| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,1
* Parasitology Research Group, School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, UK;
Department of Neuroscience, University of Connecticut Health Center, Farmington, Connecticut 06030; and
Department of Biomedical Sciences, Veterinary Medicine Building, Iowa State University, Ames, IA 50011, USA
1Correspondence: Department of Biomedical Sciences, 2036 Veterinary Medicine Building, Iowa State University, Ames, Iowa 50011, USA. E-mail: day{at}iastate.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
-amide group for biological activity. Amidation requires conversion of a glycine-extended peptide intermediate into a C-terminally amidated product. This post-translational modification depends on the sequential action of two enzymes (peptidylglycine -hydroxylating monooxygenase or PHM, and peptidyl--hydroxyglycine -amidating lyase or PAL) that in most eukaryotes are expressed as separate domains of a single protein (peptidylglycine -amidating monooxygenase or PAM). We identified a cDNA encoding PHM in the human parasite Schistosoma mansoni. Transient expression of schistosome PHM (smPHM) revealed functional properties that are different from other PHM proteins; smPHM displays a lower pH-optimum and, when expressed in mammalian cells, is heavily N-glycosylated. In adult worms, PHM is found in the trans-Golgi network and secretory vesicles of both central and peripheral nerves. The widespread occurrence of PHM in the nervous system confirms the important role of amidated neuropeptides in these parasitic flatworms. The differences between schistosome and mammalian PHM suggest that it could be a target for new chemotherapeutics.
Key Words: peptidylglycine alpha-hydroxylating monooxygenase • neuropeptide F • FMRFamide • schistosome • helminth
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Praziquantel is presently the only drug available for the treatment of schistosomiasis in most parts of the world, and with growing reports of decreased sensitivity (2
, 3)
, the need to identify potential targets for novel drugs is pressing.
Neuropeptides are a predominant component of flatworm nervous systems, as they are in other early diverging invertebrates, and the neuropeptidergic component of parasitic helminths is a potential source for new drug targets (4
, 5)
. In particular, two classes of neuropeptides are abundant in flatworms: FMRFamide-related peptides (FaRPs) and neuropeptide Fs (NPFs), both of which terminate with phenylalanine-amide (6)
. Although the sequences of schistosome FaRPs and NPFs have not yet been determined, cross-reactive peptides are abundant throughout the nervous systems of larval and adult schistosomes (7
8
9
10
11
12
13)
. Both NPF and FaRP-like transmitters are present in neurons of the central and peripheral nervous systems and are particularly evident in processes that innervate somatic muscle fibers and the reproductive system, suggesting roles in locomotory and reproductive behavior.
FaRP sequences (RYIRF-NH2, GYIRF-NH2, and YIRF-NH2) identified in other flatworms are potently excitatory on schistosome muscle (14)
. The carboxy-terminal phenylalanine-amide is essential for this activity (15)
. Similarly, the ability of flatworm NPF from the tapeworm Moniezia expansa (16)
to inhibit cAMP accumulation in schistosomes requires a carboxy-terminal -amide group (Day, unpublished results).
C-terminal -amide groups are commonly required for neuropeptide activity (17
18
19)
. The only known mechanism for carboxy-terminal amidation involves a glycine-extended intermediate and two enzyme activities, peptidylglycine -hydroxylating monooxygenase (PHM) and peptidyl--hydroxyglycine -amidating lyase (PAL). PHM requires copper, O2, and ascorbate, and is the rate-limiting step in amidation (17
, 19
, 20)
. In the human host and most other eukaryotes, both activities are encoded on a single gene as a bifunctional protein named peptidylglycine -amidating monooxygenase (PAM) (19)
. PAM is localized in the trans-Golgi network and secretory vesicles, the compartment in which neuropeptides mature during transport (21
, 22)
. In invertebrates such as Drosophila, Calliactis, and Hydra, PHM and PAL are expressed as independent proteins (23
, 24)
. Because cDNAs encoding flatworm NPFs have a glycine residue following the phenylalanine that will be amidated (25
, 26)
, the amidating mechanism may be conserved in flatworms, including schistosomes. Amidated peptides and amidating enzyme activity have also been found in plants, but the amidating enzymes have not yet been studied in detail (27
, 28)
.
Because signaling via amidated neuropeptides is crucial to the biology of invertebrates, attention has focused on these systems as a potential source of targets for novel helminth and arthropod control strategies (5)
. Attention has focused primarily on receptors for these amidated neuropeptides (4)
. However, given the broad array of neuropeptides within species, an approach targeting enzymes essential to the production of multiple peptide messengers could have even greater utility. For example, enzymes required for the amidation of all neuropeptides would be viable targets, especially if they displayed significant structural and functional differences from homologous enzymes in mammalian hosts.
Since we know that multiple amidated neuropeptides are crucial signaling molecules in schistosomes and -amidation is critical to their function, we aimed to identify and characterize the schistosome enzyme responsible for -amidation. We report the cloning and characterization of a S. mansoni cDNA, which encodes a monofunctional PHM that is widely expressed within the nervous system and has functional properties different from its human host homologue.
|
METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNA extraction and RACE-analysis
Mixed-sex schistosomes were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA), and total RNA was extracted, according to the manufacturer’s instructions. 5' RACE and 3' RACE-ready cDNAs were generated from 1 µg total RNA with the SMART RACE kit (Clontech Laboratories, Inc., Palo Alto, CA). Touchdown 5' RACE (94°C 3 min; 45 cycles of: 94°C for 15 s, 72°C–0.5°C per cycle for 30 s; 72°C for 2 min; 72°C for 7 min) was performed using Advantage Taq DNA polymerase (Clontech), 2.5 µl cDNA, the Universal Primer Mix (UPM; Clontech) and primer smPHM-R1 (5' CTTTGAAGAATGAGTTATCTCG 3', complementary to bp 208-229 of the schistosome EST, GenBank accession number AI723371). Touchdown 3' RACE (cycling as above) was performed using primer smPHM-F1 (5' ATTGCAGCAAGGTGTATAATGC 3', identical to bp 1-22 of EST AI723371) and the UPM. PCR products were TOPO-TA cloned (Invitrogen) and at least 3 plasmids were sequence analyzed.
Northern blot analysis
Digoxigenin-labeled DNA probes were generated by one-sided PCR using as a template a 934 bp PCR-product (generated with primers smPHM-F and AE01-R]5' CGAGATAACTCATTCTTCAAAG 3'[) with primer AE01-R and the DIG-labeling-mix (RocheBiochem). 20 µg total RNA were separated on a 1.2% formaldehyde–agarose gel, transferred to Protran nitrocellulose membrane (Schleicher & Schuell, Keene, NH) and UV-crosslinked for 5 min. Hybridization and detection were performed using the DIG-High Prime DNA Labeling and Detection Starter Kit I (Roche Biochem).
Plasmid construction for functional smPHM expression
smPHM (aa 18-350) was PCR-amplified with primers smPHM-F (5' TATCCTAAAGAAAAAAACAAATATGAG 3') and smPHM-BamHI-R (5' AAAGGATCCATCTAAATACTCATTTTCAAAGTTATC 3'). The PCR product and plasmid pBS-rhodopsin (24)
were cut with BamHI and ligated to yield C-terminally rhodopsin-tagged smPHM. smPHM-rhod was used as a template in a PCR (PCR-1) with primers smPHM-F and RHO-R containing a NotI-site at the 5' end (5' AAAGCGGCCGCTCACGCAGGTGCGACCTGAGATGTTTC 3'). The rat signal peptide and prosequence were PCR-amplified (PCR-2) from pCISkrPAM1a (residues 1–35) (21)
with primers rat-F containing a ClaI-site (5' AACTGCAGCTCGGTTCTATCGAT 3') and rat-R containing a 27 nt extension complementary to smPHM (aa 18-26; 5' CTCATATTTGTTTTTTTCTTTAGGATACCTCTTAAAGACAGAAAGTGGGC 3'). 2 µl from PCR-1 and PCR-2 were combined and amplified for 5 cycles, then outside primers rat-F and RHO-R were added and PCR continued for another 30 cycles. The PCR product was digested with ClaI and NotI, and cloned into pCISkrPAM1a (after releasing the ratPAM insert) to yield pCIS-smPHM-rhod. Plasmid DNA was isolated from a 200 ml overnight culture with the Concert High Purity Plasmid Maxiprep System (Life Technologies Europe Ltd., Paisley, UK) and sequence analyzed. The 25-residue rat PAM signal sequence and the 9-residue rhodopsin epitope tag have been used in the past with no effects on protein intracellular trafficking or enzyme activity (21
, 29)
.
Cell culture, transfection, and PHM enzyme assay
pEAK-Rapid cells were transfected with pCIS-smPHM-rhod using Lipofectamine 2000 and incubated in complete serum-free medium to collect secreted proteins (30)
. Cells were extracted in a low ionic strength buffer with detergent and protease inhibitors (21)
. Cell extracts and medium were analyzed by Western blot using a monoclonal antibody for the rhodopsin epitope tag (21)
. smPHM activity was determined using trace amounts of]125I[-Ac-YVG as described, with the rat homologue (the catalytic core, denoted rPHMcc) for comparison (21)
. Michaelis-Menten parameters were determined as described (23
, 31)
. The presence of N-linked oligosaccharides was examined using PNGase F (New England Biolabs). Briefly, cell extracts and secreted proteins were denatured in 10% sodium dodecyl sulfate, 5% 2-mercaptoethanol, mixed with Nonidet P-40, and digested with PNGase F and protease inhibitors at 37°C for 1 h.
Generation of anti-smPHM antibodies
Rabbit polyclonal antiserum, A297, was raised to the C-terminal 14 amino acids of smPHM (INDLFDNFENEYLD) by Genosphere Biotechnologies (Paris, France) following N-terminal coupling to Keyhole Limpet Haemocyanin and serum recovery following a primary and two booster injections. Blastp and tblastn searches of schistosome sequences at GenBank were used to check for peptide motifs similar to the C terminus of smPHM; no significantly similar sequences were identified.
Immunofluorescence and immunoelectron microscopy
Adult schistosomes were washed in PBS and fixed in 4% paraformaldehyde (PFA). Worms were incubated for 48 h at 4°C in anti-smPHM A297 (1/2000), washed with buffer, incubated in goat-anti-rabbit FITC (1/1000; Sigma, Poole, Dorset, UK), rewashed and mounted with glycerol. Confocal scanning laser microscopy (Leica TCS-NT, Leica Microsystems Europe, Milton Keynes, UK) was used for image acquisition. Adult mixed-sex worms were processed for immunoelectron microscopy as described previously (32)
. The primary antiserum (anti-smPHM A297) was diluted to 1:35000 with 0.1% BSA/Tris-HCl buffer and applied to sections overnight. After thorough washing in BSA/Tris-HCl, grids were transferred to a 20-µl drop of 10-nm gold-conjugated goat anti-rabbit IgG, as described previously. Sections were examined in a FEI (Philips) CM100 transmission electron microscope, operating at 100 keV. Controls comprised (i) incubation of sections with gold marker in the absence of primary antibody, and (ii) incubation with preimmune serum followed by the secondary antiserum and gold marker.
Computational DNA and protein analysis
Blast searches were done at www.ncbi.nlm.nih.gov. ClustalW and Boxshade were used at ch.EMBnet.org with default settings. Signal peptide prediction used SignalP 2.0 at www.cbs.dtu.dk/services/SignalP/ (33)
.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
, we identified a 518 bp EST (GenBank accession number AI723371) with weak homology to Aplysia PHM. Subsequent analysis showed the EST could encode a peptide with significant similarity (e values
4x10–7) with the PHM domains of Caenorhabditis elegans, Anopheles gambiae and Heterodera glycines. We designed primers for 5' RACE and 3' RACE experiments to identify the corresponding full-length cDNA. The RACE reactions yielded single products using a template of cDNA generated from adult, mixed-sex schistosomes.
The assembled 1442 nucleotide cDNA sequence (GenBank accession number AY172995) encodes a 350 amino acid open reading frame with all the characteristics of PHM domains found in other eukaryotes (Fig. 1
) and has a predicted molecular mass of 38 kDa. The N-terminal 17 aa of S. mansoni PHM (smPHM) are predicted to constitute the signal peptide (33)
. There is 36–42% identity with the PHM domains of Xenopus, human and Aplysia PAM, and the monofunctional PHM domains of Calliactis, Drosophila and C. elegans (Fig. 1
). smPHM contains the 8 conserved cysteine residues that are important for secondary structure, and the 5 histidine residues and single methionine residue needed for the two copper binding sites (19
, 35)
. Following the stop codon, smPHM has a 350 nucleotide 3' untranslated region with a polyadenylation signal (AAATATA) 12 nucleotides from the poly(A)+ tail. Northern blot analyses of total schistosome RNA identified a single RNA species of 
1500 nucleotides, which agrees with the size of our PCR-amplified cDNA (Fig. 2
A). In addition, there are 5 in-frame stop codons downstream of the terminator codon. Taken together, these results show that schistosomes contain a gene encoding monofunctional PHM.
|
|
Functional analysis of smPHM
To facilitate analysis of the functional characteristics of smPHM, we designed an expression vector, pCIS-smPHM-rhod (Fig. 2B
), in which the schistosome signal peptide was replaced with the 35 amino acid signal peptide and prosequence of rat PAM and an epitope tag (from rhodopsin) was placed at the C terminus (21
, 23
, 29)
. Transiently transfected mammalian cells were fed with complete serum-free medium, and both cells and medium were harvested 24 h later. Western blot analysis revealed the presence of a single 44 kDa rhodopsin-tagged protein in cell extracts and a heterogeneous collection of 53-97 kDa rhodopsin-tagged proteins in the spent medium (Fig. 2C
). The expression vector encodes a 39.6 kDa proprotein (lacking the rPAM signal sequence), substantially smaller than the rhodopsin-tagged protein observed in cell extracts. As for mammalian PHM, smPHM is efficiently secreted, with approximately 14 times as much smPHM in the medium at the end of 24 h as in the cell extract (35)
.
We next investigated the unexpectedly large molecular mass of intracellular and secreted smPHM. The sequence of smPHM includes 4 potential sites for N-linked glycosylation (N-X-S/T) (Fig. 2D
). PNGase F, which removes N-linked oligosaccharides regardless of their state of maturity (37)
, was used to assess the occurrence of N-glycosylation. Following digestion with PNGase F, cell extract smPHM had a molecular mass of 40 kDa, as predicted for rhodopsin-tagged smPHM (39.6 kDa) (Fig. 2E
). Limited PNGase F digestion of secreted smPHM revealed a ladder of cross-reactive products, consistent with N-glycosylation at all 4 candidate sites (Fig. 2F
). PNGase F treatment of secreted smPHM produced a small amount of 40 kDa protein, the same size observed in cellular extracts. A significant amount of the secreted smPHM had a mass of 55–70 kDa following PNGase F digestion, suggesting incomplete digestion or the presence of additional modifications such as O-linked glycosylation. The dramatic difference in Mr between intracellular and secreted smPHM after PNGase F digestion suggests that N-linked glycosylation occurs immediately before secretion (38
, 39)
.
The catalytic properties of secreted smPHM and the catalytic core of rat PHM (rPHMcc) were compared. smPHM exhibited optimal activity at pH 3.5, steadily declining to background levels as the assay buffer approached pH 6.5 (Fig. 3
A). As observed previously, rPHMcc exhibited optimal activity around pH 4.5, with clearly detectable activity at pH 7.0. A low pH optimum was also observed for cell extract smPHM, demonstrating that extensive glycosylation was not responsible for the low pH optimum (data not shown).
|
All PHM homologues characterized to date require copper for activity. As anticipated, both smPHM and rPHMcc activities were obliterated following addition of EDTA, a high-affinity divalent cation chelator (Fig. 3B
). smPHM displayed nearly full activity without addition of exogenous copper; rPHMcc, on the other hand, requires addition of exogenous CuSO4 for full activity (Fig. 3B
). Finally, we compared the Km of smPHM and rPHMcc for the same peptidylglycine substrate (Fig. 3C
). When assays were carried out at pH 5.0, the Km of smPHM for -N-Ac-YVG (44±5 µM) was approximately 10-fold greater than the Km of rPHMcc for the same substrate (4.2±0.4 µM). Because smPHM exhibits maximal activity at lower pH, its Km was evaluated at pH 4.0; no pH-dependent change in Km was observed (39±6 µM).
smPHM is expressed in neurons
FaRP and NPF-like peptide transmitters, both of which are C-terminally amidated, are widely expressed in the nervous system of larval and adult stages of S. mansoni (7
8
9
10
11
12
13)
. The nervous system of adult schistosomes is well developed; it is divided into central and peripheral components that form an orthogonal or ladder-like arrangement that is typical for flatworms. The central nervous system comprises the anterior brain and longitudinal nerve cords that run the entire length of the worm and are interconnected by numerous transverse commissures. The peripheral nervous system includes a well-developed subtegumental nerve plexus that innervates the body wall muscle, provides sensory endings to the gynaecophoric canal and dorsal tubercles of the male, as well as sending extensions to the oral and ventral suckers. Both the central and peripheral nervous systems contain a large number of nerve cells that so far have been found to be either peptidergic or aminergic/cholinergic in nature, but never both (unpublished observations).
To analyze the expression pattern of smPHM and to correlate this with the known expression patterns of FaRPs and NPF, we generated antibodies to the C-terminal 14 amino acids of smPHM. Adult worms showed distinct staining of neurons within the central and peripheral nervous systems (Fig. 4
A–C, E). Immunoreactivity (IR) was strong within the brain and longitudinal nerve cords (Fig. 4A
). In addition, IR was also present within the subtegumental nerve plexuses (Fig. 4B
) that extend into the ventral and oral suckers. Of particular note was the rich immunostaining in sensory endings that extended over the dorsal surface of the male worm (Fig. 4C
). As expected, a portion of the smPHM expression pattern was similar to the expression pattern observed for an NPF-like molecule (Fig. 4D
) (10
, 11
, 13)
. However, the anti-PHM staining in the adult males was more extensive than the staining observed with antibodies targeting NPF and FaRPs.
|
Female worms showed strong smPHM-IR within nerve cells and fibers that innervate the egg-forming chamber (ootype) and the adjacent ducts (vitelline duct, ovo-vitelline duct, oviduct) (Fig. 4E
). Schistosome eggs are ectolecithal or compound in nature and are formed in the ootype through the ordered assembly of yolk (vitelline) cells and a single egg cell (oocyte), which are then surrounded by the eggshell.
smPHM is not restricted to nerve cell bodies, extending into nerve fibers and thus resembling previously observed neuropeptide-staining patterns. This finding suggests that smPHM is present in secretory vesicles and furthermore that neuropeptide maturation takes place during transport to the site of secretion. Consistent with this finding are the immunostaining patterns for C-terminally amidated neuropeptides that occur throughout the cell bodies and axons of flatworm nerves.
Immunoelectron microscopic examination of the subcellular localization of smPHM confirmed that smPHM is localized to the trans-Golgi and secretory vesicles (Fig. 4F
) known to contain both NPF-like and FaRP-like peptides. Within the longitudinal nerve cords, IR was localized to dense-core vesicles. Although much of the immunogold labeling was in populations of large dense core vesicles, which are associated with peptidergic messenger molecules, some labeling was observed in populations of electron-lucent vesicles, whereas other populations of vesicles remained unlabeled (not shown). No labeling was observed in tissues or structures other than the Golgi complex of nerve cell bodies and vesicles.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 40
41
42)
, but the vast majority of evidence for their expression results from immunocytochemistry using antibodies to conserved sequence motifs at the C terminus of these signaling molecules. In S. mansoni, NPF-like and FaRP-like immunoreactivities have been identified in the nervous systems of both larval and adult stages (10
, 11
, 13)
, and peptides of these classes are physiologically active in schistosomes. Our finding that one of the enzymes necessary for the generation of C-terminally amidated peptide transmitters, peptidylglycine--hydroxylating monooxygenase, or PHM, is widely expressed in the nervous system of adult schistosomes, now helps to confirm that amidated neuropeptides play a key role in worm neuronal function.
Taking advantage of the schistosome EST database and the sequence of Aplysia PHM, we were able to identify a schistosome cDNA encoding a monofunctional PHM domain but lacking a PAL domain. smPHM is similar in sequence to other eukaryotic PHM domains. The functional significance of the presence of separate PHM and PAL proteins is unclear and has so far only been found in invertebrates (23
, 24)
. Efforts to identify a schistosome PAL cDNA with a degenerate primer-based PCR-screening strategy have been unsuccessful. Because PHM and PAL must act sequentially to accomplish the two-step amidation reaction, we assume a schistosome PAL gene is also present. Many genes encoding multifunctional products in higher organisms trace their ancestral origins to separate genetic loci (23
, 43)
.
The in vivo expression pattern of smPHM is extensive. smPHM immunoreactivity is more widespread than that of NPFs or FaRPs, suggesting that other amidated peptide transmitters may be present. Currently, there is no biochemical or molecular evidence for neuropeptides other than FaRPs or NPFs in schistosomes. The only definite role for FaRPs and NPFs in schistosomes is in locomotory behavior (14
, 15)
, and smPHM is highly expressed in the nervous system servicing the somatic musculature. The presence of smPHM in neuronal/neuroendocrine cells innervating the egg-forming chamber suggests that amidated neuropeptides are important in egg formation. Female schistosomes may produce 100–300 eggs per day, and signaling by amidated peptides may be involved in coordinating the process. Involvement of FaRPs in the egg-forming process is strongly indicated in another flatworm, the frog bladder parasite Polystoma nearcticum (44)
. In this worm, mature FaRPs are only expressed during sexually active periods, which are in synchrony with its frog host. Amidated peptide molecules may also play a role in developmental regulation during the schistosome’s life cycle. Drosophila PHM null mutants have an embryonic-lethal phenotype (45)
and in this respect, it is interesting to note that the original schistosome EST that we identified was derived from an egg-stage cDNA library. The expression pattern of smPHM in the different life-cycle stages of schistosomes may give a clue to the function of amidated peptides in development.
The biochemical and enzymatic characteristics of recombinant smPHM were compared with rat PHM, which has been crystallized and studied in detail. A key difference is the extensive glycosylation of smPHM (Fig. 2C
). Modeling smPHM based on the known structure of rat PHM indicates that all 4 potential N-glycosylation sites are situated on loop structures located on the surface of the molecule (Fig. 2D
). All 4 potential N-linked glycosylation sites in smPHM appear to be glycosylated. We initially suspected that glycosylation might be responsible for the more acidic pH optimum of secreted smPHM. However, cell extract smPHM exhibits a similarly low pH optimum (data not shown), indicating these extensive post-translational modifications, which occur upon secretion, do not affect the pH optimum.
Schistosome PHM has features that distinguish it from previously characterized vertebrate and invertebrate PHM proteins (23
, 29
, 31)
. Unlike rat PHM, bovine PHM or the four Lymnaea PHM enzymes, smPHM has little activity at neutral pH, displaying optimal activity at pH 3.5. In addition, smPHM does not require exogenous copper to exhibit maximal activity. Hence, we speculate that smPHM may bind copper with greater avidity. Finally, smPHM has a Km for -N-Ac-YVG that is almost 10-fold higher than the Km of rat, bovine or the four Lymnaea PHM proteins for the same substrate. The in vivo significance of the differences between smPHM and its mammalian homologues are not clear. Nevertheless, the exploitation of the unique features of smPHM could produce a selective disruption of amidated neuropeptide production in S. mansoni, and this may provide a novel therapeutic strategy in the treatment of schistosome infections.
|
ACKNOWLEDGMENTS |
|---|
Received for publication June 2, 2003. Accepted for publication August 8, 2003.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
