FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J.
Right arrow Articles by Zeisel, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J.
Right arrow Articles by Zeisel, S. H.
(The FASEB Journal. 2005;19:1266-1271.)
© 2005 FASEB

Polymorphism of the PEMT gene and susceptibility to nonalcoholic fatty liver disease (NAFLD)

Jiannan Song*, Kerry Ann da Costa*, Leslie M. Fischer*, Martin Kohlmeier*, Lester Kwock{dagger}, Shuli Wang* and Steven H. Zeisel*,1

* Department of Nutrition, School of Public Health and School of Medicine,
{dagger} Department of Radiology, School of Medicine, University of North Carolina at Chapel Hill, North Carolina, USA

1Correspondence: School of Public Health, CB #7461, McGavran-Greenberg Building, The University of North Carolina, Chapel Hill, NC 27599-7461, USA. E-mail: steven_zeisel{at}unc.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Phosphatidylethanolamine N-methyltransferase (PEMT) catalyzes phosphatidylcholine synthesis. PEMT knockout mice have fatty livers, and it is possible that, in humans, nonalcoholic fatty liver disease (NAFLD) might be associated with PEMT gene polymorphisms. DNA samples from 59 humans without fatty liver and from 28 humans with NAFLD were genotyped for a single nucleotide polymorphism in exon 8 of PEMT, which leads to a V175M substitution. V175M is a loss of function mutation, as determined by transiently transfecting McArdle-RH7777 cells with constructs of wild-type PEMT open reading frame or the V175M mutant. Met/Met at residue 175 (loss of function SNP) occurred in 67.9% of the NAFLD subjects and in only 40.7% of control subjects (P<0.03). For the first time we report that a polymorphism of the human PEMT gene (V175M) is associated with diminished activity and may confer susceptibility to NAFLD.—Song, J., da Costa, K. A., Fischer, L. M., Kohlmeier, M., Kwock, L., Wang, S., Zeisel, S. H. Polymorphism of the PEMT gene and susceptibility to nonalcoholic fatty liver disease (NAFLD).


Key Words: choline • liver function • single nucleotide polymorphism (SNP) • nonalcoholic fatty liver disease pregnancy • NTD • transfection • site-directed mutagenesis


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NONALCOHOLIC FATTY LIVER DISEASE (NAFLD) is the most common reason for abnormal liver function, and may occur in as much as 25% of the population (1) . NAFLD can progress to liver cell necrosis, fibrosis, and cirrhosis of the liver (1) . The mechanisms underlying NAFLD are not well understood. Obesity, diabetes, and hypertriglyceridemia are predictive risk factors but it can appear in humans who are otherwise normal (2 , 3) . Humans ingesting diets deficient in the nutrient choline develop fatty liver (4 , 5) because phosphatidylcholine is required for hepatic secretion of triacylglycerol in very low density lipoproteins (VLDL) (6 7 8) . Phosphatidylethanolamine N-methyltransferase (PEMT; EC 2.1.1.17) catalyzes de novo synthesis of phosphatidylcholine in liver (9 , 10) and is responsible for ~30% of phosphatidylcholine formed in liver, the remainder being formed from preexisting choline moiety via an alternative pathway (11) . PEMT knockout mice do not express any PEMT activity in liver and depend completely on dietary choline intake to meet daily choline requirements (12 , 13) . When fed a diet deficient in choline, they develop severe fatty liver; a choline-supplemented diet prevents this (14) and can reverse hepatic damage if begun early enough (15) . The PEMT gene is highly polymorphic; 98 single-nucleotide polymorphisms (SNPs) in PEMT were found in 48 Japanese individuals (16) . It is possible that some of these SNPs have functional significance and, if so, could make humans susceptible to fatty liver when dietary intake of choline is low. We identified a variant that resulted in an amino acid substitution (V175M) and report for the first time this SNP results in partial loss of activity of encoded PEMT and that this SNP occurs 1.7-fold as frequently in humans with NAFLD as in normal controls.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture and transient transfection
McArdle RH-7777 rat hepatoma cells (American Type Culture Collection, Manassas, VA, USA) were maintained in Dulbecco’s modified Eagle’s medium/F12 (DMEM/F12; Gibco-BRL Rockville, MD, USA), 10% horse serum, 10% fetal bovine serum, 100 units/mL penicillin (Gibco-BRL), and 100 µg/mL streptomycin sulfate (Gibco-BRL) at 37°C under 5% CO2. On day 0, cells were plated at a density of 1.5 x 106 cells/60 mm dish. When cells reached 70% confluence they were transfected with test plasmids or mock transfected with empty expression vector using Lipofectamine (Invitrogen, Carlsbad, CA, USA) per the manufacturer’s protocol. 24 h post-transfection, the expression of enhanced green fluorescent protein (EGFP) was observed under a green fluorescent microscope and the transfection efficiency was calculated based on fluorescence intensity; 48 h later, cells were harvested and total cellular homogenate and total particulate fraction were prepared for protein assay and enzyme activity analysis.

PEMT activity assay
Liver homogenate or total particulate fraction from McArdle-RH7777 cells were assayed for PEMT activity using a modified method of Ridgway and Vance (17 , 18) . Briefly, PEMT activity was assayed using 50 µg of protein in 125 mM Tris-HCl (pH 9.2; Mallincrodt, Paris, KY, USA) and 5 mM DTT buffer (Sigma, St. Louis, MO, USA) in the presence of 200 µM S-adenosyl-L-methionine containing 0.5 µCi of S-adenosyl-L-methionine (55.70 Ci/mmol; Amersham Biosciences, Piscataway, NJ, USA) and 0.4 mM exogenous phosphatidyldimethylethanolamine (P2, Avanti Polar-lipids, Inc., Alabaster, AL, USA). The reaction was carried out for 30 min at 37°C and stopped by addition of chloroform/methanol/hydrochloric acid mixture (100:50:1, v/v). An aliquot of the chloroform phase was applied to a silica gel thin-layer chromatography plate [Si250-PA (19C)-Silica Gel, Baker, Inc., Phillipsburg, NJ] and developed in chloroform: methanol: acetic acid: water (50:30:5:2, v/v). Disintegrations per minute from [3H]-PtdCho were determined in bands that comigrated with authentic standards using liquid scintillation spectrophotometry (Wallac 1410, Pharmacia LKB Nuclear Inc., Gaithersburg, MD, USA).

PEMT protein expression assay
Proteins (25 µg) were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Amersham Biosciences), which was probed with anti-FLAG M2 antibody (Sigma), washed extensively with 1x PBS (Gibco) containing 0.1% Tween 20 (Sigma), then probed with horseradish peroxidase-conjugated goat anti-mouse IgG (Pierce, Rockford, IL, USA). PEMT-FLAG protein was visualized by a reaction with Supersignal chemiluminescent substrate (Pierce) and exposed to X-ray film (Denville Scientific, Metuchen, NJ, USA). The film was scanned and the integrated optical densities of the bands were measured using the ScionImage software (Scion Corporation, Frederick, MD, USA).

Recombinant plasmid construction/site-directed mutagenesis
Total RNA was extracted from an adult white male human’s liver using Trizol (Life Technologies Inc., Rockville, MD, USA) according to the manufacturer’s instructions. Total RNA (3 µg) treated with RNase-free DNase I (Life Technologies Inc.) was reverse transcribed using an 18 mer oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen) per the manufacturer’s instructions. The oligonucleotide (5'MluI PEMT) TAACACGCGTAGTTATGACCCGGCTGCTGGGCTA was used as the 5' primer; the oligonucleotide ATCATCATCCTTGTAGTCGAGCACGACGAAGCTGAGAATGTA (3' PEMT-WT), which adds 19 nucleotides encoding the FLAG epitope (DYKDDDDK), was used as the 3' primer. The PCR product was subcloned into Nhe1 and Mlu1 multicloning sites of mammalian expression vector pBI-EGFP-tet (Clontech, Palo Alto, CA, USA), a bidirectional response plasmid that allows simultaneous expression of both EGFP and PEMT-FLAG under the control of a single tetracycline (doxycycline) -responsive element. With PEMT-WT as the template, site-directed mutagenesis was conducted using GeneTailorTM Site-Directed Mutagenesis System per manufacturer’s instructions (Invitrogen). Oligonucleotides 5'TGGTGGCCCTCACCTACATAGTGGCTCTCCTATA3' and 5' TATGTAGGTGAGGGCCACCAGCACCGTCAG3' were the forward and reverse primers to introduce the M175V mutation (we later realized that V175M is the SNP and V at 175 is the WT, and data analysis was performed accordingly; see Discussion).

Human liver specimens
Forty human liver samples were obtained from the Liver Procurement and Distribution System (LTPADS) (University of Minnesota, Minneapolis MN, USA; funded by NIH contract N01 DK92310). Of these 40 subjects, 28 had fatty liver and 12 had normal livers. Synopses of tissue donors’ medical histories, including pathologist’s impression diagnosis on liver fat content, were obtained. The specimens were snap-frozen once removed from the organ donors, delivered on dry ice, and stored at –80°C until analysis.

Normal human blood collection
Forty-seven healthy volunteers were recruited for a protocol approved by the Institutional Review Board at the University of North Carolina at Chapel Hill. These individuals consumed a diet adequate in choline content and had no liver disease by review of medical history, serum liver function tests (bilirubin, alanine aminotransferase, aspartate aminotransferase, creatine phosphokinase, {gamma}-glutamyl transpeptidase, lactic dehydrogenase, alkaline phosphatase, prothrombin time, partial thromboplastin time, and albumin), and did not have fatty liver as assessed by magnetic resonance imaging of liver (see below). Blood samples were obtained by venipuncture and peripheral lymphocytes isolated by Ficoll-Hypaque gradient using Vacutainer® CPTTM tubes with sodium citrate (Becton Dickinson, Franklin Lakes, NJ, USA) (19 , 20) and prepared for SNP analyses as described below.

Magnetic resonance imaging of liver
Changes in relative hepatic fat levels were determined using a modified "In and Out of Phase" magnetic resonance imaging (MRI) technique of Dixon (21 22 23) using a Siemens Vision 1.5T clinical MR system. Briefly, quantification of fat within the liver using MRI is possible because of the resonant frequency differences between fat and water. The resonant frequency differences in fat and water are reflected in the transverse magnetization changes and signal intensity changes at particular time intervals. Using a "breath-hold" fast field echo sequence (FLASH; TE=2.2 ms and 4.5 ms, with a flip angle of 80° and TR=140 ms) at an echo time of 2.2 ms (TE), MRI signals from water and fat will be 180° out-of-phase with each other; at a TE = 4.5 ms the signals from fat and water will be in-phase with each other. MR images obtained from the in-phase and the out-of phase can then be processed to derive the fat fraction from the differences in the MR image pixel intensity values. Serial FLASH MRI studies using a TE = 2.2 and 4.5 ms were performed on subjects. The MR image sets were processed to determine the fat fraction in the liver using software provided by Siemens Medical Solutions (Malvern, PA, USA). Five liver slices in each subject were analyzed and compared with the fat fraction found in the spleen. Relative changes in the levels of fat and water were monitored using a localized single volume proton magnetic resonance spectroscopy technique (PRESS; TE=135, TR=1500 ms) (24) .

Genomic DNA extraction
Genomic DNA was extracted from liver tissues using TriZol (Life Technologies Inc.) and from peripheral lymphocytes using PureGene (Gentra Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions.

SNP detection
DNA sequencing was performed on double-stranded DNA templates obtained from genomic DNA by PCR amplification. Exon 8 of PEMT was amplified with the oligonucleotides 5'GGAGCACTTTGCCCCAGAATC3' and 5'GACTTGGAGCCTTCAGAGCG3' as forward and reverse primers, respectively. PCR products were purified with QIAquick® PCR Purification Kit 250 (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer’s instructions. Sequencing reactions were performed by the University of North Carolina at Chapel Hill Genome Analysis Facility, using a capillary sequencing machine (model 3100, Applied Biosystems, Foster City, CA, USA). The sequences obtained were compared with ones stored in the NCBI database (http://www.ncbi.nlm.nih.gov/entrez/, accession number AF294467) using ClustalW multiple sequence alignment software (http://www.ebi.ac.uk/Tools/sequence.html). Sequence homology identity was determined in accordance with criteria as described previously (25) .

Statistics
All data are presented as mean ± standard error of the mean. Differences in the prevalences of V175M polymorphic genotypes in normal controls and patients with NAFLD were tested with Fisher’s exact test (26) . PEMT activity data were analyzed using 1-way ANOVA (27) .


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
In vitro study
Wild-type and V175M PEMT plasmids were transiently transfected into McArdle-RH7777 cells, which does not show endogenous PEMT activity (Fig. 1 ). Transfection efficiency as assessed by the expression of EGFP was not different in the three groups (vector, wild-type, or V175M; data not shown). The amount of PEMT protein expressed was assessed by measuring the FLAG epitope expressed. Whether PEMT activity was expressed per milligram protein or per expressed FLAG, the V175M form of PEMT had significantly diminished activity (Fig. 1) . Thus, V175M is a loss of function polymorphism. We analyzed enzyme activity using saturating concentrations of substrates; it is possible that activity differences between the polymorphic proteins might be different using other incubation conditions.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 1. Val to Met substitution at residue 175 of PEMT leads to expression of PEMT with reduced activity. McArdle-RH7777 cells were transiently transfected with plasmids containing sequence for wild-type PEMT (WT), V175M mutated form (V175M), or vector only (Vector). 50 µg of total particulate protein from cells harvested 48 h after transfection was used for PEMT activity assay in the presence of 200 µM AdoMet. Results are expressed as mean ± standard error for n=3/group. Open bars: Activity expressed as pmol phosphatidylcholine formed per milligram protein/h. Hatched bars: Activity expressed as pmol phosphatidylcholine formed per integrated optical density of FLAG epitope per hour. The experiment was duplicated with similar results. *P<0.01 by 1-way ANOVA; **P<0.005 by 1-way ANOVA.

Subject demographics
In patients with NAFLD (n=28; all confirmed as NAFLD from liver biopsy specimens with appropriate history), there were 12 males and 16 females, age range was 5–77 years (mean 51±3 years), with 23 Caucasians, 2 African Americans, 1 Hispanic, and 1 Asian (ethnicity not known for 1 subject); body mass indices ranged from 18.4 to 48.5 (mean 30±1.4 units; BMI unknown for 2 subjects). In control subjects (n=59; 12 confirmed normal from liver biopsy specimens and 47 confirmed as having normal liver by MRI), there were 30 males and 29 females, age range was 5–72 years (mean 37.1±2.1 years), with 37 Caucasians and 14 African Americans, 3 Hispanics, 3 Asians, 1 Native American, and 1 Trinidadian. Body mass indices ranged from 15.3 to 33 (mean 24.7±0.5 units) in the controls.

SNP detection
The V175M (G to A substitution) polymorphism in PEMT was differentially distributed in controls and NAFLD patients. Allele frequency for G and A was 0.19 and 0.81, respectively in 28 NAFLD patients; among 59 normal controls, they were 0.39 and 0.61, respectively. The frequencies of the three genotypes among patients were GG (Val/Val) 7.1%, GA (Val/Met) 25%, and AA (Met/Met) 67.9%. Frequencies of the three genotypes among normal controls were GG, 18.6%, GA, 40.7%, and AA, 40.7%. (Table 1 ). Almost twice as many controls had the GG and GA genotype than did the NAFLD patients, whereas the AA genotype was overrepresented in the NAFLD patients compared with the normal controls (P=0.02 by 2-tailed Fischer’s exact test). We observed no significant sexual dimorphism in this distribution. The observed distribution of the V175 and M175 alleles is similar to that previously reported in the public SNP databases.


View this table:
[in this window]
[in a new window]
  		Table 1. PEMT Exon 8 SNP distribution in human subjectsa


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Nonalcoholic fatty liver disease is the most common reason for liver test abnormalities in the general population (1) . While it is usually identified in adults with obesity, it can occur in people with normal body weight without underlying diabetes and hyperlipidemia, and has been described in children as well (2 , 3) . We identified a loss of function SNP in PEMT (G->A in exon 8 of the PEMT gene in humans; results in a V175M substitution in the encoded protein) that occurs more frequently in patients with NAFLD. This SNP was previously detected in humans in a Japanese population, but no functional significance was attributed to it (16) . Currently, there are no noninvasive tests to diagnose and stage NAFLD (1) . Liver biopsy remains the most sensitive diagnostic test but cannot distinguish NAFLD from other causes of fatty liver disease, such as alcohol abuse (28) . Identification of genetic predisposition factors to this disease would help identify individuals who are at risk for NAFLD and who warrant evaluation for presymptomatic prediction and prevention.

The mechanism whereby a loss of function SNP in PEMT might be associated with NAFLD involves the role of this enzyme in lipoprotein secretion from liver. Triacylglycerol is formed in the liver, then secreted in VLDL. Synthesis of new phosphatidylcholine molecules is required for VLDL formation; when they are not available, fat droplets accumulate in the cytosol of liver cells (6 , 7 , 29) . When the diet is deficient in choline (4 , 8 , 30) or when PEMT activity is inhibited or deleted (12 , 13 , 15 , 29) , fatty liver ensues.

In the literature, the sequence for human PEMT was originally reported to contain a methionine at residue 175 (GenBankTM accession number AAK19172; however, in later reports on human PEMT and in the reported sequence for mouse, rat, and cow (GenBankTM accession numbers are NP_009100, AAH26796 Q08388, and AAQ01191 respectively), PEMT contains a valine at this residue (Table 2 ). Therefore, we argue that in evolution the earliest sequence for PEMT contains a valine at this position and that the mutation to encode a methionine is the genetic polymorphism.


View this table:
[in this window]
[in a new window]
  		Table 2. Amino acid sequence alignment of mammalian PEMT orthologsa

We realize our observation is derived from a small study and that the group of NAFLD patients was drawn from a national pool whereas many of our control subjects were recruited in North Carolina. The demographics of the two groups were similar, though average BMI was higher in the NAFLD group. Since high BMI can increase incidence of fatty liver, it is possible that the PEMT SNP we report is somehow associated with factors that increase BMI. However, it is unlikely this is the sole reason that this SNP is associated with risk for NAFLD.

The relatively common occurrence of this loss of function SNP (81% of controls and 93% of NAFLD have at least one allele) suggests that it provides some evolutionary advantage to humans. We previously reported (31) that mice in which this gene is deleted have excess S-adenosylmethionine available for methylation reactions because PEMT activity uses an appreciable portion of available methyl groups for formation of choline. Perhaps when humans eat enough choline in their diet, the V175M SNP is beneficial because it reduces waste of methyl-groups for making choline moiety. Sometimes a SNP is selected for because it protects against disease (32) . Human erythrocytes infected with Plasmodium develop new pathways for accumulating choline from plasma (33) . Up to 45% of the malaria parasite is composed of phosphatidylcholine and the malaria parasite actively accumulates choline from its host (34) . Finally, there is a clear correlation between antimalarial activity of some drugs and their ability to inhibit choline uptake into the parasite (35) . Perhaps the V175M SNP we describe diminishes the availability of choline in the human host and thereby impairs the replication of the malaria parasite. Whatever the reason, it is interesting that the V175M SNP is so prevalent in humans.

The incidence of NAFLD is lower in premenopausal women than in men or postmenopausal women (36) . This would be consistent with our hypothesis that low PEMT activity is a risk factor for developing NAFLD. Female rats are less likely to develop fatty liver when fed choline-deficient diets than are male rats (37) , because females have greater capacity to form the choline moiety de novo via PEMT pathway in liver. It is estimated that female rats have 10–50% more PEMT activity than do males (38 , 39) . A woman’s capacity to form the choline moiety de novo may be highest before menopause because estrogens increase PEMT activity in humans (40) and in castrated-rats (41) . Thus, premenopausal women may be less sensitive to a loss of function SNP in PEMT because they have excess PEMT activity compared with men or postmenopausal women.

The requirement for choline (from diet or from PEMT synthesis) is spared in part by the availability of methyl groups from 1-carbon metabolism (via methyltetrahydrofolate) (42) . It is possible that the PEMT SNP we describe will interact with other commonly known SNPs in humans. For example, the thermolabile variant (677C->T) of 5,10-methylenetetrahydrofolate reductase (MTHFR, E.C. 1.5.1.20) occurs in 15–30% of humans (43) . We found that mice in which MTHFR was deleted develop fatty liver, which resolves when mice are fed the choline metabolite betaine (43) . These mice require more choline or betaine because homocysteine remethylation to methionine, in the absence of 1-carbon units via the folate pathway, shifts to a pathway that uses choline as a precursor. Homocysteine can be remethylated to methionine by methionine synthase using 5-methylfolate supplied by MTHFR (43) . Alternatively, betaine:homocysteine methyltransferase (BHMT, EC 2.1.1.5) catalyzes a methyl transfer from betaine to homocysteine (43) . When 5-methylfolate is not available, more betaine is required. Thus, humans who have diminished capacity to synthesize choline moiety via PEMT activity and diminished capacity to form 5-methylfolate will have difficulty producing increased betaine from choline when it is needed for homocysteine methylation.

We studied a relatively small number of subjects (28 with NAFLD and 59 controls); it would be valuable to characterize this SNP in larger populations. It would also be useful to determine whether diets high in choline reduce hepatic steatosis in humans with this SNP. We recently published data on choline content of foods (44) , and the U.S. Department of Agriculture maintains an updated food composition table online (http://www.nal.usda.gov/fnic/foodcomp/Data/Choline/Choline.html). We are currently examining whether there are other loss of function SNPs in the PEMT gene.


   ACKNOWLEDGMENTS
 
We thank Olga G. Kozyreva, Ph.D., and Umadevi Veluvolu, M.S., for their technical assistance, and Lawrence L. Kupper, Ph.D., for his assistance with statistical analyses. This work was supported by grants from the NIH to S.Z. (DK55865, AG09525). J.S. is a recipient of the Royster Fellowship from UNC-Chapel Hill. Support for this work was also provided by grants from the NIH to the UNC Clinical Nutrition Research Unit (DK56350) and the Center for Environmental Health and Susceptibility (ES10126).

Received for publication December 29, 2004. Accepted for publication February 24, 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Browning, J. D., Horton, J. D. (2004) Molecular mediators of hepatic steatosis and liver injury. J. Clin. Invest. 114,147-152[CrossRef][Medline]
  2. Brunt, E. M. (2001) Nonalcoholic steatohepatitis: definition and pathology. Semin. Liver Dis. 21,3-16[CrossRef][Medline]
  3. Falck-Ytter, Y., Younossi, Z. M., Marchesini, G., McCullough, A. J. (2001) Clinical features and natural history of nonalcoholic steatosis syndromes. Semin. Liver Dis. 21,17-26[CrossRef][Medline]
  4. Zeisel, S. H., daCosta, K.-A., Franklin, P. D., Alexander, E. A., Lamont, J. T., Sheard, N. F., Beiser, A. (1991) Choline, an essential nutrient for humans. FASEB J. 5,2093-2098[Abstract]
  5. Buchman, A., Dubin, M., Moukarzel, A., Jenden, D., Roch, M., Rice, K., Gornbein, J., Ament, M. (1995) Choline deficiency: a cause of hepatic steatosis during parenteral nutrition that can be reversed with intravenous choline supplementation. Hepatology 22,1399-1403[CrossRef][Medline]
  6. Yao, Z. M., Vance, D. E. (1988) The active synthesis of phosphatidylcholine is required for very low density lipoprotein secretion from rat hepatocytes. J. Biol. Chem. 263,2998-3004[Abstract/Free Full Text]
  7. Yao, Z. M., Vance, D. E. (1989) Head group specificity in the requirement of phosphatidylcholine biosynthesis for very low density lipoprotein secretion from cultured hepatocytes. J. Biol. Chem. 264,11373-11380[Abstract/Free Full Text]
  8. Yao, Z. M., Vance, D. E. (1990) Reduction in VLDL, but not HDL, in plasma of rats deficient in choline. Biochem. Cell Biol. 68,552-558[Medline]
  9. Bremer, J., Greenberg, D. (1961) Methyl transfering enzyme system of microsomes in the biosynthesis of lecithin (phosphatidylcholine). Biochim. Biophys. Acta 46,205-216[CrossRef]
  10. Vance, D. E., Walkey, C. J., Cui, Z. (1997) Phosphatidylethanolamine N-methyltransferase from liver. Biochim. Biophys. Acta 1348,142-150[Medline]
  11. Reo, N. V., Adinehzadeh, M., Foy, B. D. (2002) Kinetic analyses of liver phosphatidylcholine and phosphatidylethanolamine biosynthesis using (13)C NMR spectroscopy. Biochim. Biophys. Acta 1580,171-188[Medline]
  12. Walkey, C. J., Donohue, L. R., Bronson, R., Agellon, L. B., Vance, D. E. (1997) Disruption of the murine gene encoding phosphatidylethanolamine N-methyltransferase. Proc. Natl. Acad. Sci. USA 94,12880-12885[Abstract/Free Full Text]
  13. Zhu, X., Song, J., Mar, M. H., Edwards, L. J., Zeisel, S. H. (2003) Phosphatidylethanolamine N-methyltransferase (PEMT) knockout mice have hepatic steatosis and abnormal hepatic choline metabolite concentrations despite ingesting a recommended dietary intake of choline. Biochem. J. 370,987-993[CrossRef][Medline]
  14. Walkey, C. J., Yu, L., Agellon, L. B., Vance, D. E. (1998) Biochemical and evolutionary significance of phospholipid methylation. J. Biol. Chem. 273,27043-27046[Abstract/Free Full Text]
  15. Waite, K. A., Cabilio, N. R., Vance, D. E. (2002) Choline deficiency-induced liver damage is reversible in Pemt(–/–) mice. J. Nutr. 132,68-71[Abstract/Free Full Text]
  16. Saito, S., Iida, A., Sekine, A., Miura, Y., Sakamoto, T., Ogawa, C., Kawauchi, S., Higuchi, S., Nakamura, Y. (2001) Identification of 197 genetic variations in six human methyltransferase genes in the Japanese population. J. Hum. Genet. 46,529-537[CrossRef][Medline]
  17. Ridgway, N. D., Vance, D. E. (1988) Kinetic mechanism of phosphatidylethanolamine N-methyltransferase. J. Biol. Chem. 263,16864-16871[Abstract/Free Full Text]
  18. Ridgway, N. D., Vance, D. E. (1988) Specificity of rat hepatic phosphatidylethanolamine N-methyltransferase for molecular species of diacyl phosphatidylethanolamine. J. Biol. Chem. 263,16856-16863[Abstract/Free Full Text]
  19. Fotino, M., Merson, E. J., Allen, F. H., Jr (1971) Micromethod for rapid separation of lymphocytes from peripheral blood. Ann. Clin. Lab. Sci. 1,131-133
  20. Ting, A., Morris, P. J. (1971) A technique for lymphocyte preparation from stored heparinized blood. Vox Sang. 20,561-563[Medline]
  21. Dixon, W. T. (1984) Simple proton spectroscopic imaging. Radiology 153,189-194[Abstract/Free Full Text]
  22. Fishbein, M. H., Gardner, K. G., Potter, C. J., Schmalbrock, P., Smith, M. A. (1997) Introduction of fast MR imaging in the assessment of hepatic steatosis. Magn. Reson. Imaging 15,287-293[CrossRef][Medline]
  23. Lee, J. K., Dixon, W. T., Ling, D., Levitt, R. G., Murphy, W. A., Jr (1984) Fatty infiltration of the liver: demonstration by proton spectroscopic imaging. Preliminary observations. Radiology 153,195-201[Abstract/Free Full Text]
  24. Bottomly, P. A. (1987) Spatial localization in NMR spectroscopy in vivo. Ann. N.Y. Acad. Sci. 508,376-385[Medline]
  25. Goldenberger, D., Kunzli, A., Vogt, P., Zbinden, R., Altwegg, M. (1997) Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing. J. Clin. Microbiol. 35,2733-2739[Abstract]
  26. Analyze-It for Microsoft Excel 2004 Analyze-It for Microsoft Excel, Ltd. Leeds, UK.
  27. . SAS (1999) SAS/STAT® User’s Guide, Version 8 SAS Institute, Inc. Cary, NC.
  28. Bravo, A. A., Sheth, S. G., Chopra, S. (2001) Liver biopsy. N. Engl. J. Med. 344,495-500[Free Full Text]
  29. Noga, A. A., Zhao, Y., Vance, D. E. (2002) An unexpected requirement for phosphatidylethanolamine N-methyltransferase in the secretion of very low density lipoproteins. J. Biol. Chem. 277,42358-42365[Abstract/Free Full Text]
  30. da Costa, K. A., Garner, S. C., Chang, J., Zeisel, S. H. (1995) Effects of prolonged (1 year) choline deficiency and subsequent refeeding of choline on 1,2,-sn-diradylglycerol, fatty acids and protein kinase C in rat liver. Carcinogenesis 16,327-334[Abstract/Free Full Text]
  31. Zhu, X., Mar, M. H., Song, J., Zeisel, S. H. (2004) Deletion of the Pemt gene increases progenitor cell mitosis, DNA and protein methylation and decreases calretinin expression in embryonic day 17 mouse hippocampus. Brain Res. Dev. Brain Res. 149,121-129[CrossRef][Medline]
  32. Yates, Z., Lucock, M. (2002) Methionine synthase polymorphism A2756G is associated with susceptibility for thromboembolic events and altered B vitamin/thiol metabolism. Haematologica 87,751-756(discussion)[Abstract/Free Full Text]
  33. Kirk, K., Wong, H. Y., Elford, B. C., Newbold, C. I., Ellory, J. C. (1991) Enhanced choline and Rb+ transport in human erythrocytes infected with the malaria parasite Plasmodium falciparum. Biochem. J. 278,521-525
  34. Lehane, A. M., Saliba, K. J., Allen, R. J., Kirk, K. (2004) Choline uptake into the malaria parasite is energized by the membrane potential. Biochem. Biophys. Res. Commun. 320,311-317[CrossRef][Medline]
  35. Ancelin, M. L., Calas, M., Bompart, J., Cordina, G., Martin, D., Ben Bari, M., Jei, T., Druilhe, P., Vial, H. J. (1998) Antimalarial activity of 77 phospholipid polar head analogs: close correlation between inhibition of phospholipid metabolism and in vitro Plasmodium falciparum growth. Blood 91,1426-1437[Abstract/Free Full Text]
  36. Shen, L., Fan, J. G., Shao, Y., Zeng, M. D., Wang, J. R., Luo, G. H., Li, J. Q., Chen, S. Y. (2003) Prevalence of nonalcoholic fatty liver among administrative officers in Shanghai: an epidemiological survey. World J. Gastroenterol. 9,1106-1110[Medline]
  37. Tessitore, L., Sesca, E., Greco, M., Pani, P., Dianzani, M. (1995) Sexually differentiated response to choline in choline deficiency and ethionine intoxication. Int. J. Exp. Pathol. 76,125-129[Medline]
  38. Bjornstad, P., Bremer, J. (1966) In vivo studies on pathways for the biosynthesis of lecithin in the rat. J. Lipid Res. 7,38-45[Abstract]
  39. Lyman, R. L., Sheehan, G., Tinoco, J. (1971) Diet and 14CH3-methionine incorporation into liver phosphatidylcholine fractions of male and female rats. Can. J. Biochem. 49,71-79[Medline]
  40. Drouva, S. V., LaPlante, E., Leblanc, P., Bechet, J. J., Clauser, H., Kordon, C. (1986) Estradiol activates methylating enzyme(s) involved in the conversion of phosphatidylethanolamine to phosphatidylcholine in rat pituitary membranes. Endocrinology 119,2611-2622[Abstract]
  41. Young, D. L. (1971) Estradiol- and testosterone-induced alterations in phosphatidylcholine and triglyceride synthesis in hepatic endoplasmic reticulum. J. Lipid Res. 12,590-595[Abstract]
  42. Zeisel, S. H., Blusztajn, J. K. (1994) Choline and human nutrition. Annu. Rev. Nutr. 14,269-296[CrossRef][Medline]
  43. Schwahn, B. C., Chen, Z., Laryea, M. D., Wendel, U., Lussier-Cacan, S., Genest, J., Jr, Mar, M. H., Zeisel, S. H., Castro, C., Garrow, T., et al (2003) Homocysteine-betaine interactions in a murine model of 5,10-methylenetetrahydrofolate reductase deficiency. FASEB J. 17,512-514[Abstract/Free Full Text]
  44. Zeisel, S. H., Mar, M. H., Howe, J. C., Holden, J. M. (2003) Concentrations of choline-containing compounds and betaine in common foods. J. Nutr. 133,1302-1307[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 FASEB J.Home page
X. Xu, M. D. Gammon, S. H. Zeisel, Y. L. Lee, J. G. Wetmur, S. L. Teitelbaum, P. T. Bradshaw, A. I. Neugut, R. M. Santella, and J. Chen
Choline metabolism and risk of breast cancer in a population-based study
FASEB J, June 1, 2008; 22(6): 2045 - 2052.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. E. Vance, Z. Li, and R. L. Jacobs
Hepatic Phosphatidylethanolamine N-Methyltransferase, Unexpected Roles in Animal Biochemistry and Physiology
J. Biol. Chem., November 16, 2007; 282(46): 33237 - 33241.
[Full Text] [PDF]

Home page
 FASEB J.Home page
S. Romeo, J. C. Cohen, and H. H. Hobbs
No association between polymorphism in PEMT (V175M) and hepatic triglyceride content in the Dallas Heart Study
FASEB J, October 1, 2006; 20(12): 2180 - 2180.
[Full Text] [PDF]

Home page
 FASEB J.Home page
S. H. Zeisel
People with fatty liver are more likely to have the PEMT rs7946 SNP, yet populations with the mutant allele do not have fatty liver
FASEB J, October 1, 2006; 20(12): 2181 - 2182.
[Full Text] [PDF]

Home page
 FASEB J.Home page
K.-A. da Costa, O. G. Kozyreva, J. Song, J. A. Galanko, L. M. Fischer, and S. H. Zeisel
Common genetic polymorphisms affect the human requirement for the nutrient choline
FASEB J, July 1, 2006; 20(9): 1336 - 1344.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
N. K. Fukagawa
Sparing of Methionine Requirements: Evaluation of Human Data Takes Sulfur Amino Acids Beyond Protein
J. Nutr., June 1, 2006; 136(6): 1676S - 1681S.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J.
Right arrow Articles by Zeisel, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J.
Right arrow Articles by Zeisel, S. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS