|
|
||||||||

* Department of Nutrition, School of Public Health and School of Medicine,
Department of Radiology, School of Medicine, University of North Carolina at Chapel Hill, North Carolina, USA
1Correspondence: School of Public Health, CB #7461, McGavran-Greenberg Building, The University of North Carolina, Chapel Hill, NC 27599-7461, USA. E-mail: steven_zeisel{at}unc.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: choline liver function single nucleotide polymorphism (SNP) nonalcoholic fatty liver disease pregnancy NTD transfection site-directed mutagenesis
| INTRODUCTION |
|---|
|
|
|---|
30% of phosphatidylcholine formed in liver, the remainder being formed from preexisting choline moiety via an alternative pathway (11)| MATERIALS AND METHODS |
|---|
|
|
|---|
PEMT activity assay
Liver homogenate or total particulate fraction from McArdle-RH7777 cells were assayed for PEMT activity using a modified method of Ridgway and Vance (17
, 18)
. Briefly, PEMT activity was assayed using 50 µg of protein in 125 mM Tris-HCl (pH 9.2; Mallincrodt, Paris, KY, USA) and 5 mM DTT buffer (Sigma, St. Louis, MO, USA) in the presence of 200 µM S-adenosyl-L-methionine containing 0.5 µCi of S-adenosyl-L-methionine (55.70 Ci/mmol; Amersham Biosciences, Piscataway, NJ, USA) and 0.4 mM exogenous phosphatidyldimethylethanolamine (P2, Avanti Polar-lipids, Inc., Alabaster, AL, USA). The reaction was carried out for 30 min at 37°C and stopped by addition of chloroform/methanol/hydrochloric acid mixture (100:50:1, v/v). An aliquot of the chloroform phase was applied to a silica gel thin-layer chromatography plate [Si250-PA (19C)-Silica Gel, Baker, Inc., Phillipsburg, NJ] and developed in chloroform: methanol: acetic acid: water (50:30:5:2, v/v). Disintegrations per minute from [3H]-PtdCho were determined in bands that comigrated with authentic standards using liquid scintillation spectrophotometry (Wallac 1410, Pharmacia LKB Nuclear Inc., Gaithersburg, MD, USA).
PEMT protein expression assay
Proteins (25 µg) were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Amersham Biosciences), which was probed with anti-FLAG M2 antibody (Sigma), washed extensively with 1x PBS (Gibco) containing 0.1% Tween 20 (Sigma), then probed with horseradish peroxidase-conjugated goat anti-mouse IgG (Pierce, Rockford, IL, USA). PEMT-FLAG protein was visualized by a reaction with Supersignal chemiluminescent substrate (Pierce) and exposed to X-ray film (Denville Scientific, Metuchen, NJ, USA). The film was scanned and the integrated optical densities of the bands were measured using the ScionImage software (Scion Corporation, Frederick, MD, USA).
Recombinant plasmid construction/site-directed mutagenesis
Total RNA was extracted from an adult white male humans liver using Trizol (Life Technologies Inc., Rockville, MD, USA) according to the manufacturers instructions. Total RNA (3 µg) treated with RNase-free DNase I (Life Technologies Inc.) was reverse transcribed using an 18 mer oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen) per the manufacturers instructions. The oligonucleotide (5'MluI PEMT) TAACACGCGTAGTTATGACCCGGCTGCTGGGCTA was used as the 5' primer; the oligonucleotide ATCATCATCCTTGTAGTCGAGCACGACGAAGCTGAGAATGTA (3' PEMT-WT), which adds 19 nucleotides encoding the FLAG epitope (DYKDDDDK), was used as the 3' primer. The PCR product was subcloned into Nhe1 and Mlu1 multicloning sites of mammalian expression vector pBI-EGFP-tet (Clontech, Palo Alto, CA, USA), a bidirectional response plasmid that allows simultaneous expression of both EGFP and PEMT-FLAG under the control of a single tetracycline (doxycycline) -responsive element. With PEMT-WT as the template, site-directed mutagenesis was conducted using GeneTailorTM Site-Directed Mutagenesis System per manufacturers instructions (Invitrogen). Oligonucleotides 5'TGGTGGCCCTCACCTACATAGTGGCTCTCCTATA3' and 5' TATGTAGGTGAGGGCCACCAGCACCGTCAG3' were the forward and reverse primers to introduce the M175V mutation (we later realized that V175M is the SNP and V at 175 is the WT, and data analysis was performed accordingly; see Discussion).
Human liver specimens
Forty human liver samples were obtained from the Liver Procurement and Distribution System (LTPADS) (University of Minnesota, Minneapolis MN, USA; funded by NIH contract N01 DK92310). Of these 40 subjects, 28 had fatty liver and 12 had normal livers. Synopses of tissue donors medical histories, including pathologists impression diagnosis on liver fat content, were obtained. The specimens were snap-frozen once removed from the organ donors, delivered on dry ice, and stored at 80°C until analysis.
Normal human blood collection
Forty-seven healthy volunteers were recruited for a protocol approved by the Institutional Review Board at the University of North Carolina at Chapel Hill. These individuals consumed a diet adequate in choline content and had no liver disease by review of medical history, serum liver function tests (bilirubin, alanine aminotransferase, aspartate aminotransferase, creatine phosphokinase,
-glutamyl transpeptidase, lactic dehydrogenase, alkaline phosphatase, prothrombin time, partial thromboplastin time, and albumin), and did not have fatty liver as assessed by magnetic resonance imaging of liver (see below). Blood samples were obtained by venipuncture and peripheral lymphocytes isolated by Ficoll-Hypaque gradient using Vacutainer® CPTTM tubes with sodium citrate (Becton Dickinson, Franklin Lakes, NJ, USA) (19
, 20)
and prepared for SNP analyses as described below.
Magnetic resonance imaging of liver
Changes in relative hepatic fat levels were determined using a modified "In and Out of Phase" magnetic resonance imaging (MRI) technique of Dixon (21
22
23)
using a Siemens Vision 1.5T clinical MR system. Briefly, quantification of fat within the liver using MRI is possible because of the resonant frequency differences between fat and water. The resonant frequency differences in fat and water are reflected in the transverse magnetization changes and signal intensity changes at particular time intervals. Using a "breath-hold" fast field echo sequence (FLASH; TE=2.2 ms and 4.5 ms, with a flip angle of 80° and TR=140 ms) at an echo time of 2.2 ms (TE), MRI signals from water and fat will be 180° out-of-phase with each other; at a TE = 4.5 ms the signals from fat and water will be in-phase with each other. MR images obtained from the in-phase and the out-of phase can then be processed to derive the fat fraction from the differences in the MR image pixel intensity values. Serial FLASH MRI studies using a TE = 2.2 and 4.5 ms were performed on subjects. The MR image sets were processed to determine the fat fraction in the liver using software provided by Siemens Medical Solutions (Malvern, PA, USA). Five liver slices in each subject were analyzed and compared with the fat fraction found in the spleen. Relative changes in the levels of fat and water were monitored using a localized single volume proton magnetic resonance spectroscopy technique (PRESS; TE=135, TR=1500 ms) (24)
.
Genomic DNA extraction
Genomic DNA was extracted from liver tissues using TriZol (Life Technologies Inc.) and from peripheral lymphocytes using PureGene (Gentra Systems, Minneapolis, MN, USA) according to the manufacturers instructions.
SNP detection
DNA sequencing was performed on double-stranded DNA templates obtained from genomic DNA by PCR amplification. Exon 8 of PEMT was amplified with the oligonucleotides 5'GGAGCACTTTGCCCCAGAATC3' and 5'GACTTGGAGCCTTCAGAGCG3' as forward and reverse primers, respectively. PCR products were purified with QIAquick® PCR Purification Kit 250 (QIAGEN Inc., Valencia, CA, USA) according to the manufacturers instructions. Sequencing reactions were performed by the University of North Carolina at Chapel Hill Genome Analysis Facility, using a capillary sequencing machine (model 3100, Applied Biosystems, Foster City, CA, USA). The sequences obtained were compared with ones stored in the NCBI database (http://www.ncbi.nlm.nih.gov/entrez/, accession number AF294467) using ClustalW multiple sequence alignment software (http://www.ebi.ac.uk/Tools/sequence.html). Sequence homology identity was determined in accordance with criteria as described previously (25)
.
Statistics
All data are presented as mean ± standard error of the mean. Differences in the prevalences of V175M polymorphic genotypes in normal controls and patients with NAFLD were tested with Fishers exact test (26)
. PEMT activity data were analyzed using 1-way ANOVA (27)
.
| RESULTS |
|---|
|
|
|---|
|
Subject demographics
In patients with NAFLD (n=28; all confirmed as NAFLD from liver biopsy specimens with appropriate history), there were 12 males and 16 females, age range was 577 years (mean 51±3 years), with 23 Caucasians, 2 African Americans, 1 Hispanic, and 1 Asian (ethnicity not known for 1 subject); body mass indices ranged from 18.4 to 48.5 (mean 30±1.4 units; BMI unknown for 2 subjects). In control subjects (n=59; 12 confirmed normal from liver biopsy specimens and 47 confirmed as having normal liver by MRI), there were 30 males and 29 females, age range was 572 years (mean 37.1±2.1 years), with 37 Caucasians and 14 African Americans, 3 Hispanics, 3 Asians, 1 Native American, and 1 Trinidadian. Body mass indices ranged from 15.3 to 33 (mean 24.7±0.5 units) in the controls.
SNP detection
The V175M (G to A substitution) polymorphism in PEMT was differentially distributed in controls and NAFLD patients. Allele frequency for G and A was 0.19 and 0.81, respectively in 28 NAFLD patients; among 59 normal controls, they were 0.39 and 0.61, respectively. The frequencies of the three genotypes among patients were GG (Val/Val) 7.1%, GA (Val/Met) 25%, and AA (Met/Met) 67.9%. Frequencies of the three genotypes among normal controls were GG, 18.6%, GA, 40.7%, and AA, 40.7%. (Table 1
). Almost twice as many controls had the GG and GA genotype than did the NAFLD patients, whereas the AA genotype was overrepresented in the NAFLD patients compared with the normal controls (P=0.02 by 2-tailed Fischers exact test). We observed no significant sexual dimorphism in this distribution. The observed distribution of the V175 and M175 alleles is similar to that previously reported in the public SNP databases.
|
| DISCUSSION |
|---|
|
|
|---|
A in exon 8 of the PEMT gene in humans; results in a V175M substitution in the encoded protein) that occurs more frequently in patients with NAFLD. This SNP was previously detected in humans in a Japanese population, but no functional significance was attributed to it (16)
The mechanism whereby a loss of function SNP in PEMT might be associated with NAFLD involves the role of this enzyme in lipoprotein secretion from liver. Triacylglycerol is formed in the liver, then secreted in VLDL. Synthesis of new phosphatidylcholine molecules is required for VLDL formation; when they are not available, fat droplets accumulate in the cytosol of liver cells (6
, 7
, 29)
. When the diet is deficient in choline (4
, 8
, 30)
or when PEMT activity is inhibited or deleted (12
, 13
, 15
, 29)
, fatty liver ensues.
In the literature, the sequence for human PEMT was originally reported to contain a methionine at residue 175 (GenBankTM accession number AAK19172; however, in later reports on human PEMT and in the reported sequence for mouse, rat, and cow (GenBankTM accession numbers are NP_009100, AAH26796 Q08388, and AAQ01191 respectively), PEMT contains a valine at this residue (Table 2
). Therefore, we argue that in evolution the earliest sequence for PEMT contains a valine at this position and that the mutation to encode a methionine is the genetic polymorphism.
|
We realize our observation is derived from a small study and that the group of NAFLD patients was drawn from a national pool whereas many of our control subjects were recruited in North Carolina. The demographics of the two groups were similar, though average BMI was higher in the NAFLD group. Since high BMI can increase incidence of fatty liver, it is possible that the PEMT SNP we report is somehow associated with factors that increase BMI. However, it is unlikely this is the sole reason that this SNP is associated with risk for NAFLD.
The relatively common occurrence of this loss of function SNP (81% of controls and 93% of NAFLD have at least one allele) suggests that it provides some evolutionary advantage to humans. We previously reported (31)
that mice in which this gene is deleted have excess S-adenosylmethionine available for methylation reactions because PEMT activity uses an appreciable portion of available methyl groups for formation of choline. Perhaps when humans eat enough choline in their diet, the V175M SNP is beneficial because it reduces waste of methyl-groups for making choline moiety. Sometimes a SNP is selected for because it protects against disease (32)
. Human erythrocytes infected with Plasmodium develop new pathways for accumulating choline from plasma (33)
. Up to 45% of the malaria parasite is composed of phosphatidylcholine and the malaria parasite actively accumulates choline from its host (34)
. Finally, there is a clear correlation between antimalarial activity of some drugs and their ability to inhibit choline uptake into the parasite (35)
. Perhaps the V175M SNP we describe diminishes the availability of choline in the human host and thereby impairs the replication of the malaria parasite. Whatever the reason, it is interesting that the V175M SNP is so prevalent in humans.
The incidence of NAFLD is lower in premenopausal women than in men or postmenopausal women (36)
. This would be consistent with our hypothesis that low PEMT activity is a risk factor for developing NAFLD. Female rats are less likely to develop fatty liver when fed choline-deficient diets than are male rats (37)
, because females have greater capacity to form the choline moiety de novo via PEMT pathway in liver. It is estimated that female rats have 1050% more PEMT activity than do males (38
, 39)
. A womans capacity to form the choline moiety de novo may be highest before menopause because estrogens increase PEMT activity in humans (40)
and in castrated-rats (41)
. Thus, premenopausal women may be less sensitive to a loss of function SNP in PEMT because they have excess PEMT activity compared with men or postmenopausal women.
The requirement for choline (from diet or from PEMT synthesis) is spared in part by the availability of methyl groups from 1-carbon metabolism (via methyltetrahydrofolate) (42)
. It is possible that the PEMT SNP we describe will interact with other commonly known SNPs in humans. For example, the thermolabile variant (677C
T) of 5,10-methylenetetrahydrofolate reductase (MTHFR, E.C. 1.5.1.20) occurs in 1530% of humans (43)
. We found that mice in which MTHFR was deleted develop fatty liver, which resolves when mice are fed the choline metabolite betaine (43)
. These mice require more choline or betaine because homocysteine remethylation to methionine, in the absence of 1-carbon units via the folate pathway, shifts to a pathway that uses choline as a precursor. Homocysteine can be remethylated to methionine by methionine synthase using 5-methylfolate supplied by MTHFR (43)
. Alternatively, betaine:homocysteine methyltransferase (BHMT, EC 2.1.1.5) catalyzes a methyl transfer from betaine to homocysteine (43)
. When 5-methylfolate is not available, more betaine is required. Thus, humans who have diminished capacity to synthesize choline moiety via PEMT activity and diminished capacity to form 5-methylfolate will have difficulty producing increased betaine from choline when it is needed for homocysteine methylation.
We studied a relatively small number of subjects (28 with NAFLD and 59 controls); it would be valuable to characterize this SNP in larger populations. It would also be useful to determine whether diets high in choline reduce hepatic steatosis in humans with this SNP. We recently published data on choline content of foods (44)
, and the U.S. Department of Agriculture maintains an updated food composition table online (http://www.nal.usda.gov/fnic/foodcomp/Data/Choline/Choline.html). We are currently examining whether there are other loss of function SNPs in the PEMT gene.
| ACKNOWLEDGMENTS |
|---|
Received for publication December 29, 2004. Accepted for publication February 24, 2005.
| REFERENCES |
|---|
|
|
|---|
Related Articles
This article has been cited by other articles:
![]() |
K.-A. da Costa, K. S. Rai, C. N. Craciunescu, K. Parikh, M. G. Mehedint, L. M. Sanders, A. McLean-Pottinger, and S. H. Zeisel Dietary Docosahexaenoic Acid Supplementation Modulates Hippocampal Development in the Pemt-/- Mouse J. Biol. Chem., January 8, 2010; 285(2): 1008 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Caudill, N. Dellschaft, C. Solis, S. Hinkis, A. A. Ivanov, S. Nash-Barboza, K. E. Randall, B. Jackson, G. N. Solomita, and F. Vermeylen Choline Intake, Plasma Riboflavin, and the Phosphatidylethanolamine N-Methyltransferase G5465A Genotype Predict Plasma Homocysteine in Folate-Deplete Mexican-American Men with the Methylenetetrahydrofolate Reductase 677TT Genotype J. Nutr., April 1, 2009; 139(4): 727 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stefan, K. Kantartzis, and H.-U. Haring Causes and Metabolic Consequences of Fatty Liver Endocr. Rev., December 1, 2008; 29(7): 939 - 960. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, M. D. Gammon, S. H. Zeisel, Y. L. Lee, J. G. Wetmur, S. L. Teitelbaum, P. T. Bradshaw, A. I. Neugut, R. M. Santella, and J. Chen Choline metabolism and risk of breast cancer in a population-based study FASEB J, June 1, 2008; 22(6): 2045 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Vance, Z. Li, and R. L. Jacobs Hepatic Phosphatidylethanolamine N-Methyltransferase, Unexpected Roles in Animal Biochemistry and Physiology J. Biol. Chem., November 16, 2007; 282(46): 33237 - 33241. [Full Text] [PDF] |
||||
![]() |
S. Romeo, J. C. Cohen, and H. H. Hobbs No association between polymorphism in PEMT (V175M) and hepatic triglyceride content in the Dallas Heart Study FASEB J, October 1, 2006; 20(12): 2180 - 2180. [Full Text] [PDF] |
||||
![]() |
S. H. Zeisel People with fatty liver are more likely to have the PEMT rs7946 SNP, yet populations with the mutant allele do not have fatty liver FASEB J, October 1, 2006; 20(12): 2181 - 2182. [Full Text] [PDF] |
||||
![]() |
K.-A. da Costa, O. G. Kozyreva, J. Song, J. A. Galanko, L. M. Fischer, and S. H. Zeisel Common genetic polymorphisms affect the human requirement for the nutrient choline FASEB J, July 1, 2006; 20(9): 1336 - 1344. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Fukagawa Sparing of Methionine Requirements: Evaluation of Human Data Takes Sulfur Amino Acids Beyond Protein J. Nutr., June 1, 2006; 136(6): 1676S - 1681S. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |