized by a shift of myosin heavy chain gene expression rather than a change of essential myosin light chain gene expression (for review see 5).
It is well established that a hypertrophic response is elicited in the cardiac H9c2 cell line upon stimulation with vasopressin (20)
, which activates the V1 receptor/Gq-protein/PLC system and elicits phasic and tonic increases of intracellular free Ca2+ (21)
. Likewise, stimulation of the V1 receptor/Gq-protein/PLCß pathways revealed hypertrophic responses in primary cardiomyocytes (23)
. This results in the production of diacylglycerol and inositol trisphosphate, which in turn mobilizes intracellular Ca2+ and activates protein kinase C (21
, 24)
. Thus, many signaling pathways regulating expression of genes involved in the hypertrophic process became activated, particularly Ca2+-calmodulin-dependent and MAPK pathways (21)
. Stimulation of the G-protein-coupled V1 receptor of H9c2T1 cells therefore provides the opportunity to selectively dissect the most relevant hypertrophic pathways involved in human ALC-1 promoter regulation.
Upon stimulation of the G-protein-coupled V1 receptor, activated PKC mobilizes the p42 MAPkinase (ERK2) pathway in H9c2 cells (21)
. Transgenic overexpression of a MAPkinase that activates ERK1/2 evoked a hypertrophic phenotype of the heart (19)
. ERK1/2 is believed to phosphorylate nuclear transcription factors, thus increasing the transcription rate of cardiac genes (25)
. We inhibited the MAPkinase pathways of vasopressin-stimulated H9c2T1 cells indirectly by using the PKC inhibitor BIM. This inhibitor revealed only a small and statistically nonsignificant inhibitory effect on human ALC-1 promoter activity. Hence, we suggest that 1) PKC isoforms are not involved in the regulation of human ALC-1 promoter activity in H9c2T1 cells upon vasopressin stimulation, and 2) other signaling pathways play a dominant role on human ALC-1 promoter activity regulation.
Activation of the protein phosphatase calcineurin by the Ca2+-calmodulin complex and subsequent dephosphorylation and nuclear translocation of transcription factors of the NFAT family constitutes a major mechanism of gene transcription activation in the course of the cardiac hypertrophy process (13
, 14)
. We could demonstrate here that the same pathway is active in the cardiomyocyte H9c2 cell line and that it increased human ALC-1 promoter activity in H9c2T1 cells. Cyclosporin A, a potent calcineurin inhibitor (26)
, partially but significantly attenuated the activation level of the human ALC-1 promoter of vasopressin-stimulated H9c2T1 cells. Whether translocated NFAT directly activates the human ALC-1 promoter and/or affects promoter activity via integrated action with other transcription factors needs to be elucidated. NFAT3 has been demonstrated to be a cofactor for the cardiac zinc finger transcription factor GATA-4 (13)
, which plays an important role in the cardiac hypertrophy process (27)
. For direct activation, the human ALC-1 promoter sequence (11)
contains several NFAT as well as GATA-4 consensus binding sites (e.g., at –1679 to –1689 bp and –1484 to –1496 bp, respectively).
The significance of the calcineurin/NFAT pathway for human ALC-1 promoter activity is in line with clinical investigations: patients with hypertrophic obstructive cardiomyopathy revealed significantly elevated calcineurin activities (14)
and expressed large amounts of ALC-1 (10)
. The overloaded hypertrophied ventricle of patients with valvular heart diseases re-expressed the ALC-1 in the ventricle (6)
. Hemodynamic normalization upon valve replacement caused normalization of ventricle dimensions whereas ALC-1 expression became undetectable (6)
.
Besides the calcineurin/NFAT pathway, the effect of the multifunctional Ca2+-calmodulin-dependent kinases (CaMK) was investigated by using the CaMK inhibitor KN-93, which blocks activity of all CaMK (28)
. In contrast to the calcineurin pathway, which only partially activated the human ALC-1 promoter, we found an almost complete decline of promoter activity to basal levels upon CaMK inhibition of vasopressin-stimulated H9c2T1 cells. This demonstrates the important role of the Ca2+-calmodulin systems on human ALC-1 promoter regulation. H9c2T1 cardiomyocyte cells expressed cytoplasmic forms of the CaMKII; consequently, no nuclear staining could be detected in our immunofluorescence study (cf. also ref 22
). This localization pattern remained unchanged upon vasopressin stimulation. CaMKIV, however, could be localized in the cytoplasm and the nucleus, even in unstimulated H9c2T1 cells. In fact, CaMKIV exists in a wide range of tissues, including the heart (29)
. Upon vasopressin stimulation, CaMKIV accumulated in the nucleus. This vasopressin-induced relative nuclear accumulation of CaMKIV is interesting, since CaMKIV confers hypertrophic responses upon phosphorylation of histone deacetylase, with subsequent nuclear export and release of active MEF2 isoforms from the histone deacetylase/MEF2 complex (15)
. The hypertrophic response upon stimulation of G-protein-coupled receptor of primary neonatal cardiomyocytes by phenylephrine-activated MEF2 is a process tightly associated with phosphorylation of histone deacetylase by CaMKIV (30)
. Several corresponding consensus binding sites for MEF2 exist in the human ALC-1 promoter sequence (e.g., at –1595 to –1617 bp). Alternatively, CaMKIV phosphorylates cAMP response element (CRE) binding protein (CREB), a ubiquitous transcription factor, which is then coactivated by CREB binding protein (CBP) (31)
. Phosphorylation of CREB by CaMKIV occurs at the same site (Ser133) as protein kinase A-mediated phosphorylation (31)
, which markedly stimulates CRE-mediated transcription (note a CREB binding site at –1558 to –1578 bp in the human ALC-1 promoter). CaMKII, however, additionally phosphorylates CREB at S142, thus negatively regulating CREB activity (32)
. Likewise, activating transcription factor-1 (ATF-1) is stimulated only by CaMKIV phosphorylation at Ser 63, whereas CaMKII was ineffective, due to the phosphorylation on a second site at ATF-1 (33)
. Hence, in the H9c2T1 cardiomyocycte cells the stimulation of human ALC-1 promoter activity by CaMK may well be mediated by CaMKIV rather than CaMKII.
Elimination of extracellular Ca2+ induced a brief phasic increase of intracellular free Ca2+ upon vasopressin stimulation (21)
, which was sufficient to confer the full vasopressin effect on hALC-1 promoter activity. We therefore suggest that phasic rather than sustained tonically enhanced intracellular Ca2+ levels activate those Ca2+-calmodulin-dependent pathways that regulate the expression of the hALC-1 gene.
In summary, Ca2+-calmodulin-dependent processes rather than PKC-activated hypertrophic signaling pathways involved in the development of cardiac hypertrophy regulate the activity of the human ALC-1 promoter via the activation of calcineurin and most probably CaMKIV.
|
ACKNOWLEDGMENTS |
|---|
Received for publication June 8, 2004. Accepted for publication November 19, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. I. Luoma and L. Zirpel Deafferentation-Induced Activation of NFAT (Nuclear Factor of Activated T-Cells) in Cochlear Nucleus Neurons during a Developmental Critical Period: A Role for NFATc4-Dependent Apoptosis in the CNS J. Neurosci., March 19, 2008; 28(12): 3159 - 3169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. M. Hernandez, M. Jones, G. Guzman, and D. Szczesna-Cordary Myosin essential light chain in health and disease Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1643 - H1654. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Sucharov, S. Langer, M. Bristow, and L. Leinwand Shuttling of HDAC5 in H9C2 cells regulates YY1 function through CaMKIV/PKD and PP2A Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1029 - C1037. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
