| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Institute of Molecular Biology
* Division of Clinical Pharmacology and Toxicology, Department of Internal Medicine
Institute of Experimental Immunology, Institut für Klinische Pathologie
Veterinärmedizinisches Labor
|| Biologisches Zentrallabor, University of Zurich, Switzerland
1Correspondence: Institute of Molecular Biology, Winterhurerstr. 190, Universität Zürich, 8057 Zürich, Switzerland. E-mail: walter.schaffner{at}molbio.unizh.ch
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: heavy metal stress • cadmium toxicity • hematopoiesis • conditional knockout
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2
3
4
5)
. Metallothioneins bind heavy metals with high affinity and are involved in heavy metal homeostasis/detoxification and radical scavenging (6)
. MTF-1 binds via its zinc fingers to so-called metal response elements (MREs), DNA motifs of core consensus TGCRCNC present in multiple copies in the promoters of all Mt genes and other target genes of MTF-1. In the mouse, MTF-1 seems to be particularly important for the induction of two stress-inducible metallothionein genes, Mt-I and Mt-II, in response to heavy metal load (7
, 8)
. Other target genes of the ubiquitously expressed MTF-1 include those for ZnT1, a zinc exporter pump, tear albumin/lipocalin, and C/EBP
(9
, 10)
. Under hypoxic conditions, MTF-1 contributes to the expression of placental growth factor (PlGF), an angiogenic factor expressed in many tumors (11
12
13)
. Targeted gene disruption of the Mtf1 locus in the mouse causes embryonic lethality at midgestation 
14 days postcoitum (p.c.) due to liver degeneration (14)
. A gross effect on the central nervous system (CNS) could be excluded by a transplantation experiment whereby neuroectoderm from 12.5-day embryos was grafted onto the brain of adult mice. Mutant and wild-type tissues survived, and cells containing or lacking Mtf1 were able to differentiate into several major cell types of the CNS (15)
. Fibroblasts from 12.5-day embryos survived in culture but were more susceptible to the cytotoxic effects of cadmium and H2O2 (14)
. In this paper we demonstrate that the embryonic liver phenotype is caused by a cell-autonomous defect at the hepatocyte level. To further explore the function of MTF-1 in adult mice, we generated Mtf1 conditional knockout mice where Mtf1 was deleted in the liver, bone marrow, and to various degrees in some other tissues after birth. Mice lacking Mtf1 in the liver survive well under non-stress conditions but exhibit increased sensitivity to cadmium intoxication, revealing a function of MTF-1 distinct from its role in embryonic liver development. Conditional knockout mice displayed an abnormality in hematopoiesis, with significantly reduced total leukocytes, especially lymphocytes. Together, these results establish the role of MTF-1 in the response to heavy metals and reveal a new aspect of MTF-1 function in the hematopoietic system.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
106 cells were plated in one well of a 24-well plate precoated with MATRIGEL (Becton Dickinson labware, Franklin Lakes, NJ, USA). Cells were kept at 37°C in a humidified incubator with 5% CO2 and the medium was renewed every 24 h. The rest of the embryo was used for genotyping. For rat and mouse embryonic hepatocyte cocultivation, each 12.5-day mouse embryonic liver was mixed with half of a 12.5-day rat embryonic liver such that the rat cell to mouse cell ratio was 1:1. The culture medium was a 1:1 volume mixture of Ham's F12 (Gibco 21765-011) and Williams E medium (Amimed 1-48f02-I) supplemented with 1% L-glutamine (Sigma, St. Louis, MO, USA), 0.03225 mg/mL L-proline (Sigma), 1.67% (V:V) ITS (insulin/transferrin/selen) (Gibco 51500-056), 0.1 M vitamin C, and 10–7 M dexamethasone. Cell samples were collected at the indicated time intervals. In the coculture experiment, the first samples were analyzed within a few hours of removing the embryonic livers.
Reconstitution of hematopoiesis in irradiated mice
Embryonic livers (13.5 days) were freshly isolated on a sterile bench in a ventilated hood. Livers were kept in 1 mL cold DMEM medium. The remainder of each embryo was used for genotyping. Cells were isolated from livers by incubating disrupted liver in 1x trypsin-EDTA at 37°C for 30 min. Wild-type mice were irradiated 24 h before the experiment and received whole-body irradiation (9.5 Gy). Wild-type, Mtf1+/–, and Mtf1–/– liver cells were injected intravenously into the irradiated mice; control mice were injected with PBS. All mice were kept under specific pathogen-free conditions (SPF). Blood samples were taken after 4 months and the blood cell lineage was analyzed by FACS.
Tissue processing, histology, and blood analysis
For tissue processing and histological studies, mouse embryos or tissues were fixed in 4% formalin; 24 h later the tissues were dehydrated in graded ethanol and embedded in paraffin blocks for sectioning with a microtome and staining with hematoxylin-eosin (H&E). To detect apoptotic cells, consecutive slides were stained using "in situ cell death detection kit, fluorescein" (Roche, Nutley, NJ, USA). For blood analysis, blood was drawn from the orbital sinus under anesthetization and collected in heparin- or EDTA-containing tubes. Blood cell counting was done with the automated analyzer CELL-DYN (Abbott, Abbott Park, IL, USA).
RT-PCR
Total RNA was isolated using either TRIzol reagent (Life technologies, Grand Island, NY, USA) or QIAGEN RNeasy kit (Qiagen, Chatsworth, CA, USA) according to the manufacturer’s protocol. DNaseI digestion was performed after RNA isolation.
RT-PCR was performed using QIAGEN OneStep RT-PCR kit (Qiagen), with 100 ng total RNA. Primers used were:
for mouse AFP (AT=57°C):
5' CGAAACCTCCAGGCAACAAC 3';
5' GCAGAAGCCTAGTTGGATCA 3';
for rat AFP (AT=57°C):
5' CGGAATCTCCAGGCTGTACT 3';
5' TGTCCTGGCATTTCGATGGCG 3';
for mouse CPS (AT=55°C):
5' ATGACGAGGATTTTGACAGCTTGCAAAG 3';
5' CCACTTCACCAGCAACA 3';
for rat CPS (AT=55°C):
5' ATGACGAGGATTTTGACAGCTTGCAAAG 3';
5' TCACGTGCCGTTGTATCAGGG 3';
for GAPDH (AT=58°C):
5' TCGGAGTCAACGGATTTGGTCGTA 3';
5' ATGGACTGTGGTCATGAGTCCTTC 3';
for cMTF-1 (MTF-1 cDNA) (AT= 58°C):
5' TTAGACGAAGCTTGGGCTGCAGG 3';
5' CAATGTTTCTTGGCATGGGTGTG 3'.
Generation of MTF-1 cDNA rescue mice and liver-specific deletion mice
Plasmid pUbi-JunB was a gift from Dr. Erwin F. Wagner. The JunB coding sequence was substituted with mouse MTF-1 cDNA; two additional loxP sites were introduced by standard procedure using primers:
5'TATGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGTTAACGT 3';
5'TAACGTTAACATAACTTCGTATAATGTATGCTATACGAAGTTATGCGGCCGCA3'.
(Detailed information is available upon request.) The plasmid pUbiMTF2xloxP was linearized by digestion with Bgl II and the fragment was injected into the male pronuclei of fertilized eggs from Mtf1+/– intercrossing according to standard methods.
Mice from cDNA rescue line Mtf1–/–Tg were crossed with Mx-Cre mice (a gift from Dr. Michel Aguet). Starting at postnatal day 5 or 6, all littermates, including KoTg control mice, were injected (four times, with 3-day intervals) intraperitoneally with 100 µg (total volume 20 µL in PBS) polyinosinic-polycytidylic acid (polyI/C; Sigma) to induce expression of Cre recombinase. They were genotyped by PCR using primer pairs:
Mtf1 wt allele:
5' TGT CTT ACT GAT GAG GTG TC 3';
5' GCT CTT CAA AGT CCC AAA TG 3';
Mtf1 KO allele:
5'GATCGGCCATTGAACAAGATG 3';
5'CCTGATGCTCTTCGTCCAGATC 3'; MTF-1 transgene:
5'CACATTATCTCACCAGATCAGATTC3';
5'CTG TTC TCC CAT GAC TAG GCT G 3';
Mx-Cre:
5' CTA TCC AGC AAC ATT TGG GCC AGC 3';
5'CCA GGT TAC GGA TAT AGT TCA TGA C 3'.
A complete excision of cMTF-1 in the liver (and in white blood cells; see below) was reached by repeated injection of double-stranded RNA (polyI/C). Excision of the MTF-1 transgene led to transient formation of extracellular circles, which were diluted out by the ensuing liver cell proliferation.
Cadmium and zinc toxicity test
Cadmium was injected subcutaneously (s.c.) rather than added to the drinking water to better control the dosage (16)
. For the cadmium toxicity test, 7 KoTgCre mice (Mtf1 knockout, MTF-1 cDNA, Mx-Cre; 4 males and 3 females) and 12 KoTg (Mtf1 knockout, MTF-1 cDNA; 8 males and 4 females), all 8–16 wk old, were injected s.c. with CdSO4 in PBS, 10 µmol/kg body weight (b.w.) for 4 days, and 20 µmol/kg for 5 days. To determine total amounts of cadmium in livers, kidneys, and brains from cadmium-treated mice, tissues were submitted to an oxidative acid digestion in a microwave oven and measured by ICP-MS.
To test zinc toxicity, 12- to 14-wk-old female mice were injected s.c. for 7 consecutive days with increasing doses of ZnCl2 in PBS (Sigma). On days 1, 2, and 3, KoTg (n=3) and KoTgCre (n=3) mice received 200, 300, and 400 µmol/kg b.w., respectively. On days 4 and 5, mice received 600 µmol/kg b.w. and on days 6 and 7, 800 µmol/kg b.w.
EMSA assay
Liver extracts were prepared using tissue protein extraction reagent T-PERTM (Pierce, Rockford, IL, USA). EMSA (electrophoretic mobility shift assay) was performed as described (17
, 18)
. Binding reactions were performed by incubating 2–5 fmol end-labeled, 31 bp-long MRE-s-containing oligonucleotides with liver extracts. Identification of the MTF-1 binding was performed by using wild-type control liver extracts in the presence or absence of an MRE-s-containing oligonucleotide.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, we analyzed Mtf1 knockout (KO) livers using several different histological tools. H&E staining of Mtf1 null mutant livers revealed enlarged sinusoids and a tendency of hepatocytes to form irregular patches of cells, some in the process of necrosis. White blood precursor cells as well as erythroid cells appeared morphologically normal in wild-type and KO livers (Fig. 1
A). We checked for hepatic apoptosis by the TUNEL assay and found no evidence of elevated apoptosis in KO livers (Fig. 1B
).
|
Primary embryonic hepatocyte culture indicates mutant hepatocyte defect is cell autonomous
To test hepatocyte viability in Mtf1 KO mice, we cultured hepatocytes from single embryonic livers. Wild-type (wt), Mtf1+/–, and Mtf1–/– embryonic livers were isolated on day 12.5 p.c. and grown ex vivo. Cells were collected at intervals on days 2, 4, 6, and 8 of culture. Expression of several liver-specific markers—AFP (-fetoprotein) (19)
, HNF4 (hepatocyte nuclear factor 4) (20)
, and CPS (carbamoyl phosphate synthetase) (21)
—was determined by RT-PCR.
Liver cells from wild-type mouse embryos grew to confluency within 2 days in microwell culture. By contrast, Mtf1 KO liver cultures appeared normal at first but cell density decreased rapidly. In fact, in some microwells most of the Mtf1–/– cells were lost after several days whereas in others the remaining cells lacked hepatocyte morphology (Fig. 2
A). Wild-type embryonic liver cultures expressed all three liver markers tested: HNF4 expression was strong throughout the entire culture period (data not shown), whereas two independent wild-type cultures showed increasing expression of AFP and CPS from day 2 to day 8 (Fig. 2B
). Thus, we conclude that wild-type hepatocytes survive for at least 8 days in culture and maintain their differentiation state. None of the above liver markers could be detected from liver cultures lacking Mtf1, even if total cell RNA was normalized to the transcripts of a ubiquitously expressed gene (GAPDH) (Fig. 2B
). These results indicate that Mtf1–/– hepatocytes are intrinsically less viable than their wild-type counterparts.
|
To ascertain whether the hepatocyte defect was cell autonomous or could be rescued by normal hepatocytes, we cocultivated wild-type rat hepatocytes with Mtf1–/– mouse hepatocytes. In each culture, cells from 12.5-day embryonic liver of a wild-type, an Mtf1+/–, or an Mtf1–/– embryo were cocultivated with half of a 12.5-day wild-type rat embryo liver. Hepatocytes were found to proliferate and reach confluency after 1 or 2 days; no obvious difference could be observed by microscopic inspection between wt, heterozygous, and KO cocultures (Fig. 2C
).
Cells were collected at different time intervals, and expression of the embryonic liver-specific markers AFP and CPS was checked by RT-PCR using specific primers that selectively amplified rat or mouse genes. Rat liver cells cultured alone were used as control. They grew well and expressed all liver markers throughout the entire period in culture. Wild-type mouse liver cells from each coculture expressed mouse-specific AFP and CPS (mAFP and mCPS). This indicates that wild-type mouse cells can readily survive and maintain their hepatocyte identity in the presence of rat hepatocytes. By contrast, expression of mAFP decreased in Mtf1 null mutant hepatocytes at an early stage and the signal had disappeared by day 8 in KO cultures. For mCPS, no significant expression could be detected in KO cells even shortly after removing the liver from the embryo or at a later time (Fig. 2D
). We conclude that in spite of the presence of healthy rat hepatocytes, there is at most a minor rescue effect for the KO hepatocytes. A straightforward explanation of these findings is that the loss of hepatocytes in Mtf1–/– embryos is a cell-autonomous effect, and strongly indicates this to be the primary cause of embryonic lethality (see Discussion).
Embryonic hematopoiesis still compatible with disruption of Mtf1
During embryogenesis, hematopoiesis first occurs in the yolk sac. After midgestation, blood stem cells migrate to the embryonic liver. The fetal liver produces blood cells until shortly before birth, when the bone marrow takes over as the site of hematopoiesis (22)
. Several knockout mouse strains with embryonic liver defects, including those for c-Met, c-Jun, XBP, and NF-
B, display a deficiency in the hematopoietic system (23
24
25
26
27)
. Therefore, we performed an experiment to see whether the Mtf1 KO liver is able to reconstitute long-term hematopoiesis. Livers from day 13.5 p.c. of wild-type, Mtf1+/–, and Mtf1–/– mouse embryos were isolated, dissociated, and transplanted onto lethally irradiated wild-type recipient mice via intravenous injection. All 20 mice receiving embryonic liver cells survived, whereas all control mice who received a PBS injection died within 10 days. Genotyping of donor embryos performed after cell injection revealed that 6 were wild-type, 13 heterozygous, and 1 was an Mtf1 KO. Four months later, the origin of blood cells in the recipient mice was checked by PCR genotyping. A <5% wild-type signal was detectable in the KO liver recipient by PCR using DNA from peripheral blood cells (Fig. 3
A). The fact that one mouse receiving Mtf1–/– liver cells also survived indicates that Mtf1–/– cells could, in principle, contribute to reconstitution of the hematopoietic system. FACS analysis using B cell-specific markers CD19 and B220, T cell-specific markers CD4 and CD8, and a macrophage-specific marker, MAC1, revealed that Mtf1–/– liver cells had the potential to supply these types of cells (Fig. 3B
). Their immunological competence was not challenged in this experiment, since all mice were maintained under SPF conditions. FACS analysis of just two mice—one reconstituted with KO, the other with wild-type embryonic liver cells—did not permit reliable quantification of immune cells. Subsequent analyses of Mtf1 conditional knockout mice, however, revealed an underrepresentation of peripheral blood leukocytes (see below).
|
MTF-1 cDNA transgene fully rescues the KO phenotype
Disruption of Mtf1 causes embryonic lethality at midgestation due to liver degeneration. To test whether this phenotype is indeed caused by the deletion of Mtf1, we generated transgenic mice expressing an MTF-1 cDNA gene in a conventional Mtf1 KO background. A plasmid containing MTF-1 cDNA under the control of the human ubiquitin promoter/enhancer and flanked by two loxP sites (pUbiMTF2xloxP) was injected into zygotes from Mtf1 heterozygous crosses (Fig. 4A
). Subsequently, mice homozygous for Mtf1 knockout expressing MTF-1 cDNA transgene (KoTg) were generated by more crosses. These mice turned out to be viable and reproduced normally under laboratory conditions. EMSA indicated that the MTF-1 levels were very similar in the livers of KoTg mice and wild-type mice (data not shown). That the MTF-1 cDNA was able to rescue the liver degeneration phenotype is compelling evidence that the Mtf1 KO phenotype is caused by deletion of the Mtf1 gene rather than a secondary effect, such as an interference with the expression of a neighboring gene.
|
After birth, deletion of Mtf1 from liver is no longer lethal
We generated Mtf1–/–TgCre (KoTgCre) mice by crossing KoTg mice with Mx-Cre mice. Mx-Cre transgenic mice express Cre recombinase under the Mx1 (interferon-inducible protein p78, IFI78) gene promoter, which is inducible by interferon-, interferon-ß, or double-stranded RNA. Cre-mediated gene deletion was reported to be complete in liver and bone marrow and to vary in different organs—for example, from 8% excision efficiency in the brain, to 40% in the kidney and 94% in the spleen (1
, 2)
. For induction of Cre recombinase, mice of both genotypes (KoTgCre and KoTg) were injected several times with synthetic double-stranded RNA (polyI/C) starting at postnatal day 5 or 6. Expression of the MTF-1 cDNA transgene in KoTgCre mice was verified by RT-PCR using a primer pair hybridizing specifically to the transcript generated from MTF-1 cDNA but not with the endogenous MTF-1 transcript. PolyI/C-induced mice had no detectable cMTF-1 expression in their livers and blood cells whereas expression in brain, kidney, heart, lung, and testis was reduced to various degrees, in agreement with previous studies (Fig. 4B
) (1)
. Consistent with deletion of the gene and loss of mRNA, no MTF-1-specific DNA binding activity could be detected in KoTgCre liver extract by EMSA (Fig. 4C
).
KoTgCre mice were found to be viable under laboratory conditions. H&E staining of adult liver sections from KoTgCre mice revealed no abnormality in overall liver structure; hepatocytes formed cords separated by sinusoids, which were lined by flattened endothelial cells (Fig. 4D
).
To further characterize adult liver function in conditional knockout mice, blood concentrations of common markers of liver damage, AST (aspartate aminotransferase), ALT (alanine aminotransferase), and AP (alkaline phosphatase) were determined. The KoTgCre group mice displayed normal AST and ALT levels and a mild (60%) increase in AP relative to the control group KoTg (data not shown).
Cadmium sensitivity of mice with selective Mtf1 deletion in the liver
MTF-1 regulates basal and heavy metal-induced expression of mouse metallothioneins, notably Mt-I and Mt-II. Another prominent target gene of MTF-1 is the one for ZnT1 (zinc transporter 1), which exports zinc from the cytoplasm and thus protects cells from zinc toxicity (10)
. To test the contribution of MTF-1 on zinc and cadmium detoxification, we challenged conditional knockout mice that lacked Mtf1 in the liver with zinc or cadmium (28)
(see Materials and Methods). Cadmium treatment was lethal for all male KoTgCre mice, whereas all male KoTg control mice survived without any symptoms. From the female group, two female KoTgCre mice and one control KoTg mouse died during the experiment. Histological analysis of dead mice revealed massive cell degeneration and necrotic cells in liver, lung, and pancreas. The brain was not obviously affected (not shown), probably because the brain-blood barrier protects the CNS from cadmium influx (see Fig. 5
). These results suggest that loss of Mtf1 in the liver, and possibly partial loss in other organs, renders the mice susceptible to cadmium toxicity. Measurement of total metal concentration using ICP-MS demonstrated that, compared with their KoTg mice littermates, KoTgCre mice had accumulated considerably less cadmium in their livers and kidneys than the control mice. In KoTgCre male mice, the total amount of accumulated cadmium was reduced 3-fold in livers and 1.7-fold in kidneys (Fig. 5A
) compared with the control mice. The female KoTgCre mice had accumulated 2-fold less in the livers and 1.6-fold less in the kidneys (Fig. 5B
). Since metal-loaded metallothioneins are preferentially accumulating in liver and kidney, these data are in line with a severely reduced expression of metallothioneins in cells lacking Mtf1 (see Discussion). We also tested the effect of increasing doses of zinc (200–800 µmol/kg). However, control and KoTgCre mice both survived well under these conditions (data not shown; for details of protocol, see Materials and Methods). More studies are required to determine whether there is any difference in zinc sensitivity between wild-type and conditional knockout animals.
|
Leukocyte deficiency in Mtf1 conditional knockout mice
PCR genotyping revealed virtually complete excision of the MTF-1 cDNA transgene in KoTgCre blood cells (data not shown). To check how the loss of Mtf1 affects blood cell function and survival, we quantified the blood cells in these mice. Mtf1 conditional knockout mice (n=7, 4 males and 3 females) displayed one-third of the amount of white blood cells compared with the control group, KoTg mice (n=8, 4 male and 4 females) (Fig. 3)
, whereas the amounts of erythroid cells and platelets were similar between the two mouse groups (data not shown). Blood differentiation assays demonstrated that in the conditional KO mice, the lymphocyte population was particularly severely reduced; monocyte and neutrophil populations dropped in proportion to total white blood cells (Fig. 6
).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
14 days p.c. (14)
. Whatever the mechanism of liver degeneration, it was already established it could not be due entirely to the lack of stress-induced metallothioneins, since knockout of metallothionein genes Mt-I and Mt-II yielded viable mice under laboratory conditions (16
, 29)
. We were interested to see whether the primary cause of lethality was a cell-intrinsic defect of hepatocytes, a developmental defect that precluded the formation of an orderly liver structure, or a defect in other cell types resulting in the lack of a direct signal or a diffusible factor (hormone) required for embryonic liver development. The first time point "day 0" revealed a weak expression of AFP in the Mtf1 KO (Fig. 2D
). AFP is an early hepatocyte marker whose full expression is known to depend on MTF-1 (9)
. This indicates that the culture initially contained hepatocytes, possibly already compromised in their differentiation potential as suggested by the lack of detectable CPS, another hepatocyte marker. Such hepatocytes, however, disappeared soon during culturing and, in some cases, were replaced by fibroblast-like cells. At present we do not know whether the latter represented dedifferentiated/transdifferentiated hepatocytes or overgrowth of a minority cell population. Therefore, Mtf1–/– embryos most likely suffer from a hepatocyte-autonomous defect, which in cell culture can be at most somewhat delayed by coculture with healthy rat liver cells. (An alternative explanation for the complementation failure—an incompatibility between mouse and rat hepatocytes—seems highly unlikely to us.) Because adult mice lacking Mtf1 in the liver survive well under non-stress conditions, the defect apparently is at an embryonic differentiation step, rather than a failure to detoxify cellular components. Organogenesis of the liver requires proper control of proteins that also have a role in various forms of cell stress response, like c-Jun, XBP, SEK, HGF/SF, c-Met, and Rel-A. Mice mutated in any of these genes show similar embryonic liver degeneration phenotypes, namely, parenchymal hypoplasia and apoptosis in hepatocytes (24
, 25
, 30
31
32
33
34)
. However, MTF-1 probably does not belong to this signaling cascade(s), since Mtf1–/– hepatocytes do not undergo apoptosis and there is no sign of hematopoietic failure, a phenotype shared by null mutants of most of the proteins mentioned above (23
24
25
, 30)
. In contrast, histology of precrisis livers on day 12.5 p.c. revealed a normal representation of hematopoietic cells; cells from an embryonic KO liver were able to reconstitute the hematopoietic system of a recipient mouse. From this we conclude that the embryonic hematopoietic system is not significantly affected by the lack of MTF-1. As mentioned, we noted the absence, from the earliest time point of the culture period, of transcripts for a well-established liver marker, carbamoyl phosphate synthetase (CPSase I; EC 6.3.4.16), which catalyzes the first step of the urea cycle in mitochondria. Thus the gene encoding this enzyme might be a direct or indirect target of MTF-1 (see ref 9
for other targets). CPSase deficiency by itself, however, is unlikely to cause the loss of Mtf1 null mutant hepatocytes, since mice and humans lacking this essential enzyme survive until after birth (35)
.
Deletion of the Mtf1 gene in adult mouse liver by conditional knockout did not obviously affect a major liver function under laboratory conditions and in the absence of heavy metal stress. Cell culture data had indicated before that MTF-1 is important for metal detoxification: fibroblasts derived from Mtf1–/– embryos displayed increased sensitivity to cadmium and to H2O2 cytotoxicity (14)
. The in vivo data from conditional Mtf1 knockout mice presented here reveal an essential role of MTF-1 in heavy metal detoxification: in spite of normal viability under laboratory conditions, KoTgCre mice are sensitive to cadmium toxicity. Intoxication symptoms 1–2 days post-treatment were followed by lethality in male KoTgCre mice, whereas the control mice appeared completely unaffected and showed no adverse signs thereafter. Since male fertility was not determined after cadmium treatment, we cannot exclude a potential effect on testes/male fertility, which seems to be particularly susceptible to cadmium toxicity (36)
. KoTgCre females were less severely affected than males, which agrees with an independent study where female mice lacking metallothioneins Mt-I and Mt-II were found to be less sensitive to cadmium intoxication than males (6)
. In spite of greater sensitivity, KoTgCre mice accumulated only one-third the amount of cadmium in their livers and half the amount in kidneys as control mice. Since chelation of heavy metals by MTs represents a prominent protection mechanism against heavy metal toxicity (37
, 38)
, this result, at first glance counterintuitive, most likely reflects the severe reduction of metallothionein expression in the absence of MTF-1. In line with this notion, we recently observed low metallothionein expression with concomitant heavy metal sensitivity in MTF-1 null mutant Drosophila (39)
. We tested our conditional knockout mice for increased sensitivity to oxidative stress by treatment with paraquat and for liver regeneration by partial hepatectomy. Preliminary data indicate that in both cases there was no difference to control mice (data not shown). The latter finding suggests that the absence of MTF-1 does not grossly impair adult hepatocyte proliferation, in contrast to the situation in livers with impaired c-Jun or NF-B functions (40
, 41)
.
Finally, we genotyped peripheral blood cells from conditional knockout mice after polyI/C treatment and found quantitative cMTF-1 excision, which is consistent with the extensive inducibility of Mx-Cre in bone marrow and spleen (2)
. Surprisingly, and in contrast to the seemingly normal hematopoiesis in Mtf1 KO embryos (see above), reduced numbers of white blood cells, especially lymphocytes, were observed in the conditional knockout mice. This suggests a role for MTF-1 in the proliferation/maintenance of adult leukocytes. Independently, an involvement of MTF-1 in antimicrobial defense was suggested by treatments of dendritic cells by bacterial LPS (lipopolysaccharide) or influenza virus A, which induce an elevated expression of MTF-1 mRNA (42)
. Since in our studies all mice were kept under high hygiene standard facilities, no particular susceptibility to infections was detected and the life span of these mice was similar to the control group.
In conclusion, we show here that the "metal-responsive transcription factor-1" (MTF-1) is essential for embryonic liver formation; null mutant hepatocytes suffer from a cell-autonomous defect, resulting in liver degeneration in the embryo. Moreover, null mutant mice are fully rescued by a cDNA transgene; finally, excision of this transgene in the liver, bone marrow, and some other tissues renders mice susceptible to cadmium toxicity and reduces leukocyte titers, especially lymphocyte titers, suggesting a novel function of MTF-1 in the hematopoietic system.
|
ACKNOWLEDGMENTS |
|---|
Received for publication December 2, 2003.
Revision received March 24, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  Y. Li, T. Kimura, R. W. Huyck, J. H. Laity, and G. K. Andrews Zinc-Induced Formation of a Coactivator Complex Containing the Zinc-Sensing Transcription Factor MTF-1, p300/CBP, and Sp1 Mol. Cell. Biol., July 1, 2008; 28(13): 4275 - 4284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Adle, D. Sinani, H. Kim, and J. Lee A Cadmium-transporting P1B-type ATPase in Yeast Saccharomyces cerevisiae J. Biol. Chem., January 12, 2007; 282(2): 947 - 955. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Egli, J. Domenech, A. Selvaraj, K. Balamurugan, H. Hua, M. Capdevila, O. Georgiev, W. Schaffner, and S. Atrian The four members of the Drosophila metallothionein family exhibit distinct yet overlapping roles in heavy metal homeostasis and detoxification Genes Cells, June 1, 2006; 11(6): 647 - 658. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Wimmer, Y. Wang, O. Georgiev, and W. Schaffner Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione Nucleic Acids Res., October 12, 2005; 33(18): 5715 - 5727. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Selvaraj, K. Balamurugan, H. Yepiskoposyan, H. Zhou, D. Egli, O. Georgiev, D. J. Thiele, and W. Schaffner Metal-responsive transcription factor (MTF-1) handles both extremes, copper load and copper starvation, by activating different genes Genes & Dev., April 15, 2005; 19(8): 891 - 896. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Liuzzi, J. A. Bobo, L. A. Lichten, D. A. Samuelson, and R. J. Cousins Responsive transporter genes within the murine intestinal-pancreatic axis form a basis of zinc homeostasis PNAS, October 5, 2004; 101(40): 14355 - 14360. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
