| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Division of Host Defense, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan; and
Laboratory of Host Defense & Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan
1Correspondence: Division of Host Defense, Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. E-mail: nishihit{at}bioreg.kyushu-u.ac.jp
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
mRNA was severely impaired in response to lipopolysaccharide, not only in macrophages from alternative IL-15 Tg mice but also in RAW264.7 cells that had been transfected with alternative IL-15 together with IL-15 receptor (IL-15R). IL-15 promoter activity was suppressed in the transfected cells. Although nuclear factor-
B activation was not impaired, the binding activity of nuclear extracts to the interferon-stimulated response element of the IL-15 promoter region was reduced in RAW264.7 cells, which had been cotransfected with alternative IL-15 and IL-15R. IL-15 was mainly colocalized with IL-15R at the cytoplasmic membrane of RAW264.7 cells, which had been cotransfected with normal IL-15, whereas nonsecretable IL-15 was colocalized with IL-15R in nucleus after cotransfection with alternative IL-15 and IL-15R. These results suggest that nonsecretable IL-15 generated by alternative splicing suppresses further IL-15 gene transcription, implying a novel autocrine regulatory mechanism for cytokine gene expression by alternative splicing.
Key Words: cytokine • gene transcription • negative feedback
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 2)
, stimulating natural killer (NK) cells, NK T cells (NKT cells), epithelial 
T cells, and memory CD8 T cells to develop, proliferate, and survive (1
2
3
4
5
6
7)
. IL-2 is produced exclusively by activated T cells, and IL-15 mRNA is constitutively expressed by various cells and tissues such as the placenta, skeletal muscle, kidney, epithelial cells, synovial cells, and macrophages (1
2
3
4)
. However, IL-15 protein is produced at a very low level only by a limited number of cells, such as activated macrophages and epithelial cells during periods of immune response and inflammation, suggesting that mechanisms controlling IL-15 expression must operate in these cells. There are several lines of evidence indicating the existence of multicomplex mechanisms for regulation of IL-15 expression at the levels of transcription, translation, and intracellular trafficking (5)
. In terms of transcriptional control, transcriptional factors, including nuclear factor (NF) -B, interferon (IFN) regulatory factor 1 (IRF-1) and IRF-3, which bind to NF-B binding sites, and IFN-stimulated response elements (ISREs), respectively, play important roles in IL-15 transcription in lipopolysaccharide (LPS) -stimulated macrophages and virus-infected cell lines (8
9
10)
. In terms of translational control, IL-15 expression is regulated by multiple elements, including the presence of upstream AUGs in the 5'-untranslated region (UTR) of mRNA, unusually long signal peptides, and the C-terminal region of mature proteins (11
, 12)
.
The alternative splicing pathway is a mechanism by which diversity is generated in a reversible manner without the requirement of the expression of a new gene. Changes in the alternative splicing of specific pre-mRNA molecules may be associated with the unique function of each isoform (13)
. Many examples of alternative RNA splicing are used to generate various forms of mRNA in viral and eukaryote systems. We and others have reported that a murine shorter IL-15 precursor, encoded by alternative splicing mRNA containing an alternative exon 5, which displayed high efficiency of translation, lacks hydrophobic domains of signal sequence in the leader peptide. Hence, the shorter isoform of the murine IL-15 precursor was thought to be restricted to the cytoplasm (14
15
16
17)
. However, the functional roles of isoforms that result from alternative splicing have not been elucidated. We have recently revealed that macrophages obtained from IL-15 transgenic (Tg) mice expressing the isoform of IL-15 cDNA with alternative exon 5 under the control of major histocompatibility complex class I promoter have large amounts of intracellular IL-15 protein but secreted little of it extracellularly (18)
. The short signal peptide may regulate the fate of the mature protein by controlling the intracellular trafficking to non-endoplastic reticulum sites such as the cytoplasm and the nucleus. Notably, alternative IL-15 Tg mice expressing an isoform of IL-15 cDNA encoding a nonsecretable form of IL-15 protein had impaired ability to produce endogenous IL-15 in vivo after bacterial infection. Hence, it is possible that intracellular IL-15 isoforms play a role of negative feedback in the synthesis of endogenous IL-15 proteins.
In the present study, we attempted to elucidate the molecular mechanisms by which the nonsecretable IL-15 suppressed endogenous IL-15 production by macrophages in response to LPS in vitro. Expression of endogenous IL-15 mRNA but not tumor necrosis factor (TNF-) mRNA was impaired severely in peritoneal macrophages obtained from alternative IL-15 Tg mice and in RAW264.7 cells that had been cotransfected with alternative IL-15 and IL-15 receptor (IL-15R). Overexpression of nonsecretable IL-15 inhibited IL-15 promoter activity in RAW264.7 cells transfected with IL-15R. Although LPS signal transduction via Toll-like receptor 4 (TLR4) was not impaired, the binding activity of nuclear extracts to the IL-15 promoter was reduced in RAW264.7 cells that had been cotransfected with alternative IL-15 and IL-15R. Secretable IL-15 was colocalized with IL-15R at the cytoplasmic membrane, whereas nonsecretable IL-15 was localized in the nucleus in RAW264.7 cells that had been cotransfected with IL-15 and IL-15R. Implications for a novel autocrine regulatory mechanism for cytokine gene expression by alternative splicing are discussed in this paper.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Briefly, alternative IL-15 cDNA encoding a nonsecretable IL-15 precursor protein was cloned between the BamHI and SalI sites of a Tg expression vector, pHSE-3', which contains the H-2K promoter and immunoglobulin (Ig) enhancer and ß-globin splice site and poly A signal. Transgene DNAs were microinjected into the male pronucleus of fertilized single-cell embryos of C57BL/6 mice. Microinjected eggs were transferred to pseudopregnant C57BL/6 foster mothers. Alternative IL-15 Tg mice were identified by digesting genomic DNA with PstI, followed by Southern blot analysis using an IL-15-specific probe. In each experiment, age- and sex-matched littermates were used. C57BL/6 mice were obtained from Japan SLC (Hamamatsu, Japan). Mice were maintained under specific, pathogen-free conditions and offered food and water ad libitum. All mice were used at 6–8 wk of age.
Reagents and antibodies (Abs)
LPS from Escherichia coli (serotype B6:026) was obtained from Sigma Chemical Co. (St. Louis, MO, USA) and Bachem AG (Bubendorf, Switzerland). Recombinant mouse TNF- was purchased from Peprotech (Seattle, WA, USA). Polyclonal antiphosphorylated inhibitor of B (IB), IB, and IL-15R Abs were obtained from Santa Cruz Biotech (Santa Cruz, CA, USA). Polyclonal anti-IL-15 and anti-IL-15R Abs were purchased from R&D Systems (Minneapolis, MN, USA). An anti-Flag M2 mouse monoclonal Ab was obtained from Sigma Chemical Co.
Northern blot analysis
Total cellular RNA was isolated as described above. Aliquots (20 µg) of total RNAs were fractionated on 1% agarose gel containing 20 mM morpholinopropane sulfonic acid, 5 mM sodium acetate, 1 mM EDTA (pH 7.0), and 6% (v/v) formaldehyde and were transferred to nylon membranes. After UV cross-linking, the membranes were soaked in prehybridization solution [6x saline sodium citrate (SSC), 5x Denhardt’s reagent, 0.5% sodium dodecyl sulfate (SDS), 100 µg/mL denatured salmon sperm DNA, and 50% formamide] for 3 h at 65°C followed by incubation with 32P-labeled probe in hybridization solution (6x SSC, 0.5% SDS, 100 µg/mL denatured salmon sperm DNA, and 50% formamide) for 14 h at 65°C. The membranes were washed in 2x SSC, 0.1% SDS, for 10 min twice at room temperature and in 0.1x SSC, 0.1% SDS, for 10 min twice at 50°C and were exposed to Fuji RX-U films (Fuji Film, Tokyo, Japan). The membranes were hybridized with a 32P-labeled oligo probe, an IL-15 UTR sequence probe 5'-GCTGTGTTTGGAAGGCTGAGTT-3', or an alternative IL-15 additional sequence probe 5'-AAGCAACGGAACAATCAAGA-3' and with cDNA fragments of the coding regions of TNF- or ß-actin.
Reverse transcription-polymerase chain reaction (RT-PCR)
mRNA was prepared using QuickPrep Micro mRNA purification kit (Pharmacia Biotech, Uppsala, Sweden). First-strand cDNA was synthesized from 2 µg mRNA using RT (SuperScript II RT, Life Technologies, Gaithersburg, MD, USA) and 20 pmol of a random primer in 20 µL reaction mixtures according to the manufacturer’s instructions. The synthesized first-strand cDNA (2 µL) was amplified by means of the PCR using 20 pmol each primer specific for murine ß-actin or IL-15 with 2.5 U rTaq (Takara Shuzo, Osaka, Japan) in a total volume of 50 µL reaction buffer consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin, and 0.2 mM deoxy-unspecified nucleoside 5'-triphosphate. The specific primers used were as follows: ß-actin sense, 5'-TTCTGCATCCTGTCAGCAAT-3'; antisense, 5'-TAAAACGCAG-CTCAGTAACAGTCCG-3'; IL-15 exon 1 sense, 5'-TTCTCTTCTTCATCCTCCCCCT-3'; and IL-15 exon 2 antisense, 5'-ATGAAGAGGCAGTGCTTTGA-3'. The products were resolved on 1.8% agarose gels and visualized by staining with ethidium bromide.
Mammalian expression vectors and transient transfection
A mouse macrophage cell line, RAW264.7, was obtained from RIKEN Cell Bank (Tsukuba, Japan) and maintained in Dulbecco’s modified Eagle’s medium with 10% newborn calf serum. The coding region of alternative IL-15 or normal IL-15 was amplified by RT-PCR and inserted into a mammalian expression vector, pcDNA3.1+ (Invitrogen, Carlsbad, CA, USA), to yield pcDNA3.1 alternative IL-15 or pcDNA3.1 normal IL-15. The expression plasmids p3XFlag-CMV10-IL-15R were prepared by cloning mouse IL-15R wild-type cDNA containing all of the seven exons, as described by Bulfone-PauS et al. (19)
into p3XFlag-CMV10 vectors. The structure of all plasmid constructs was verified by restriction-enzyme mapping and nucleotide sequencing. For transient transfection, cells were plated onto 60-mm plates at 1 x 106 cells/plate on the day before transfection. Combinations of expression plasmid DNAs (6 µg total/plate) were dissolved in 300 µL OptiMEMTM (Invitrogen) and mixed well with 15 µL LipofectAMINETM (Invitrogen) dissolved in 300 µL OptiMEMTM. The mixture was incubated at room temperature for 30 min. Then 2.4 mL OptiMEMTM was added, and the mixture was poured onto cells after the removal of the culture medium. After incubation at 37°C for 12 h, the DNA-LipofectAMINETM mixture was replaced with 4 mL regular medium. The cells were harvested with phosphate-buffered saline after a further 36 h of incubation at 37°C and used for analyses.
Promoter activity
The mouse IL-15 promoter was cloned as described previously (8)
. The DNA fragment (position –564) comprising ISRE and NF-B binding sites was amplified by PCR using a sense primer, 5'-AACTTCACAGAGGCAAAGGCATTCC-3' (position –564 to 540), and an antisense primer, 5'-GGGAAGAGTGGCTGGACAGAAGG -3' (position –1 to +22), and cloned into the Kpn/XhoI site of a pGL-promoterless luciferase reporter vector (Promega, Madison, WI, USA). The NF-B consensus sequence, AGTTGAGGGGACTTTCCCAGG (Promega), was used as a control. Two micrograms of pGL3IL-15(–564) or pGL3NF-B together with 0.2 µg pRL-SV40 as an internal control was transfected into RAW264.7 by LipofectAMINETM (Gibco-BRL, Grand Island, NY, USA) by DMRIE-CTM (Gibco-BRL) according to the manufacturer’s instructions. At 48 h after transfection, cells were stimulated with 1 µg/mL LPS for 8 h. Then the cells were lysed, and the lysates were used for luciferase activity measurements using a dual luciferase reporter assay system (Toyo Ink Co., Tokyo, Japan) according to the manufacturer’s instructions. All the luciferase assays performed in the current study were repeated at least three times, and typical results for each experiment were shown.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared from RAW264.7 stimulated with 1 µg/mL LPS or 10 ng/mL TNF-. The binding sequences used for the EMSAs were 5'-TTGGGACTCCCCGG-3' for IL-15 NF-B and 5'-CTTTCTCTTTCACTTTCT-3' for ISRE. Approximately 1 x 105 cpm of an oligonucleotide labeled with 32P using T4 polynucleotide kinase, 10 µg nuclear extract, and 1 µg poly (dI.dC) was added to the binding buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, and 4% glycerol) and incubated for 30 min at 4°C.
Immunoprecipitation and Western blot analysis
Cellular extracts were prepared using phospholipase C lysis buffer (50 mM HEPES, pH 7.0, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF, 10 mM NaPPi, 1 mM Na3VO4, 1 mM phenylmethanesulfonyl fluoride, 10 mg/mL aprotinin, 10 mg/mL leupeptin). The lysates from 107 cells were incubated with a primary Ab for 2 h at 4°C and then with protein G-Sepharose beads (Amersham Pharmacia Biotech, Little Chalfont, UK) for 1 h. The beads were washed three times with lysis buffer, suspended in SDS sample buffer, and heated at 95°C for 5 min. The eluted proteins were applied to SDS polyacrylamide gel and electrotransferred to a nitrocellulose membrane. The membrane was blocked for 2 h in 2% bovine serum albumin-Tris-buffered saline/Tween 20 (TBST; 20 mM Tris-HCl, pH 7.6, 0.15 M sodium chloride, 0.1% Tween 20), incubated with primary Abs in TBST for 1 h, washed three times with TBST, and incubated for 1 h with horseradish peroxidase-conjugated anti-mouse Ig (Amersham Pharmacia Biotech) diluted 1:10,000 in TBST. After three washes in TBST, the blot was developed with an enhanced chemiluminescence system (Amersham Pharmacia Biotech) according to the manufacturer’s instructions.
Immunocytochemical analysis
After cells had been fixed with formaldehyde, immunohistochemistry was performed using monoclonal anti-FLAG M2 Ab and affinity-purified anti-IL-15 Ab followed by fluorescein isothiocyanate (FITC) -conjugated rat anti-mouse Ig secondary Ab and rhodamine-conjugated goat anti-rabbit Ig secondary Ab. Confocal microscopic analyses were performed using MRC-1024 (Bio-Rad Laboratories, Hercules, CA, USA).
Statistical analysis
The statistical significance of the data was determined by Student’s t-test. A Pvalue of less than 0.05 was taken as significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. To determine whether impaired production of IL-15 occurs at the transcriptional level in alternative IL-15 Tg mice, we performed Northern blot analysis of IL-15 gene expression by peritoneal macrophages obtained from alternative IL-15 Tg mice. Consistent with previously reported results (18)
, alternative IL-15 mRNA was detected consistently in macrophages from alternative IL-15 Tg mice (Fig. 1
). The macrophages from non-Tg mice expressed large amounts of IL-15 mRNA in response to LPS, whereas those from alternative IL-15 Tg mice expressed only small amounts of IL-l5 mRNA after LPS stimulation. Conversely, TNF- mRNA expression by macrophages from alternative IL-15 Tg mice was not affected by LPS stimulation.
|
To further investigate the effects of overexpression of nonsecretable IL-15 on IL-15 gene transcription, we transfected alternative IL-15 or normal IL-15 cDNA together with IL-15R cDNA into the macrophage cell line RAW264.2 and examined expression of endogenous IL-15 mRNA by semiquantitative RT-PCR in response to LPS or TNF-. Only small amounts of two types of endogenous IL-15 transcripts were detected in normal RAW264.7 cells, and both transcripts equally increased to peak levels at 4 h after LPS or TNF- stimulation (data not shown). Therefore, we examined the expression levels of endogenous IL-15 mRNA at 4 h after LPS or TNF- stimulation. We confirmed the expression of IL-15 proteins in both transfected cells by Western blot analysis (Fig. 2
). The expression level of endogenous IL-15 mRNA was not changed in RAW264.7 cells transfected with alternative IL-15 or normal IL-15 cDNA alone after stimulation with LPS or TNF- (data not shown). However, when IL-15R was cotransfected with the IL-15 cDNA, the expression level of endogenous IL-15 mRNA was greatly reduced in cells transfected with alternative IL-15 compared with the level in cells transfected with normal IL-15 or the control vector in response to LPS or TNF- (Fig. 3
). The whole cell extract immunoprecipitated by anti-Flag Ab and immunoblotting with anti-Flag and anti-IL-15 Abs. As shown in Fig. 2B
, Flag-tagged IL-15R was coprecipitated with normal IL-15 or alternative IL-15, confirming the complex formation of IL-15 and IL-15R in both transfectants.
|
|
IL-15 promoter activity was suppressed by overexpression of alternative IL-15 in a mouse macrophage cell line
The mouse IL-15 promoter region encompassing ISRE and NF-B binding sites or consensus NF-B binding sites was cloned into a promoterless luciferase vector, pGL3-basic (Promega). The generated plasmids (NF-B-luc and IL-15pmt-luc) were transfected into a mouse macrophage cell line RAW264.7, which had been cotransfected with alternative IL-15 or normal IL-15 and IL-15R. Forty-eight hours after the transfection, the cells were stimulated with LPS for 8 h, and the luciferase activity was measured. The results standardized by the internal control are shown in Fig. 3
. A significant level of induction through the common NF-B promoter was obtained in RAW264.7 cells transfected with normal IL-15 or alternative IL-15 (Fig. 4
A). Conversely, the induction level through the IL-15pmt construct for LPS treatment was less when macrophages were transfected with alternative IL-15 than the level in cells transfected with a vector or normal IL-15 (Fig. 4B
). It was also confirmed that cotransfection with IL-15R was indispensable for suppression of IL-15R promoter activity by alternative IL-15 and that IL-15R elicited alternative IL-15-mediated suppression of IL-15 promoter activity in a dose-dependent manner (Fig. 4C
). These results suggest that overexpression of intracellular IL-15 suppresses IL-15 promoter activity in the presence of IL-15R. These constructs were transfected into another mouse macrophage cell line J774.1, and results for RAW264.7 cells were obtained (data not shown).
|
TLR4 signaling was not inhibited by overexpression of alternative IL-15
TLR4 stimulation activates NF-B, which is required for IL-15 transcription activation (20
, 21)
. We examined activation of the downstream effector of TLR4 signaling in RAW264.7 cells, which had been cotransfected with alternative IL-15 or normal IL-15 and IL-15R. As shown in Fig. 5
, phosphorylation of IB and degradation of IB occurred after LPS stimulation in RAW264.7 cells, which had been cotransfected with alternative IL-15 and IL-15R. These results suggest that LPS signaling from TLR4 may not be impaired by overexpression of alternative IL-15.
|
DNA–protein binding of the mouse IL-15 promoter in RAW264.7 cells
To examine the activity of binding of transcriptional factors to the IL-15 promoter region, EMSAs were performed (Fig. 6
). Double-strand oligonucleotides corresponding to the NF-B binding sequence of the IL-15 promoter region were labeled and incubated with nuclear extracts from transfected RAW264.7 cells stimulated with LPS. Stimulation with LPS induced protein binding to IL-15 NF-B probes in RAW264.7, which had been cotransfected with alternative IL-15 and IL-15R. Conversely, the activity of binding of nuclear extracts to ISRE of the IL-15 promoter region was reduced in RAW264.7 cells, which had been transfected with alternative IL-15 together with IL-15R. These results suggest that overexpression of alternative IL-15 may selectively inhibit the activity of binding of transactivation factors to ISRE of the IL-15 promoter region.
|
Localization of intracellular IL-15 and IL-15R in macrophages
To determine how intracellular IL-15 encoded by the alternative IL-15 gene suppressed the binding of nuclear extract to the IL-15 promoter region in the presence of IL-15R, localization of IL-15 protein in RAW264.7 cells, which had been cotransfected with IL-15 and IL-15R, was examined by confocal microscopy. As shown in Fig. 7
, IL-15 (red) was detected mainly in the cytoplasm when the alternative IL-15 gene alone was transfected into RAW264.7 cells, whereas the IL-15 was intranuclear when the alternative IL-15 gene was cotransfected with the IL-15R gene. There was colocalization of IL-15 and IL-15R (in yellow), suggesting that the IL-15 and IL-15R complex was localized in the intranuclear space. Conversely, the secretable form of IL-15 was below the detectable level of detection in the nucleus and was mainly found to be associated with cell membranes, giving a ring-like pattern when the normal IL-15 gene was cotransfected with IL-15R.
|
To determine whether nuclear translocation of the IL-15 and IL-15R complex occurs in macrophages in a physiological condition, we next examined kinetics of change in localization of IL-15 and IL-15R in the macrophage cell line RAW264.7 after LPS stimulation. Normal IL-15 and alternative IL-15 mRNAs were induced in parallel 3 h after stimulation with LPS (Fig. 8
A). Western blot analysis of nuclear extract prepared by biochemical means revealed the expression of IL-15R in the nuclear fraction 6 h after LPS stimulation (Fig. 8B
). Confocal microscopy also revealed the expression of IL-15 and IL-15R in the nucleus 6 h after LPS stimulation (Fig. 8C
). Thus, nonsecretable IL-15 may be produced, and then the IL-15/IL-15R complex may be translocated to the nucleus at the late stage after LPS stimulation in a physiological condition.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 18)
. However, the functional role of isoforms that result from alternating splicing has not been elucidated. In this study, we found that nonsecretable IL-15 protein generated by alternative splicing inhibited LPS-induced IL-15 production at the transcriptional level. Coexpression of IL-15R was indispensable for the alternative IL-15-mediated inhibition. Intracellular IL-15 was colocalized in the nucleus with IL-15R, which contains a functional nuclear translocation sequence (NLS; refs. 22
23
24
). It has been suggested that intracellular IL-15, which forms a complex with IL-15R and is then translocated to the nucleus, may inhibit transcriptional activation of the IL-15 gene in response to LPS by interfering with the binding of transcription factors to the IL-15 promoter. Sorting of the same protein to a different cellular compartment by modification of the regulatory sequence has also been observed in other systems. In case of Int2, two different signal peptides are generated by the use of different start codons in-frame, resulting in the transportation of the proteins to a secretory pathway or the nucleus (25)
. The alternative splicing pathway is not only a mechanism by which diversity is generated in a reversible manner without the requirement of the expression of a new gene but is also an autocrine regulatory mechanism.
The promoter region of the IL-15 gene contains several consensus motifs for transcriptional factor binding such as specific protein-1, NF-B, NF–IL-6, -activated sequence, and ISRE (8
, 9)
. We determined previously the promoter activity of the 5' upstream region of the murine IL-15 gene in LPS-stimulated macrophages. The results of a luciferase assay using a 1.2-kb upstream fragment and its deletion mutants ligated to the luciferase reporter vector revealed that the 5' upstream region, including the NF-B binding site, is essential for promoter activity after LPS stimulation. The importance of ISRE for activation of the IL-15 promoter was also determined by the use of a series of reporter assays using IL-15 promoter deletion mutants (9)
. In fact, mice lacking the expression of IRF-1 expressed no IL-15 mRNA after stimulation with LPS and IFN- (10)
. Furthermore, IRF-3 has been reported to be important for IL-15 mRNA expression in virus-infected cells (9)
. The results of the present study suggest that NF-B activation may not be impaired, as phosphorylation of IB and NF-B binding activity to the NF-B binding motif of the IL-15 promoter was not affected in macrophages overexpressing nonsecretable IL-15. Conversely, the binding activity of the nuclear extract to the ISRE of the IL-15 promoter was significantly impaired. It has recently been reported that LPS signaling via TLR4 can activate IRF-3 in MyD88-independent and Toll/IL-1R domain-containing adaptor-inducing (TRIF) IFN-ß-dependent pathways (26
, 27)
. Upon signal triggered by TLR4, IRF-3 is phosphorylated, and the homodimer of IRF-3 forms a complex with the coactivator, cyclic AMP response element binding, protein binding protein/p300 in the nucleus, and a holocomplex of IRF-3, competent in DNA binding, is thus generated (28)
. The activation of IRF-3 results in IFN-ß production, which in turn induces in IRF-1 activation (29)
. Taken together, the results suggest that the nonsecretable IL-15 and IL-15R complex inhibits the activity of binding of IRF-1 and/or the holocomplex of IRF-3 to the IL-15 promoter region (Fig. 9
). Members of the IRF family show significant homology of the 115 amino acids in the amino-terminal region, which comprise the DNA binding domain (28)
, raising a possibility that IL-15 has homology in the amino acid sequence to IRF-1 and IRF-3, which may compete with binding to ISRE. However, there is no homology in the amino acid sequence between IL-15 and IRF DNA binding domain. Thus, it remains unknown how the cytokine/receptor complex in the nucleus inhibits the binding of nuclear factors to the IL-15 promoter region.
|
IL-15 binds to a heterodimetric receptor complex, which is composed of a unique IL-15R, the IL-2Rß, and common chains (3
4
5)
. IL-15R gene expression is reported to regulate by NF-B and IRF (30
, 31)
, suggesting that the nonsecretory IL-15 and IL-15R complex may inhibit not only IL-15 but also IL-15R gene expression. Within the human and mouse IL-15R sequences, there is a putative NLS (22
, 23)
, which has been demonstrated in the sequence of a number of ligands and receptors, including those that activate signal transducer and activator of transcription factors (32
, 33)
. In the present study, we found a nonsecretable isoform of IL-15, which uses a short (21 amino acids) signal peptide and is stored intracellularly and translocated to the nucleus in the presence of IL-15R. Conversely, the secretable form of IL-15, containing a long (48 amino acids) signal peptide, has no nuclear localization but rather, is directed to a secretory pathway and binds to IL-15R on cell surfaces. It is possible that IL-15R, which has a high affinity for IL-15, might bind to nonsecretable IL-15 inside the cell, and through its putative NLS, the cytokine-receptor complex is translocated to the nuclear compartment. Thus, IL-15R might play different roles for the two forms of IL-15 on the cell surface for secretable IL-15 and at the nuclear level for nonsecretable IL-15. IL-15R is known to form several variants generated by alternative exon splicing (34
, 35)
. It can be speculated that the exon 2 spliced isoform is excluded from nuclear trafficking, as the exon 2 encoded domain is indispensable for not only cytokine binding but also nuclear trafficking (34)
. At present, we do not have any evidence for participation of particular IL-15R variants in nuclear trafficking. The biological significance of NLS in IL-15R will require further experiments. Many transmembrane receptors have also been detected in the nucleus, including receptors for insulin (36)
, nerve growth factor (37
, 38)
, fibroblast growth factor (39)
, platelet-derived growth factor, growth hormone (40)
, IL-1 (41)
, cerB-4 (42)
, and HER-2/neu (43
44
45)
. Nuclear localization might therefore be a general feature of many transmembrane receptors. However, despite many previous reports about nuclear receptors, the functions of transmembrane receptors in the nucleus have not been elucidated. In this study, we have shown the potential functions of nuclear IL-15R. It is possible that many other receptors also have this activity and can regulate their own genes.
IL-15 mRNA is expressed constitutively in the placenta, skeletal muscle, and kidney, and the different tissues seem to exhibit different distributions of two forms of IL-15 (14
15
16
17)
, suggesting that the biological significance of the regulatory mechanisms may be distinct in different tissues (4)
. IL-15 mRNA is up-regulated when monocytes are activated by LPS/IFN- (3
, 4)
. We previously reported that alternative IL-15 Tg mice show normal development of NK, NKT cells, and intraepithelial lymphocyte (18)
. Conversely, IL-15 production was severely impaired after bacterial infection. These results suggest that constitutive expression of IL-15 may not be affected by overexpression of nonsecretable IL-15 and that transcriptional regulation of the constitutive expression may be different from the regulation of the inducible IL-15 gene. Alternatively, as IL-15R expression is indispensable for nuclear translocation and inhibition by nonsecretable IL-15, the physiological level of IL-15R may not be sufficient for IL-15R-mediated translocation of nonsecretable IL-15 in macrophages.
It is notable that not only in an IL-15 overexpression condition but also in a physiological situation, IL-15R and IL-15 were detected in the nucleus at a late phase after LPS stimulation. Normal IL-15 and alternative IL-15 mRNAs were induced in parallel 3 h after stimulation with LPS. However, we previously reported that the translational efficiency in an alternative IL-15 isoform was five-fold higher than that in the secretable isoform (16)
. Therefore, nonsecretable IL-15 may predominant at the late stage after LPS stimulation, and a complex of IL-15R and nonsecretable IL-15 may preferentially be translocated to the nucleus and consequently inhibit further transcriptional activation. Although down-regulation of IL-15 mRNA is mediated mainly by degradation, our results suggest that nonsecretable IL-15, generated by alternative splicing, might down-regulate IL-15 gene transcription. This implies a novel autocrine regulatory mechanism for cytokine gene expression by alternative splicing.
|
ACKNOWLEDGMENTS |
|---|
Received for publication July 1, 2004. Accepted for publication September 23, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B binding site is essential for transcriptional activation of IL-15. Immunogenetics 48,1-7[CrossRef][Medline]
-mediated apoptosis in fibroblasts by TRAF2 recruitment to the IL-15R chain. FASEB J. 13,1575-1585 chain of the IL-2 receptor. EMBO J. 14,3654-3663[Medline]
chain and close linkage of IL15RA and IL2RA genes. J. Biol. Chem. 270,29862-29869-chain mRNA results in a shortened form with a distinct pattern of expression. J. Biol. Chem. 274,26978-26984 gene expression through an NF- B site. J. Immunol. 166,2602-2609 promoter. J. Immunol. 168,5667-5674-chain mRNA results in a shortened form with a distinct pattern of expression. J. Biol. Chem. 274,26978-26984
isoforms. J. Immunol. 170,5045-5055This article has been cited by other articles:
|
|
 |
|
  E. H. Duitman, Z. Orinska, E. Bulanova, R. Paus, and S. Bulfone-Paus How a Cytokine Is Chaperoned through the Secretory Pathway by Complexing with Its Own Receptor: Lessons from Interleukin-15 (IL-15)/IL-15 Receptor {alpha} Mol. Cell. Biol., August 1, 2008; 28(15): 4851 - 4861. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Franchi, J. Zaret, X. Zhang, S. Bocca, and S. Oehninger Expression of immunomodulatory genes, their protein products and specific ligands/receptors during the window of implantation in the human endometrium Mol. Hum. Reprod., July 1, 2008; 14(7): 413 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. S. Quinn Interleukin-15: A muscle-derived cytokine regulating fat-to-lean body composition J Anim Sci, April 1, 2008; 86(14_suppl): E75 - E83. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Kagimoto, H. Yamada, T. Ishikawa, N. Maeda, F. Goshima, Y. Nishiyama, M. Furue, and Y. Yoshikai A regulatory role of interleukin 15 in wound healing and mucosal infection in mice J. Leukoc. Biol., January 1, 2008; 83(1): 165 - 172. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Bulanova, V. Budagian, E. Duitman, Z. Orinska, H. Krause, R. Ruckert, N. Reiling, and S. Bulfone-Paus Soluble Interleukin (IL)-15R{alpha} Is Generated by Alternative Splicing or Proteolytic Cleavage and Forms Functional Complexes with IL-15 J. Biol. Chem., May 4, 2007; 282(18): 13167 - 13179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Stoklasek, K. S. Schluns, and L. Lefrancois Combined IL-15/IL-15R{alpha} Immunotherapy Maximizes IL-15 Activity In Vivo J. Immunol., November 1, 2006; 177(9): 6072 - 6080. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Lorenzen, A. J. Dingley, Y. Jacques, and J. Grotzinger |
