FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devchand, P. R.
Right arrow Articles by Nikolic, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devchand, P. R.
Right arrow Articles by Nikolic, B.
(The FASEB Journal. 2005;19:203-210.)
© 2005 FASEB

A synthetic eicosanoid LX-mimetic unravels host-donor interactions in allogeneic BMT-induced GvHD to reveal an early protective role for host neutrophils

Pallavi R. Devchand*, Birgitta A. Schmidt*, Valeria C. Primo{dagger}, Qing-yin Zhang{dagger}, M. Amin Arnaout{dagger}, Charles N. Serhan*,1 and Boris Nikolic{dagger}

* Center for Experimental Therapeutics and Reperfusion Injury, Department of Anesthesiology, Perioperative and Pain Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, USA; and
{dagger} Renal Division, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA

1Correspondence: Center for Experimental Therapeutics and Reperfusion Injury, Thorn Building for Medical Research, Brigham and Women’s Hospital, 75 Francis St., Boston, MA 02115, USA. E-mail: cnserhan{at}zeus.bwh.harvard.edu and bnikolic{at}partners.org


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Lipoxin A4 (LXA4) and aspirin-triggered 15-epi-LXA4 are potent endogenous lipid mediators thought to define the inflammatory set-point. We used single prophylactic administrations of a synthetic aspirin-triggered lipoxin A4 signal mimetic, ATLa, to probe dynamics of early host-donor interactions in a mouse model for the inflammation-associated multifactorial disease of allogeneic bone marrow transplant (BMT) -induced graft-vs.-host disease (GvHD). We first demonstrated that both host and donor are responsive to the ATLa signals. The simple and restricted regimen of a single prophylactic administration of ATLa [100 ng/mL to donor cells or 1 µg (~50 µg/kg) i.v. to host] was sufficient to delay death. Clinical indicators of weight, skin lesions, diarrhea and eye inflammation were monitored. Histological analyses on day 45 post-BMT showed that the degree of cellular trafficking, particularly neutrophil infiltrate, and protection of end-organ target pathology are different, depending on whether the host or donor was treated with ATLa. Taken together, these results chart some ATLa protective effects on GvHD cellular dynamics over time and identify a previously unrecognized effect of host neutrophils in the early phase post-BMT as important determinants in the dynamics of GvHD onset and progression.—Devchand, P. R., Schmidt, B. A., Primo, V. C., Zhang, Q.-y., Arnaout, M. A., Serhan, C. N., Nikolic, B. A synthetic eicosanoid LX-mimetic unravels host-donor interactions in allogeneic BMT-induced GvHD to reveal an early protective role for host neutrophils.


Key Words: eicosanoids • lipoxin • LXA4 receptor • complex inflammatory diseases


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
BONE MARROW TRANSPLANTS (BMTs) are often the only therapeutic avenue available to rescue patients from hematological malignancies and related diseases (1) . Syngeneic transplants are successful with manageable side effects, but availability of identical sibling donors is limited; hence the efforts focused on developing safe protocols for HLA-matched and HLA-mismatched BMTs. In these allogeneic transplants, graft-vs.-host disease (GvHD) is the primary formidable complication contributing to multiorgan damage leading to death. Despite major advances in chemotherapy, immunosuppressive therapy, and supportive care, chronic GvHD still develops in ~20 to 40% of patients receiving BMTs (www.nih.gov/nci). The morbidity and mortality of GvHD are associated with two clinical benefits: graft-vs.-leukemia effects and enhancement of the engraftment process. To efficiently treat and prevent this complex inflammatory disease, a better understanding of the cellular and molecular mechanisms involved in disease onset and progression is required.

The pathophysiology of BMT-induced GvHD is well documented (2) . For instance, it manifests as a multiorgan disease resulting from interplay between graft cells and a host system, with late stages of disease displaying prominent T cell involvement. Much research has focused on T cell trafficking and activation with the aim of developing agents as therapeutic approaches to squelch progression of GvHD. However, little is known about the very early cellular events of BMT-induced GvHD. This knowledge of dynamics of host-graft interactions over the early time window post-BMT will help identify other key cellular players involved in initiating GvHD and in modulating onset and progression of disease in the different host target organs.

We are only beginning to understand allogeneic BMT-induced GvHD at the level of molecular signaling pathways. For example, genetic experiments using knockout mouse models to modulate distinct T cell subsets have identified the Il-4 and Il-12 cytokine pathways—specifically, the two transcription factors STAT4 and STAT6—as important determinants of end-organ target damage (3) . A more recent study uses an immunosuppressant drug to demonstrate that intervention of the sphingosine 1-phosphate signaling pathway can modulate T cell homing to lymph nodes and delay progression of GvHD (4) . Since current clinical treatments of immunosuppressants and steroids are far from optimal, identification of other key effector signaling pathways associated with GvHD is required for successful drug intervention at different stages of BMT therapy.

The quest for a detailed understanding of mechanisms of eicosanoid lipid signaling pathways continues to provide useful avenues for preventative and therapeutic intervention of various inflammation-associated diseases (5 , 6) . Perhaps the most notable and enigmatic example is the effect of aspirin acetylation of Cox-2 protein on its ability to catalyze formation of potent lipid mediators (7 , 8) . For instance, acetylated-Cox2 catalyzes conversion of arachidonic acid to the aspirin-triggered lipoxin 15-epi-lipoxin A4. Rational design of stable synthetic mimetics, particularly 15-epi-16-(para-fluoro)-phenoxy-LXA4 (ATLa), has facilitated our understanding of lipoxin actions and biology (9) . Several groups have demonstrated in various cell types and tissues that ATLa can down-regulate proinflammatory signals (10) . However, the effects of ATLa are not simply anti-inflammatory. For instance, in human neutrophils, ATLa can trigger the genetic program of resolution by inducing expression of a protective gene cassette (11) . Recent pharmacogenetic studies using ATLa and transgenic mice expressing the human lipoxin A4 receptor (ALX) provide in vivo evidence for involvement of lipoxin A4-triggered signaling pathways in determining set-point of acute inflammation (12) . The dual role of ATLa as an anti-inflammatory and a proresolution synthetic analog render it an attractive chemical probe of the interplay between graft and host in developing GvHD.

This report uses our knowledge of the ATLa signaling system in a mouse model of allogeneic BMT-induced GvHD in lethally irradiated MHC-mismatched recipients to probe key early events in the progression of this multifactorial disease and to manipulate its complex pathophysiology. We demonstrate that a single prophylactic ATLa treatment of either host or donor is sufficient to delay GvHD-induced mortality. By using the ATLa chemical probe, we have unveiled a previously unrecognized impact of host neutrophils in the early phase post-BMT as important determinants in the dynamics of GvHD onset and progression.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
RT-PCR on BMCs
BMCs from BALB/c mice were prepared as described by Sykes et al. (3) . Cells (10x106) were treated with either 100 nM 15-epi-16-(para-fluoro)-phenoxy-LXA4 or control solvent (0.1% ethanol) in RPMI containing 6.25 mM HEPES (pH 7.2), Gentamicin, and 0.01 mg/mL DNase 1 at 37°C for 1 h. Samples were processed and analyzed by RT-PCR as described earlier (11) . Primers used in amplifications were 5'TGCTGACAAGAAGAGATGAG3' and 5'TCCTGGTTTCCACAGACTAC3' for NAB1; 5'CAGCTGGTTGTGCAGACAAAATG3' and 5'CATCCACAGCCCCCTCCTCA3' for ALX; 5'TCCACCACCGTGTTGCTGTAG3'; and 5'GACCACAGTCCATGACATCACT3' for GAPDH.

Induction and assessment of GvHD
The animal model used for BMT-induced GvHD was performed essentially as described by Sykes et al. (3) . Specific pathogen-free female C57BL/6 (H-2b, KbIbDb) and BALB/c (H-2d, KdIdDd) mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Briefly, recipient female mice were lethally irradiated (9.75 Gy, 137Cs source) and reconstituted within 4–8 h with an i.v. inoculum. In a typical experiment, mice (n of 8–10 mice per treatment group) received BMCs (5x106) and an increased dose of spleen cells (13x106). All syngenic controls received syngeneic C57BL/6 BMCs. Mice receiving GvHD-inducing inoculum were injected with MHC-mismatched BALB/c cells and no ATLa treatment (vehicle control), single prophylactic treatment of either host (i.v. 1 µg, ~50 µg/kg) or donor (100 ng/mL). Mice were monitored for up to 90 days for body weight and scored for clinical evidence of GvHD in skin, posture, inflammation of eyes, and diarrhea. Each parameter was quantified by scoring from 0 (normal) to 4 (severe) as described by Nikolic et al. (3) . Studies were conducted under protocol no. 2003N0003000, which was approved by the Massachusetts General Hospital IRB.

Histopathology
Tissues were harvested, immediately fixed in 10% formalin, and processed further at the Histology Core Facility, Children’s Hospital, Boston. Paraffin sections were stained with hematoxylin and eosin. For histological examination, slides were coded and systematically examined by a pathologist.

Flow cytometry
Bone marrow, peripheral blood, and spleen cells were prepared and analyzed by 2-color flow cytometry on a FACScan (Becton Dickinson, Franklin Lakes, NJ, USA) as described by Kim et al. (4) . To block nonspecific Fc{gamma}R binding of labeled antibodies, 2.4G2 (rat anti-mouse Fc{gamma}R mAb) was added to the first incubation. Granulocytic population was identified by a combination of Mac-1 epitope and forward light scatter while differentiating the host from donor cells based on expression of H2Dd stained with anti-H2Dd mAb 34-2-12 and H2Db stained with anti-H2Db mAb 5F1 (PharMingen, San Diego, CA, USA).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
As an effective probe of host and graft contributions to GvHD, ATLa must modulate both players of the system: the host organism and the donor BMCs. In previous reports using a murine peritonitis model, we demonstrated that 1 µg of ATLa (~50 µg/kg) administered i.v. is sufficient to modulate dynamics of host responses in acute inflammation (12) . We evaluated the ATLa signaling circuit in freshly isolated mouse BMCs by focusing on the ability of ATLa to trigger the early response of elevated NAB1 transcripts via an ALX-mediated pathway. Indeed, ALX receptor transcripts were detected in BALB/c BMCs by specific amplification of a ~1 kb cDNA product (Fig. 1 A). Semiquantitative RT-PCR analyses showed increased NAB1 transcripts upon stimulation by 100 nM ATLa (Fig. 1B, C ), demonstrating that the ATLa signaling circuit is present and functional in BMCs. Thus, ATLa can effectively modulate both graft and host systems.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. ALX pathway is present and active in BMCs. A) Isolated BMCs express lipoxin A4 receptor. RT-PCR reaction from BALB/c bone marrow cells showing amplified ~1 kb fragment of ALX. B) Structure of ATLa. C) ATLa triggers up-regulation of NAB1, an early response gene of the ATLa signaling pathway. Isolated BALB/c BMCs were incubated in the presence (+) or absence (–) of 100 nM ATLa. Semiquantitative RT-PCR reaction shows induced expression of NAB1 as measured by amplification of ~800 bp fragment. Lower panel shows levels of GAPDH standard in each incubation.

The mouse model used for BMT mimics the clinical process of irradiation followed by inoculum with hematopoietic cells (3) . All host female C57BL/6 mice were lethally irradiated (9.75 Gy). Mice were divided into four groups. In the syngeneic control group, hematopoietic rescue was achieved by reconstitution with syngeneic C57BL/6 bone marrow cells (5x106). In the reference group of GvHD mice (vehicle control), GvHD was induced by allogeneic inoculum of fully MHC-mismatched marrow (10x106) and spleen cells (13x106) from female BALB/c mice. To probe host contributions to GvHD, 1 µg ATLa was administered i.v. (~50 µg/kg) immediately prior to allogeneic inoculum. For donor cell effects, allogeneic inoculum was incubated with 100 ng/mL ATLa 5 min before cell transfer to the host. Since the experimental design was to probe early events of graft-host interactions, the drug regimen was simple and restricted to a single prophylactic administration of ATLa.

A definitive endpoint of chronic GvHD is death. As expected, mortality curves showed 100% survival of syngeneic BMT control group over the course of the experiment, and all mice receiving the allogeneic GvHD-inducing inoculum without any drug treatment died by day 58 post-BMT (Fig. 2 ). A single prophylactic ATLa treatment prolonged life for up to 90 days in both treatment groups, but systemic administration of ATLa to host was more efficient in delaying death than pretreatment of donor cells. Thus, giving the ATLa signal once (pre-BMT) manifests months later as protection against death.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. ATLa delays mortality in a mouse model for GvHD. Lethally irradiated C57BL/6 mice (n of 8–10 mice per treatment group) received BMCs (5x106) and an increased dose of spleen cells (13x106). All syngenic controls that received syngeneic C57BL/6 cells survived. Mice injected with fully MHC-mismatched BALB/c cells and no ATLa treatment (vehicle control) die from GvHD within 58 days. Single prophylactic treatment of host (i.v. 1 µg, ~50 µg/kg) or donor (100 ng/mL) prolongs life for up to 90 days. Result represents a single experiment done in triplicate.

We monitored the classic clinical symptoms associated with progression of GvHD. Mean weight of mice in the syngeneic group showed normal weight increases with age and was not markedly affected by the BMT (Fig. 3 A). Mice receiving the GvHD-inducing regimen (vehicle control group) displayed four expected phases of weight changes over time: a dramatic decrease of weight in the initial 10 days, followed by rapid recovery, then a small window of stability, and finally progressive weight loss until death. ATLa treatment affected neither the rate nor extent of initial phase of weight loss, but treatment effects were manifested in later days post-BMT. Notably, the mean weight changes of ATLa treatments were similar to each other until day 60, when the host-treated group started to consistently gain weight. We monitored overt symptoms associated with GvHD end-organ targets including diarrhea, skin lesions, and eye inflammation (Fig. 3B-D ). As expected, syngeneic controls show no adverse health symptoms whereas the GvHD-inducing inoculum resulted in all measured clinical symptoms. A single prophylactic administration of ATLa offered significant protection against all three symptoms. In skin lesion development, the degree of protection was similar irrespective of host or donor treatment (Fig. 3C ). ATLa did probe some differences between host and donor contributions that manifested over later stages of GvHD (~day 45–50 post-BMT). For example, systemic treatment of the host facilitated apparent resolution of eye inflammation and loss of diarrhea (Fig. 3B, D ), whereas treatment of donor cells did not. Taken together, these clinical indicators show that a single prophylactic treatment with ATLa is protective against symptoms of GvHD months post-BMT, and the degree of protection and end-organ affected are dependent on whether the host or the donor is triggered by ATLa.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Single prophylactic ATLa treatment protects against GvHD-induced clinical symptoms: differential effects on disease progression based on treatment of host vs. donor. Plots showing weight (A), diarrhea (B), skin lesions (C), and eye inflammation (D) on different treatment groups with time. Syngenic control group (shaded diamond), mice injected with fully MHC-mismatched BALB/c cells and no ATLa treatment (shaded triangles), ATLa treatment of donor (filled circles) and ATLa treatment of host (filled squares). Results correspond to the same experiment of mortality curve shown in Fig. 2 .

Since clinical symptoms identified days 45–50 as the key time window during the progression of GvHD for differentiating host vs. donor treatments, we evaluated relevant tissues more closely by histopathology. Mice were killed on day 45 post-BMT, organs were isolated, and stained paraffin sections were examined (Fig. 4 ). The intestines of syngeneic mice were apparently normal whereas GvHD-induced mice showed focal marked neutrophilic infiltrate with eosinophils in the mucosa, and infiltrate extending into the submucosa. There were signs of cryptitis and early cryptabcesses. When donor cells were treated with ATLa, mice displayed only focal mild mucosal infiltrate with some extension into the crypts. By contrast, ATLa treatment of the host displayed no significant pathological changes.



View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Degree of ATLa protection from leukocyte infiltration of end-organ targets is dependent on prophylactic treatment of host vs. donor. Histological sections of intestine (400x), skin (200x), and eyes (100x) stained with H&E from representative mice (45 days post-BMT) of the syngeneic group (A), untreated control group (B), and donor (C), and host (D) ATLa-treated. Tissue analyses and scoring of cellular infiltration were performed in a double-blind fashion.

The skin of syngeneic BMT control mice did not show significant pathological changes whereas GvHD inoculum resulted in a mild diffuse mixed inflammatory cell infiltrate and dermal edema. ATLa treatment of donor allogeneic inoculum indicated scant diffuse mixed dermal infiltrate extending into the subcutis; host treatment of ATLa showed no significant infiltration.

Histological examination of the eyes indicated no significant pathological changes in mice receiving syngeneic BMT. Mice treated with GvHD allogeneic inoculum showed mild subcorneal mixed infiltrates with eosinophils and focal areas of exocytosis of neutrophils into the corneal epithelium. The eyelid had marked diffuse neutrophilic infiltrate in the papillary dermis with exocytosis of neutrophils into the epidermis. The epidermis demonstrated scale crust with underlying small intraepidermal pustules with necrosis of some areas of the epithelium. Stimulation of donor inoculum with ATLa dampened effects on the eye. Histological sections displayed mild subcorneal neutrophilic infiltrate. The skin around the eye showed moderate to marked neutrophilic dermal diffuse infiltrate, with extension into the sebaceous glands and focal exocytosis of neutrophils into the epidermis. Although pustule formation was observed, no areas of necrosis were evident. By striking contrast, despite mild mixed inflammatory infiltrates observed in adjacent skin tissues, the single prophylactic ATLa treatment of the host was sufficient to protect the eye, resulting in no significant inflammatory infiltrate present on day 45 post-BMT.

Taken together, the histological data were consistent with the clinical indicators. More important, analyses of the sections provide insight at the tissue level, demonstrating that a single prophylactic administration of ATLa modulates degree of tissue infiltration by leukocytes, primarily neutrophils, on day 45 post-BMT and manifests as manipulation of progression of GvHD in a protective manner. Furthermore, the degree of cellular trafficking and protection of end-organ target pathology is different depending on whether the host or donor was stimulated with ATLa.

We next monitored neutrophils over the very early window of post-BMT (days 3 and 17), with particular emphasis on dynamics of replacement of host cells with donor cells in three relevant sites: bone marrow, spleen, and peripheral blood. Hematopoietic reconstitution of neutrophils was analyzed by 3-color flow cytometry, allowing identification of the granulocytic population by combination of Mac-1 epitope and forward light scatter while differentiating host from donor cells based on expression of donor-derived H2Dd MHC. In the absence of drug treatment, on day 3 post-BMT host PMN levels were low, representing 5% of PBCs, 16% of BMCs, and 36% of splenocytes (Fig. 5 A, left panel). ATLa treatment of donor cells or host recipient significantly increased PBC levels of host PMN by up to 10-fold. In contrast, BMC levels of host PMN were unaffected by ATLa treatment of donor cells, but systemic administration of ATLa to host resulted in a 2-fold increase. Spleen host PMN levels did not modulate upon ATLa drug treatment; levels were similar to untreated mice receiving the GvHD inoculum. The donor cell contribution to total PMN (% chimerism) in GvHD-induced mice on day 3 post-BMT was 53% in PBC, 6% in BMC and 57% in splenocytes (Fig. 5B , left panel). ATLa treatment of either host or donor displayed similar effects on % chimerism: treatments significantly decreased % chimerism in bone marrow and peripheral blood cell populations (6- and 3-fold, respectively), but drug treatment did not change % chimerism of splenocyte PMN.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. Differential effects of host vs. donor ATLa treatment on PMN dynamics during progression of GvHD. Cells isolated from peripheral blood, bone marrow, and spleen of untreated control group (unfilled bars), donor-treated group (filled bars), and host-treated group (striped bars) were examined by FACs analyses for % host PMN present in different tissues on day 3 post-BMT (A, left panel), total donor PMN on day 17 post-BMT (right panel), and % chimerism on day 3 post-BMT (B, left panel). On day 17 post-BMT, % chimerism was 100% (B, right panel). Data are presented as mean value ± SE obtained from different mice. A typical experiment has an n of 3. *Significantly different from untreated control GvHD group, P< 0.03.

On day 17 after inoculum of the GvHD-inducing regimen, only donor PMN cells are present (i.e., 100% chimerism), with PMN contributing to 86% of peripheral blood leukocytes, 61% of bone marrow cells, and 78% of splenocyte population (Fig. 5A , right panel). ATLa treatment did not significantly affect the levels on day 17; all treated mice showed 100% chimerism (Fig. 5B , right panel).

Since the FACs data showed a clear difference between host and donor ATLa at the level of bone marrow PMN populations on day 3 post-BMT, we asked simply whether this early event affects cellular dynamics in the bone marrow during the later stages of GvHD progression. Data from clinical and histology sections described above indicated day 45 post-BMT as a key point of diversion of differential host vs. graft ATLa. Thus, cellular dynamics were evaluated at tissue level by histological sections of femur bone from all treatment groups on day 45 post-BMT (Fig. 6 ). As expected, syngenic control mice showed normocellular bone marrow, with 50% cellularity. All cell lines were present, including visible lipid-laden cells. Mice receiving GvHD-inducing allogenic inoculum displayed hypercellularity of bone marrow. The 90% cellularity constituted a marked increase in neutrophils, with low levels of erythrocytes. By contrast, ATLa treatment of donor cells pre-BMT manifested in the bone marrow on day 45 post-BMT as 65% cellularity with all cells present and maturing, and an apparent left shift. Bone marrow sections from mice receiving ATLa systemically pre-BMT were comparable to syngenic mice. All cell lines were present and maturing, albeit with a mild hypercellularity of 60%.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 6. ATLa alters response of bone marrow to BMT. H&E staining of sections of bone marrow (100x) from representative mice (45 days post-BMT) of the syngeneic group (A), untreated control group (B), donor (C), and host (D) ATLa-treated groups. Double-blind analyses of sections were used to determine % cellularity (see text).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The aim of this study was to use single prophylactic administrations of a synthetic aspirin-triggered lipoxin A4 signal mimetic to probe dynamics of early host-donor interactions in a mouse model for the inflammation-associated multifactorial disease of allogeneic fully MHC-mismatched BMT-induced GvHD. Because lipoxin A4 signals not only anti-inflammation but also a reprogrammed fate associated with resolution, we tested the hypothesis that prophylactic treatment of ATLa modulates host and donor contributions to early events associated with progression of GvHD and these effects manifest at late stages of complex pathophysiology as a protection of end-organ targets.

Our results chart ATLa protective effects on allogeneic BMT-induced GvHD cellular dynamics over time. Although the ATLa was administered before BMT, no immediate overt signs of drug response were detected within the first 2 wk: early indicators of weight changes were similar to mice receiving GvHD inoculum without drug treatment. Directed FACs analyses monitoring replacement of host PMN with donor PMN indicate that the dynamics of this process is altered by ATLa and is sensitive to systemic treatment of host vs. pretreatment of donor cells prior to BMT. Drug treatment had no effect on the spleen, but ATLa treatments increased host PMN numbers in PBC and decreased % chimerism. Tangible differences were observed between host and donor effects of ATLa in BMCs, where systemic ATLa treatment increased host PMN but ATLa treatment of inoculum was not significantly different from the untreated group. The % chimerism, however, was lower in host and donor treated groups. Day 17, after weight loss recovery phase, neutrophils in both ATLa treatment groups were similar to untreated PBCs, BMCs, and spleen, with 100% donor chimerism. Day 45 post-BMT, the first overt signs of differential effects of host vs. donor treatments manifested, both being protective. Systemic protection apparently facilitated resolution of eye inflammation and loss of diarrhea. At a histological level, a marked difference in neutrophil infiltration of tissues was evident. The bone marrow also displayed significant differences in degree of hyperpolarity and tissue structure. These differences in the two treatment groups on day 45 post-BMT manifested as differences in weight changes 2 wk later, with systemically treated mice gaining weight. The final endpoint of disease progression leads to death, which is delayed by ~1 month in ATLa-treated mice. Morbidity curves were shifted to the right in both treatment groups, with systemic host treatment being more efficacious than treatment of inoculum.

A key early influence of a single prophylactic treatment with ATLa was altered dynamics of replacement of host PMN by donor cells, with host and donor treatment differences evident in the bone marrow. How might the single prophylactic exposure to ATLa modulate host PMN activity leading to such a dramatic effect in disease progression with protection that manifests months later? PMN play a primary role in adaptive response of host defense (13) . As part of their homeostatic function, these dynamic cells are actively involved in determining the fate and direction of an inflammatory response: from responding to initial inflammatory stimuli to amplifying the inflammatory reaction, to redirecting the inflammation to resolution. The multifaceted role of the neutrophil is facilitated in part by precise temporal regulation of responses to counterregulatory signals, which intersect at several levels in their signal transduction cascades but trigger precise signal-specific responses within seconds, minutes, hours, or days. For example, as part of its anti-inflammatory profile, ATLa signal inhibits proinflammatory responses to eicosanoid leukotriene B4 at several stages, such as O2 generation at the cell surface within seconds (14) or more downstream later events in the nucleus, including NF-{kappa}B-mediated transcription of proinflammatory cytokines (12) . This is particularly relevant for GvHD since the early hallmark of a cytokine storm of molecules, including TNF-{alpha}, is associated with disease (2) . Besides intersecting with the proinflammatory cascade, ATLa triggers a distinct genetic program that involves active redefinition of the neutrophil to a cell that can stimulate resolution—for instance, by altering cytokine-chemokine axis (12 , 14) . The half-life of ATLa in the blood is ~3.5 min (15) , and our data indicate that a single prophylactic treatment can protect against a multifactorial complex disease with effects that manifests months later. Thus, the key to success of ATLa protection against GvHD must in part be inherent in its duality as an agent that stimulates anti-inflammation and redefines the neutrophil to a "resolution state."

Compared with ATLa treatment of donor cells, systemic treatment of host indicated not only enhanced protection as measured by delayed death, but also had differential effects on end-organ targets. This is consistent with earlier studies from several research groups demonstrating that ATLa affects a variety of cell types (9) . While many effects have been well characterized in neutrophils, we are beginning to appreciate how ATLa impacts function of several immune effector cell types (e.g., eosinophils, monocytes, lymphocytes, and dendritic cells) and nonmyeloid cell types (e.g., fibroblasts and epithelial cells). Clearly, a better understanding at the molecular signaling level is needed to understand how ATLa affords protection in several organs like the gastrointestinal tract (16 , 17) , pulmonary (18) , and renal systems (19) . Particularly intriguing are our findings that a prophylactic systemic dose of ATLa facilitates resolution of eye inflammation and loss of diarrhea 60 days later. Further analyses on cell- and tissue-specific responses to ATLa will facilitate intervention of the complex cellular and molecular dynamics leading to GvHD.

By virtue of its ability to bind and activate the lipoxin A4 receptor ALX, most studies use ATLa as a synthetic mimetic of two endogenous enzymatically produced products of arachidonic acid: 15-epi-LXA4 generated by aspirin-triggered COX-2 and 15-(S)-LXA4 generated by sequential lipoxygenase reactions primarily in transcellular synthesis (20) . It is noteworthy that the ATLa signaling pathway also influences generation of other eicosanoid messengers. For example, in a mouse model of asthma, ATLa affects production of prostanoids and leukotrienes (18) . In a transgenic mouse model, myeloid-selective expression of the human ALX triggers redefinition of the lipoxygenase axes (12) . ALX pathway intersects with the steroid glucocorticoid pathway at several levels; both agents can up-regulate NAB1, a nuclear corepressor that serves as an "off" switch for the EGR-1-responsive expression of proinflammatory genes in many cell systems (11) . More recently, Perretti et al. reported that a fragment of annexin 1, a glucocorticoid response gene, can stimulate ALX (21) . This is of particular interest since glucocorticoids are still the most effective anti-inflammatory drugs in clinical therapy of GvHD, but side effects remain an obstacle. Perhaps further exploration on the nature of ALX as a receptor for both peptides and lipids will offer additional avenues of therapeutic potential.

Eicosanoid mimetics and modulators of their signaling pathways are useful tools to probe for dynamic mechanisms behind the onset and progression of multifactorial inflammatory diseases, like GvHD, where simple prophylactic administration of a signal alters complex pathophysiology of disease months later. The results presented here provide the intriguing prospect that a dual-edged agent that acts as an anti-inflammatory as well as a trigger of the resolution program in neutrophils can dynamically regulate the early phase post-BMT and protect against disease progression.


   ACKNOWLEDGMENTS
 
This work was supported in part by National Institutes of Health grants GM38765 (C.N.S.), K01-AR02219 (P.R.D), K08-DK59919 (B.N.), and P01-DK50305 (M.A.A. and C.N.S.). B.N. is the recipient of an ASN/AST John Merrill Transplant Scholar Grant. We thank Mary H. Small for expert assistance in the preparation of this manuscript.

Received for publication July 19, 2004. Accepted for publication September 29, 2004.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Nikolic, B., Sykes, M. (1997) Bone marrow chimerism and transplantation tolerance. Curr. Opin. Immunol. 9,634-640[CrossRef][Medline]
  2. Blazar, B. R., Korngold, R., Vallera, D. A. (1997) Recent advances in graft-versus-host disease (GVHD) prevention. Immunol. Rev. 157,79-109[CrossRef][Medline]
  3. Nikolic, B., Lee, S., Bronson, R. T., Grusby, M. J., Sykes, M. (2000) Th1 and Th2 mediate acute graft-versus-host disease, each with distinct end-organ targets. J. Clin. Invest. 105,1289-1298[Medline]
  4. Kim, Y. M., Sachs, T., Asavaroengchai, W., Bronson, R., Sykes, M. (2003) Graft-versus-host disease can be separated from graft-versus-lymphoma effects by control of lymphocyte trafficking with FTY720. J. Clin. Invest. 111,659-669[CrossRef][Medline]
  5. Funk, C. D. (2001) Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 294,1871-1875[Abstract/Free Full Text]
  6. Kersten, S., Desvergne, B., Wahli, W. (2000) Roles of PPARs in health and disease. Nature (London) 405,421-424[CrossRef][Medline]
  7. FitzGerald, G. A. (2003) COX-2 and beyond: approaches to prostaglandin inhibition in human disease. Nat. Rev. Drug Discov. 2,879-890[CrossRef][Medline]
  8. Serhan, C. N., Hong, S., Gronert, K., Colgan, S. P., Devchand, P. R., Mirick, G., Moussignac, R.-L. (2002) Resolvins: a family of bioactive products of omega-3 fatty acid transformation circuits initiated by aspirin treatment that counter pro-inflammation signals. J. Exp. Med. 196,1025-1037[Abstract/Free Full Text]
  9. McMahon, B., Mitchell, S., Brady, H. R., Godson, C. (2001) Lipoxins: revelations on resolution. Trends Pharmacol. Sci. 22,391-395[CrossRef][Medline]
  10. Wallace, J. L., Fiorucci, S. (2003) A magic bullet for mucosal protection... and aspirin is the trigger!. Trends Pharmacol. Sci. 24,323-326[CrossRef][Medline]
  11. Qiu, F.-H., Devchand, P. R., Wada, K., Serhan, C. N. (2001) Aspirin-triggered lipoxin A4 and lipoxin A4 up-regulate transcriptional corepressor NAB1 in human neutrophils. FASEB J. 15,2736-2738[Free Full Text]
  12. Devchand, P. R., Arita, M., Hong, S., Bannenberg, G., Moussignac, R.-L., Gronert, K., Serhan, C. N. (2003) Human ALX receptor regulates neutrophil recruitment in transgenic mice: roles in inflammation and host defense. FASEB J. 17,652-659[Abstract/Free Full Text]
  13. Nathan, C. (2002) Points of control in inflammation. Nature (London) 420,846-852[CrossRef][Medline]
  14. Hachicha, M., Pouliot, M., Petasis, N. A., Serhan, C. N. (1999) Lipoxin (LX)A4 and aspirin-triggered 15-epi-LXA4 inhibit tumor necrosis factor 1{alpha}-initiated neutrophil responses and trafficking: regulators of a cytokine-chemokine axis. J. Exp. Med. 189,1923-1929[Abstract/Free Full Text]
  15. Clish, C. B., O’Brien, J. A., Gronert, K., Stahl, G. L., Petasis, N. A., Serhan, C. N. (1999) Local and systemic delivery of a stable aspirin-triggered lipoxin prevents neutrophil recruitment in vivo. Proc. Natl. Acad. Sci. USA 96,8247-8252[Abstract/Free Full Text]
  16. Souza, M. H., de Lima, O. M., Jr, Zamuner, S. R., Fiorucci, S., Wallace, J. L. (2003) Gastritis increases resistance to aspirin-induced mucosal injury via COX-2-mediated lipoxin synthesis. Am. J. Physiol. 285,G54-G61
  17. Gewirtz, A. T., Collier-Hyams, L. S., Young, A. N., Kucharzik, T., Guilford, W. J., Parkinson, J. F., Williams, I. R., Neish, A. S., Madara, J. L. (2002) Lipoxin A4 analogs attenuate induction of intestinal epithelial proinflammatory gene expression and reduce the severity of dextran sodium sulfate-induced colitis. J. Immunol. 168,5260-5267[Abstract/Free Full Text]
  18. Levy, B. D., De Sanctis, G. T., Devchand, P. R., Kim, E., Ackerman, K., Schmidt, B. A., Szczeklik, W., Drazen, J. M., Serhan, C. N. (2002) Multi-pronged inhibition of airway hyper-responsiveness and inflammation by lipoxin A4. Nat. Med. 8,1018-1023[CrossRef][Medline]
  19. Leonard, M. O., Hannan, K., Burne, M. J., Lappin, D. W., Doran, P., Coleman, P., Stenson, C., Taylor, C. T., Daniels, F., Godson, C., et al (2002) 15-epi-16-(para-fluorophenoxy)-lipoxin A4-methyl ester, a synthetic analogue of 15-epi-lipoxin A4, is protective in experimental ischemic acute renal failure. J. Am. Soc. Nephrol. 13,1657-1662[Abstract/Free Full Text]
  20. Serhan, C. N. (1994) Lipoxin biosynthesis and its impact in inflammatory and vascular events. Biochim. Biophys. Acta 1212,1-25[Medline]
  21. Perretti, M., Flower, R. J. (2004) Annexin 1 and the biology of the neutrophil. J. Leukoc. Biol. 76,25-29[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
N. Chiang, C. N. Serhan, S.-E. Dahlen, J. M. Drazen, D. W. P. Hay, G. E. Rovati, T. Shimizu, T. Yokomizo, and C. Brink
The Lipoxin Receptor ALX: Potent Ligand-Specific and Stereoselective Actions in Vivo
Pharmacol. Rev., September 1, 2006; 58(3): 463 - 487.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devchand, P. R.
Right arrow Articles by Nikolic, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devchand, P. R.
Right arrow Articles by Nikolic, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS