| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Center for Experimental Therapeutics and Reperfusion Injury, Department of Anesthesiology, Perioperative and Pain Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA
1Correspondence: Center for Experimental Therapeutics and Reperfusion Injury, Thorn Building for Medical Research, 7th Floor, Brigham and Women’s Hospital, 75 Francis St., Boston, MA 02115, USA. E-mail: cnserhan{at}zeus.bwh.harvard.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-induced NF
B activation. Transgenic FvB mice were generated by DNA injections of a 3.8 kb transgene consisting of the full-length hALX cDNA driven by a fragment of the hCD11b promoter. When topically challenged via dermal ear skin, hALX transgenic mice gave attenuated neutrophil infiltration (
80% reduction) in response to leukotriene B4 (LTB4) plus prostaglandin E2 (PGE2) as well as 50% reduction in PMN infiltrates (P<0.02) to receptor-bypass inflammation evoked by phorbol ester. The hALX transgenic mice gave markedly decreased PMN infiltrates to the peritoneum with zymosan and altered the dynamics of this response. Transgenic hALX mice displayed increased sensitivity with >50% reduction in PMN infiltrates to suboptimal doses (10 ng/mouse) of the ligand lipoxin A4 stable analog compared with <10% reduction of PMN in nontransgenic littermates. Soluble mediators generated within the local inflammatory milieu of hALX mice showed diminished ability to activate the proinflammatory transcription factor NFB. Analyses of the lipid-derived mediators from exudates using LC-MS tandem mass spectroscopy indicated an altered profile in hALX transgenic mice that included lower levels of LTB4 and increased amounts of lipoxin A4 compared with nontransgenic littermates. Together these results demonstrate a gain-of-function with hALX transgenic mouse and indicate that ALX is a key receptor and sensor in formation of acute exudates and their resolution.—Devchand, P. R., Arita, M., Hong, S., Bannenberg, G., Moussignac, R.-L., Gronert, K., Serhan, C. N. Human ALX receptor regulates neutrophil recruitment in transgenic mice: roles in inflammation and host defense.
Key Words: eicosanoids • lipoxin A4 • resolution of inflammation • inhibition of NFB • G-protein-coupled receptor
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 2)
. Despite the complexity and apparent redundancies in proinflammatory mediators, it is now clear that the dynamics of an acute inflammatory response require precise temporal and spatial coordination and regulation of key signaling pathways (2)
. For example, among the many endogenous chemical mediators, discrete classes of eicosanoids and intracellular signal sets are associated with the initiation of neutrophilic inflammation and progression toward resolution of the response to restore the organism’s homeostasis. The temporal profile of the eicosanoid lipoxin A4 (LXA4) is particularly intriguing because induction of its biosynthetic machinery and the production of LXA4 correlate with the onset of resolution, namely, the loss of PMN from inflammatory exudates (2)
. Recent findings indicate that LXA4 biosynthesis is also used by microbial pathogens to evade host defense (3)
. The anti-inflammatory properties of synthetic mimetics of this endogenous lipid-derived mediator in add-back experiments in vivo support the concept that LXA4 activates endogenous anti-inflammation and accelerates resolution (reviewed in refs 4
, 5
). LXA4 has a high-affinity receptor (ALX) that is expressed in myeloid cells, and evidence for involvement of the ALX receptor in vivo in this pivotal switch in inflammatory status from continued inflammation to pro-resolution is of interest. The functional evaluation of eicosanoid pathways in vivo has involved the use of genetically engineered mouse models, including targeted disruption at several stages of the signaling cascades ranging from biosynthetic enzymes (6
, 7)
, to cell surface (8
, 9)
and nuclear (10)
receptors. Recently we used transgenic mice expressing the high-affinity human leukotriene B4 receptor BLT-1 to further define the receptor and LTB4 role(s) in PMN trafficking and enhancing PMN-mediated tissue injury (11)
. Here, we investigated the function of a putative leukocyte counter-regulatory receptor in vivo—the human lipoxin A4 receptor (hALX)—using a gain-of-function approach. The results demonstrate that human ALX serves a protective role in vivo in specific acute inflammatory and innate responses upon challenge. |
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
for 5 h, harvested, and assayed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega).
Generation of human ALX transgenic mice
The hALX (GenBank accession # X63819) was cloned into the HindIII/Xba I sites of pGL3basic-hCD11b plasmid (11)
and the Not1 fragment containing the transgene (3.84 kb) was purified using DEAE ion-exchange membrane (NA45, Schleicher and Schuell, Keene, NH, USA). DNA concentrations were determined by UV spectroscopy. Transgenic mice were generated at Brigham and Women’s Hospital Transgenic Mouse Facility (Dr. Arlen H. Sharpe). Approximately 200 fertilized FvB eggs were injected with 1.5 ng of DNA each and transferred into four foster mothers (25 eggs per oviduct). Litters were genotyped for founders as described below. Hemizygous colonies were amplified by outbreeding hALX transgenic males with wild-type FvB females. Expression of hALX protein was verified by Western blot. Rabbit antisera containing polyclonal anti-hALX antibody was affinity purified using a bacterially expressed fusion protein consisting of a carboxyl-terminal fragment of hALX linked to glutathione-S-transferase. This anti-hALX antibody preparation was used in Western blots against lysates from leukocyte-rich PMA-treated mouse ears (see below).
Genotyping of mice
Genomic DNA was isolated from tail biopsies of mice and screened by PCR using primers directed to the hCD11b promoter and the 5'-untranslated region of hALX. Primers used in amplifications were 5'GGCACCTTTTGGATAGTGGTATTG3' and 5'GACCTCAAGGCTGCAAATGC3' for the CD11b-hALX transgene; and 5'TCCACCACCGTGTTGCTGTAG3' and 5'GACCACAGTCCATGACATCACT3' for GAPDH internal control. The PCRs (total volume of 25 µL) used the Qiagen Master mix, 0.2 µM of each primer, and 50 ng of genomic DNA. Reactions were performed in thermocycler using the following program: denaturation at 94°C for 2 min, amplification for 30 cycles (94°C for 0.5 min, 48°C for 0.5 min, 72°C for 1 min), followed by extension cycle of 72°C for 10 min. Products were separated by electrophoresis of 5–10 µL of PCR on 1% agarose gels and visualized by ethidium bromide staining.
Dermal ear inflammation
Murine dermal inflammations were performed as in ref 12
. The agonists LTB4 plus PGE2 (1 µg each together in acetone) or 100 ng PMA was applied to each ear; after 24 h, punch biopsies (6 mm diameter, Acu-Punch@) were taken. Each tissue sample was assessed for neutrophil content and infiltration. Tissues were homogenized in potassium phosphate buffer (pH 6.0) containing 0.5% hexadecyltrimethylammonium bromide, followed by three cycles of sonication and freeze-thaw. The particulate matter was removed by centrifugation (16,000 g for 20 min), and PMN were enumerated using myeloperoxidase (MPO) activity. Calibration curve for conversion of MPO activities to PMN number for FvB mice was performed as in ref 12
after collection of neutrophils using zymosan-induced peritonitis.
Zymosan-induced peritonitis
Mice were challenged i.p. with 1 mg zymosan A (Sigma, St. Louis, MO, USA) in 1 mL sterile PBS. At indicated intervals, the mice were killed and peritoneal lavages were collected with PBS. Cells were stained with Trypan blue, assessed, and counted using light microscopy. To obtain soluble fractions (vide infra for analysis), the peritoneal exudates were centrifuged at 1200 g for 10 min.
NFB reporter assay for inflammatory potential
Mouse NIH3T3 fibroblasts (0.5x105) were transfected with p(NRE)5-luc and pRL-TK-luc using Superfect reagent (Qiagen). Cells were treated for 16 h with DMEM medium (Gibco, Grand Island, NY, USA) containing 10% FBS and 100 µL of either PBS, 2.5 ng recombinant mouse TNF (Gibco) in PBS, or supernatants from zymosan-induced peritoneal exudates (100 µL of 3 mL total lavage from Transgenic line D and nontransgenic littermates). Luciferase assays were performed using the Dual-Luciferase Reporter Assay System.
LC-MS tandem mass spectroscopy
Two volumes of ice-cold methanol were rapidly added to cell-free supernatants obtained from zymosan-induced peritoneal exudates and immediately stored at –20°C. Eicosanoids were extracted for LC/MS/MS and analyses performed as in ref 13
. All compounds were identified in the present experiments using reported physical properties [i.e., UV absorbance, retention time (coelution), fragmentation in MS and MS-MS mode] for each eicosanoid using materials prepared by total organic synthesis that matched those of biologically derived eicosanoids.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), a lipoxin A4 metabolically stable analog (ATLa) inhibiting TNF-induced NFB activity using an in vitro transient transfection system. Results in Fig. 1
indicate that this receptor transmitted its inhibitory actions within the low nanomolar range of ATLa consistent with the affinity of the receptor for LXA4 and its stable analog mimetics (12)
in a ligand as well as receptor-dependent fashion. This full-length hALX cDNA was used to establish transgenic mice. The transgene construct consisted of the human ALX cDNA driven by a fragment of the hCD11b promoter (Fig. 2A
). This promoter was engineered for targeted expression in myeloid cells (14)
. Earlier studies by Dziennis et al. (14)
using founders with two different reporter genes (ß-galactosidase and Thy1.1 surface marker) downstream of this CD11b promoter fragment showed appreciable levels of transgene expression directed to mature myeloid cells. To this end, for the present experiments the transgenic founders were generated by DNA injections of fertilized FvB oocytes. The colonies were amplified from five different founders by out-crossing to wild-type FvB, thus maintaining hemizygous lines. These mice did not display obvious gross morphological or tissue defects upon examination by light microscopy for potential histopathology (not shown). Peripheral blood analyses using a Coulter counter for red blood cell and white blood cell indices, and Wright staining of blood smears showed no apparent differences between transgenic and nontransgenic littermates (not shown). RT-PCR analyses indicated that hALX transcript levels in the five different transgenic lines range from 30% (line D) to 130% (line B) of the endogenous mouse ALX receptor (data not shown). Taken together, these data indicate that the different transgenic lines express appreciable levels of hALX in a myeloid-selective manner and qualify the mice for functional studies. Each transgenic line expressed the human ALX protein (Fig. 2B
).
|
|
With the transgenic hALX lines in hand, we evaluated the role of hALX in a well-appreciated dermal ear model of acute inflammation (cf. ref 12
). Topical application of LTB4 stimulates neutrophil-driven acute inflammation via a GPCR-mediated pathway (11)
. This response is enhanced in a synergistic fashion with simultaneous topical application of both PGE2 and LTB4 (15)
. Neutrophil infiltration of the skin in response to phorbol esters, on the other hand, is not exclusively GPCR dependent at this interval, but rather involves a more global non-cell-type-specific tissue activation that is robust in magnitude. In both types of topical challenge, PMN accumulation was monitored (Fig. 3A
)as a function of tissue MPO activity (see Materials and Methods and ref 12
). Introduction of the hALX transgene resulted in attenuated neutrophil accumulation in mouse ear skin, as noted with dramatically reduced responses to the eicosanoids (LTB4 plus PGE2) that were more pronounced than the extent of inhibition obtained with phorbol ester-evoked responses (Fig. 3B, C
).
|
We next evaluated the effect of hALX expression in an established murine model for innate immunity and sepsis (1
, 11)
. Here, zymosan A derived from yeast cell wall was used to initiate a response that, in the peritoneal cavity, is mediated in part by chemokines, eicosanoid lipid mediators, and complement pathways to evoke leukocytic infiltration and peritonitis. Characteristic temporal events of this response involved an initial phase of increasing infiltration of PMN into the peritoneal cavity, such that the PMN number approached maximal values at 4 h (Fig. 4A
, left panel). Introduction of the hALX transgene protected against zymosan-induced peritonitis (Fig. 4A
, right panel) by decreasing the absolute level of leukocytic infiltration (i.e., a set-point in acute inflammation). This altered host defense response was evident in mice from three different transgenic lines (Fig. 4B
). Differential counts of leukocytes in the peritoneal exudates indicated they were essentially similar in percent of leukocytes to their nontransgenic littermates, although the total number of cells was reduced. The transgenic hALX mice initiate a predominantly neutrophil-driven response in this form of zymosan-induced peritonitis (data not shown). After 3 h the total number of leukocytes present within the peritoneal exudates of transgenic mice was comparable to responses obtained with sham-treated animals, i.e., sterile PBS injection without zymosan challenge and substantially less than the number of cells present in the exudates of nontransgenic mice (Fig. 4B
).
|
Next, we evaluated these mice for their response in a second organ injury, ischemia-reperfusion (I/R), which models the severe PMN-mediated injury from within observed in surgical patients. End organ injury caused by aberrant in situ PMN activation, a common problem associated with surgical based clamping procedures in humans (16)
, was evaluated using a hind-limb tourniquet procedure (cf. ref 11
). A marked accumulation into the lung was observed after I/R injury (3 h ischemia and 3 h reperfusion (results not shown), with values consistent with those reported earlier (11)
. PMN accumulation in lung tissues of transgenic mice was essentially identical to that of their nontransgenic littermates (results not shown, n=3, P value indicates no significant difference). Thus, expression of the hALX transgene did not render PMN simply "nonresponsive," since in this form of injury from within, expression of the transgene was not sufficient to protect against tissue injury caused by excessive PMN tissue infiltration and their subsequent activation.
Because the dampened response to zymosan conferred by the hALX transgene was inherent in the context of the inflammatory response, we further investigated the cell-free supernatants obtained from zymosan-induced peritoneal exudates to test for potential differences in released soluble signaling mediators. "Inflammatory potential" per se can be monitored efficiently by net effect of local mediators on activity of a well-characterized biomarker of inflammation. The transcription factor NFB plays a key role in inflammation and innate immunity and is established as a critical component in the production of proinflammatory mediators (17)
. We developed a NFB-responsive ex vivo reporter assay using murine NIH3T3 fibroblasts (see Materials and Methods) to compare the activity of exudates obtained from transgenic mice and their nontransgenic littermates (Fig. 5
). Supernatants from the nontransgenic mice gave NFB stimulation. In contrast, this bioactivity was markedly reduced in exudates from transgenic mice. Hence, the dampened response of hALX mice could have resulted in part from changes in the composition of soluble mediators present within exudates.
|
Since hALX is a ligand-activated receptor, the observed diminished leukocyte infiltration and/or counter-regulation should be triggered by the presence of endogenous ligand within exudates (4
,5
). To this end, we analyzed peritoneal exudates from transgenic mice using LC/MS/MS (13)
and established the presence of the ligand, namely, lipoxygenase-derived lipoxin A4 within exudates (20 ng LXA4 per mouse exudate taken at a 4 h interval with 5 mL lavage; Fig. 6
, upper panel). In exudates from nontransgenic littermates, LXA4 was below detection at this time point. In sharp contrast, the chemoattractant LTB4 was below limits of detection in exudates from transgenic mice but was present in nontransgenic littermates (10 ng LTB4 per mouse exudate at 4 h; Fig. 6
, lower panel). Additional profiling analyses using LC/MS/MS indicated a modulation within the lipoxygenase pathway axis such that the transgenic mice exudates contained elevated amounts of both 15S-HETE (5.1 ng/mouse exudate) and 5S,15S-diHETE (3.1 ng/mouse exudate), which were below limits of detection in nontransgenic littermates. As observed with nontransgenic littermates, mice characteristically produce 12S-HETE (8.7 ng/mouse exudate) as a main lipoxygenase product (not shown). These results indicated that 1) hALX could be triggered in situ by endogenous exudate levels of LXA4 and 2) the presence of the human transgene receptor changed the profile signature of exudate lipid mediators.
|
Lipoxin A4, aspirin-triggered 15-epi-lipoxin A4 and their stable analogs are the most effective ligands described to date for ALX (nM Kd range) (see refs 18
, 19
). ALX was originally denoted as an orphan seven transmembrane-spanning receptor that showed nucleotide sequence homology related to the N-formyl peptide receptors (FPRL-1) (20)
, which proved to be high-affinity receptors for the endogenous ligand LXA4 (for review, see refs 18
, 21
). Subsequently, additional ligands such as serum amyloid A (SAA) have been shown to activate this receptor (22)
, also known in the literature as FPRL-1/lipoxin A4 or ALX receptor (21
22
23)
. Several exogenous small peptides and synthetic agents have been reported to activate the receptor in vitro, but in micromolar concentration ranges that for most are orders of magnitude greater than that required for LXA4, ATL (15-epi-lipoxin A4), or their stable analogs (see Fig. 1
and ref 18
; for a review, see ref 21
).
To assess whether overexpression of human ALX in transgenic mice altered the sensitivity to ligand lipoxin A4 in vivo, a series of experiments were performed in ALX transgenic and nontransgenic littermates using zymosan-induced peritonitis (Fig. 7
). The aspirin-triggered 15-epi-lipoxin A4 stable analog (ATLa) is a potent inhibitor in vivo of leukocyte recruitment (13)
; at suboptimal doses of ATLa (10 ng), ALX transgenic mice showed an enhanced sensitivity to i.v. administration of ATLa (Fig. 7)
. At subthreshold levels, ATLa gave 50% inhibition in the ALX transgenic mice and <10% inhibition in nontransgenic littermates, whereas at higher doses (1 µg ATLa), no apparent differences were observed between ATLa inhibition in the transgenic ALX overexpressors vs. nontransgenic littermates. Leukocyte recruitment in both transgenic and nontransgenic mice with the higher 1 µg i.v. dose of ATLa was essentially identical. Along these lines, we observed that increasing receptor expression increased the sensitivity or potency of the response to low suboptimal doses of this compound in transgenic vs. nontransgenic mice, i.e., it shifts the efficacy curve to the left. The compound at higher concentrations gives maximal response in this system; hence increasing receptor number did not further increase efficacy to the compound. These results indicate that neutrophil recruitment to the peritoneum is more sensitive to exogenous addition of a lipoxin A4 stable analog, i.e., aspirin-triggered 15-epi-lipoxin A4, than in nontransgenic littermates. Moreover, these results demonstrate that overexpression of the human LXA4 receptor in vivo (hALX transgenic) and addition of the pharmacologic tool, its ligand, together enhance inhibition (see Fig. 7
, inset) and provide compelling evidence for the importance of the role of this ligand receptor system in leukocyte counter-regulation in vivo.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 3)
. We found that this protective effect of the human ALX is mediated in part by affecting the composition of the local exudate inflammatory milieu such that not only is the potential for amplifying proinflammatory signaling cascades restricted, but the profile of lipoxygenase products generated within exudates was altered to one that would promote resolution. Hence, hALX can be activated by endogenous LXA4, 15-epi-LXA4 (ATL), or administration of their stable mimetics (i.e., ATLa), which illustrates the capacity for serving as a pivotal regulator system for inflammatory exudative status.
Based on the present findings, a hypothetical model is proposed that highlights the overexpression of human ALX receptor in regulation of acute inflammation and host defense. For example, in neutrophil-driven responses, diverse stimuli can recruit PMN, which at the initial or early phases leads to activation of intracellular NFB to produce and amplify production of more protein and lipid-derived mediators that enhance the inflammatory response and inflammation. This amplification increases PMN infiltration with time, which can also give rise to inappropriate tissue damage and the known role of PMN within the tissue damage cycle (1
, 24)
. Introduction of human ALX in a myeloid-selective manner amplifies the ability of ALX counter-regulatory circuits and renders them more sensitive to the levels of endogenous as well as exogenously administered lipoxin A4. Activation of this receptor then leads to a diminished number of PMN infiltrating the tissue. During the dynamic time course of a neutrophil-driven acute inflammatory response, this amplified hALX pathway not only counter-regulates proinflammatory pathways (as those reviewed in refs 4
, 5
) including the NFB pathway (Figs. 1
, 5)
, but also stimulates expression in human cells of a protective gene cascade (25)
. Modulation of NFB activity and the importance of tight regulation of this activity during the time course of an acute inflammatory response and subsequent resolution are consistent with results from several research groups (for a recent review, see ref 26
). Although much is known about the link between NFB and the production of cytokine proinflammatory mediators, our results suggest that NFB might affect production of lipoxygenase-derived proinflammatory mediators. Whether this is a direct or indirect action remains to be determined. This difference or shift in lipoxygenase-derived products suggests that the temporal expression and activity of the lipoxygenase enzymes is different in transgenic hALX mice from their nontransgenic littermates. This proposed model of ALX involvement in molecular dynamics of inflammation is consistent with results in Figs. 3
4
5
6
7
and leads to the notion that these events can diminish set-points within contained exudates to give shortened intervals for resolution of inflammation.
In the dynamic complexity of acute inflammation and host defense, the outcome can be influenced to a large extent by two main classes of molecules: 1) the extracellular mediators (exogenous and endogenous) and/or communicating signals generated from within; and 2) the receptors that receive and transmit these signals within the effector cells (5
, 12
, 27)
. The results presented here indicate that, in vivo, amplifying a protective receptor circuit can have a downstream effect on signal generation to reduce the number of PMN infiltrating into tissues and modulate an exudate set-point (i.e., the leukocyte cell number and soluble mediators present). Thus, a successful outcome for the host both in instigating a response and resolving it not only requires triggering the appropriate signaling circuit with temporal precision and amplitude, but is a measure of availability and sensitivity of the receptor circuit. Given these initial characterizations, the hALX transgenic mouse offers new avenues for charting protective counter-regulation in host defense and inflammatory responses relevant in human disease.
|
ACKNOWLEDGMENTS |
|---|
Received for publication August 28, 2002. Accepted for publication December 9, 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
–leukotriene B4 pathway to inflammation control. Nature (London) 384,39-43[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  D. G. Souza, C. T. Fagundes, F. A. Amaral, D. Cisalpino, L. P. Sousa, A. T. Vieira, V. Pinho, J. R. Nicoli, L. Q. Vieira, I. M. Fierro, et al. The Required Role of Endogenously Produced Lipoxin A4 and Annexin-1 for the Production of IL-10 and Inflammatory Hyporesponsiveness in Mice J. Immunol., December 15, 2007; 179(12): 8533 - 8543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Arita, T. Ohira, Y.-P. Sun, S. Elangovan, N. Chiang, and C. N. Serhan Resolvin E1 Selectively Interacts with Leukotriene B4 Receptor BLT1 and ChemR23 to Regulate Inflammation J. Immunol., March 15, 2007; 178(6): 3912 - 3917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Chiang, C. N. Serhan, S.-E. Dahlen, J. M. Drazen, D. W. P. Hay, G. E. Rovati, T. Shimizu, T. Yokomizo, and C. Brink The Lipoxin Receptor ALX: Potent Ligand-Specific and Stereoselective Actions in Vivo Pharmacol. Rev., September 1, 2006; 58(3): 463 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Arita, M. Yoshida, S. Hong, E. Tjonahen, J. N. Glickman, N. A. Petasis, R. S. Blumberg, and C. N. Serhan Resolvin E1, an endogenous lipid mediator derived from omega-3 eicosapentaenoic acid, protects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis PNAS, May 24, 2005; 102(21): 7671 - 7676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kurosaka, Q. Chen, F. Yarovinsky, J. J. Oppenheim, and D. Yang Mouse Cathelin-Related Antimicrobial Peptide Chemoattracts Leukocytes Using Formyl Peptide Receptor-Like 1/Mouse Formyl Peptide Receptor-Like 2 as the Receptor and Acts as an Immune Adjuvant J. Immunol., May 15, 2005; 174(10): 6257 - 6265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fukunaga, P. Kohli, C. Bonnans, L. E. Fredenburgh, and B. D. Levy Cyclooxygenase 2 Plays a Pivotal Role in the Resolution of Acute Lung Injury J. Immunol., April 15, 2005; 174(8): 5033 - 5039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Gronert, N. Maheshwari, N. Khan, I. R. Hassan, M. Dunn, and M. Laniado Schwartzman A Role for the Mouse 12/15-Lipoxygenase Pathway in Promoting Epithelial Wound Healing and Host Defense J. Biol. Chem., April 15, 2005; 280(15): 15267 - 15278. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. L. Bannenberg, N. Chiang, A. Ariel, M. Arita, E. Tjonahen, K. H. Gotlinger, S. Hong, and C. N. Serhan Molecular Circuits of Resolution: Formation and Actions of Resolvins and Protectins J. Immunol., April 1, 2005; 174(7): 4345 - 4355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. R. Devchand, B. A. Schmidt, V. C. Primo, Q.-y. Zhang, M. A. Arnaout, C. N. Serhan, and B. Nikolic A synthetic eicosanoid LX-mimetic unravels host-donor interactions in allogeneic BMT-induced GvHD to reveal an early protective role for host neutrophils FASEB J, February 1, 2005; 19(2): 203 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Chen, D. Wade, K. Kurosaka, Z. Y. Wang, J. J. Oppenheim, and D. Yang Temporin A and Related Frog Antimicrobial Peptides Use Formyl Peptide Receptor-Like 1 as a Receptor to Chemoattract Phagocytes J. Immunol., August 15, 2004; 173(4): 2652 - 2659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ohira, G. Bannenberg, M. Arita, M. Takahashi, Q. Ge, T. E. Van Dyke, G. L. Stahl, C. N. Serhan, and J. A. Badwey A Stable Aspirin-Triggered Lipoxin A4 Analog Blocks Phosphorylation of Leukocyte-Specific Protein 1 in Human Neutrophils J. Immunol., August 1, 2004; 173(3): 2091 - 2098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. McMahon and C. Godson Lipoxins: endogenous regulators of inflammation Am J Physiol Renal Physiol, February 1, 2004; 286(2): F189 - F201. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) represent hALX receptor-expressing cells and open squares (
) are pcDNA3 cells without hALX receptor exposed to ATLa at the indicated concentrations. Results represent mean ± SE of n= 4 separate experiments, each performed in duplicate. *P< 0.02.
