FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by CASAS, F.
Right arrow Articles by WRUTNIAK-CABELLO, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by CASAS, F.
Right arrow Articles by WRUTNIAK-CABELLO, C.
(The FASEB Journal. 2003;17:426-436.)
© 2003 FASEB

Endocrine regulation of mitochondrial activity: involvement of truncated RXR{alpha} and c-Erb A{alpha}1 proteins

FRANÇOIS CASAS*, LAETITIA DAURY*, STÉPHANIE GRANDEMANGE*, MURIEL BUSSON*, PASCAL SEYER*, RENÉE HATIER{dagger}, ANGEL CARAZO*, GÉRARD CABELLO*1 and CHANTAL WRUTNIAK-CABELLO*

* UMR-866 Différenciation Cellulaire et Croissance (INRA-UMII-ENSAM), Unité d’Endocrinologie Cellulaire, Institut National de la Recherche Agronomique (INRA), 34060 Montpellier Cedex 1, France; and
{dagger} EMI INSERM 0014, Laboratoire de Microscopie Electronique, Faculté de Médecine, BP 184, 54505 Vandoeuvre-lès-Nancy Cedex, France

1Correspondence: UMR-866 Différenciation Cellulaire et Croissance, Unité d’Endocrinologie Cellulaire, Institut National de la Recherche Agronomique, 2 place Viala, 34060 Montpellier Cedex 1, France. E-mail: cabello{at}ensam.inra.fr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The importance of mitochondrial activity has recently been extended to the regulation of developmental processes. Numerous pathologies associated with organelle’s dysfunctions emphasize their physiological importance. However, regulation of mitochondrial genome transcription, a key element for organelle’s function, remains poorly understood. After characterization in the organelle of a truncated form of the triiodothyronine nuclear receptor (p43), a T3-dependent transcription factor of the mitochondrial genome, our purpose was to search for other mitochondrial receptors involved in the regulation of organelle transcription. We show that a 44 kDa protein related to RXR{alpha} (mt-RXR), another nuclear receptor, is located in the mitochondrial matrix. We found that mt-RXR is produced after cytosolic or intramitochondrial enzymatic cleavage of the RXR{alpha} nuclear receptor. After mitochondrial import and binding to specific sequences of the organelle genome, mt-RXR induces a ligand-dependent increase in mitochondrial RNA levels. mt-RXR physically interacts with p43 and acts alone or through a heterodimerical complex activated by 9-cis-retinoic acid and T3 to increase RNA levels. These data indicate that hormonal regulation of mitochondrial transcription occurs through pathways similar to those that take place in the nucleus and open a new way to better understand hormone and vitamin action at the cellular level.—Casas, F., Daury, L., Grandemange, S., Busson, M., Seyer, P., Hatier, R., Carazo, A., Cabello, G., Wrutniak-Cabello, C. Endocrine regulation of mitochondrial activity: involvement of truncated RXR{alpha} and c-Erb A{alpha}1 proteins.


Key Words: mitochondrial import • mitochondrial transcription • mt-DNA • triiodothyronine • 9-cis-retinoic acid


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ALTHOUGH THE ROLEof mitochondria has long been restricted to their influence on fuel metabolism, the importance of organelle activity has more recently been extended to the regulation of developmental processes. Mitochondria play a key role in induction of apoptosis (1) . Several studies have established that organelle activity is involved in regulation of cell proliferation and differentiation independently of ATP production (2 3 4 5) . The physiological relevance of this reevaluation has been emphasized by the observation that disruption of the mt-TFA gene (tfam) encoding a constitutive mitochondrial transcription factor led to embryonic lethality (6) . It is also well supported by the extreme severity of diseases induced by rearrangements of the mitochondrial genome. This set of data highlights the requirement for tight regulation of mitochondrial activity for proper development.

Given this physiological importance of the organelle, the observation that several hormones regulate mitochondrial activity was not unexpected (7 8 9 10 11 12 13 14 15) , but requires new studies in order to characterize the pathways involved in this regulation. This knowledge could bring new ways to better understand mitochondrial deficiencies associated with degenerative diseases. Characterization of hormonal receptors in the organelle (16) has provided new insight into the regulation of mitochondrial genome transcription. p43, a truncated version of the triiodothyronine nuclear receptor c-Erb A {alpha}1 (NR1A1 according to the Nuclear Receptors Nomenclature Committee, 1999), acts as a triiodothyronine (T3)-dependent transcription factor of the organelle (17) . p43 bound to specific mitochondrial DNA sequences and increased RNA steady-state levels in the organelle, with a latency period of <5 min (17) . We found that p43 bound to a DR2 sequence located in the mitochondrial D-loop by forming a complex with a 45 kDa truncated form of another member of the nuclear receptor superfamily, PPAR{gamma}2 (18) . These data enabled us to clarify the direct regulation of mitochondrial transcription by thyroid hormone (10 , 13 , 19) and provided an additional explanation of the thyromimetic influence of fibrates reported in other studies (8 , 20) . This observation, which already suggested that mitochondrial genome transcription could be regulated in a similar way to nuclear transcription, also raised the question of the identity of proteins interacting with p43 on four other response elements recorded in the mitochondrial genome sequence (21) .

In the nucleus, RXR receptors display two kinds of activity. They act as 9-cis-retinoic acid-dependent transcription factors that bind DR1 response elements found in the promoter of target genes. However, they are also major partners for other nuclear receptors such as VDR, RAR, PPAR, and T3R by forming heterodimers and supporting the transcriptional activity of each specific ligand (22 , 23) . A striking observation is that disruption of the RXR{alpha} gene induces embryonic lethality associated with cardiac failure and alterations in mitochondrial gene expression (24) and that an adipocyte targeted RXR{alpha} suppression in 4-wk-old mice induces severe hypothermia during fasting (25) . Conversely, retinoic acid up-regulates mitochondrial gene expression (26 , 27) ; vitamin A, the precursor of naturally occurring retinoids, influences mitochondrial activity in rat liver and heart (7 , 11) . All these data implying a retinoid influence at mitochondrial level led us to search for the presence of RXR-related proteins in the organelle.

We report here the existence of a 44 kDa protein related to RXR{alpha} in the mitochondrial matrix. This protein, produced by enzymatic cleavage of the RXR{alpha} nuclear receptor, is imported into mitochondria, binds to specific sequences of the organelle genome, and induces alone or through a heterodimerical complex a ligand-dependent increase in mitochondrial RNA levels.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Mitochondria preparations
Male Wistar rats (body weight 200–300 g) were used in all experiments. Liver mitochondria were prepared by differential centrifugations and purified using a sucrose gradient (1.02/1.68M) (28) . Mitoplast, outer membrane, intermembrane, and matrix fractions were obtained as described previously (29) . The purity of submitochondrial fractions (data not shown) was tested by measuring the specific activities of monoamine oxidase (30) (outer membrane), malate dehydrogenase (30) (matrix), and cytochrome oxidase (inner membrane).

Western blot analysis and antibodies
Mitochondrial extracts (50 µg) were electrophoresed onto 10% SDS-PAGE gels and blotted onto PDVF membranes. Mouse RXR{alpha} protein used as control was synthesized in vitro using reticulocyte lysate (Promega, Madison, WI, USA). The presence of RXR{alpha} polypeptides was assessed with either the polyclonal antibody RPRX{alpha}(A) raised against an RXR{alpha} amino terminus epitope or two monoclonal antibodies (4RX-3A2, 1RX-6G12) raised against epitopes in the RXR{alpha} D-E domains (31) . Signals were revealed using a chemiluminescent Western blot procedure (ECF kit, Amersham, Arlington Heights, IL, USA) and analyzed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA, USA).

Electron microscopy
Electron microscopy was performed on Wistar liver preparations (ultramicrotomy and immunolabeling). Specimens were fixed with 4% paraformaldehyde/0.1% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4, for 3 h at 4°C and rinsed in the same buffer. After dehydration in a graded series of ethanol, liver samples were embedded in Bioacryl (Tebu, France) overnight at room temperature. Polymerization was performed under UV light for 72 h at 4°C. Ultrathin frozen sections were collected on formvar-coated nickel grids. Sections were rehydrated in 0.1 M sodium cacodylate, pH 7.4, then incubated overnight at 4°C with 4RX-3A2 antibody (diluted 1/5000 in 0.1 M sodium cacodylate, pH 7.4). After several washes, sections were incubated with gold-conjugated protein A (diluted 1/100) for 1 h. They were then washed and fixed in 1% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4. Sections used as negative controls were incubated with preabsorbed 4RX-3A2 antibody (diluted 1/5000 in 0.1 M sodium cacodylate, pH 7.4). Ultrathin sections were slightly contrasted with uranyl acetate and examined with a Philips CM12 electron microscope.

RXR{alpha} cleavage experiments
For calpain cleavage experiments, 3 µL of in vitro translated protein product was mixed with m-calpain (Sigma, St. Louis, MO, USA) and 5 µL of 400 mM Tris-HCL pH 7.5/24 mM CaCl2/2 mM DTT at 30°C as described (32) . After 30 min, reactions were stopped by the addition of 2x Laemmli buffer. The resulting product was run on SDS gels and analyzed using a PhosphorImager (Molecular Dynamics).

Mitochondrial import
Import experiments were performed as described previously (17) using highly purified isolated rat liver mitochondria. After import experiments, mitochondria were treated with proteinase K for 10 min at 4°C; 10% of the amount of reticulocyte lysate added to mitochondria for import experiments was loaded in the control lane. Mitoplasts were prepared by digitonin treatment, mitochondria and rabbit reticulocyte lysate were depleted in ATP and ADP by apyrase, and the organelle membrane potential was decreased by addition of 1 µM fluoryl cyanide m-chlorophenylhydrazone (FCCP) in the incubation medium.

EMSA experiments
EMSA were performed as described previously (16) , with [32P]-labeled oligonucleotide probes corresponding to the mitochondrial T3RE-like sequences identified on the Rattus norvegicus mitochondrial genome. These sequences were 12S (acgttAGGTCAAGGTGTaggc); 16S (agcgCGACCTatttaagAGTTCAtatc); DR2 (gtcaAGGCATgaAGGTCAgcac); RSV-TRE (ttgaTGCCTTcctcaacatagccgtcAAGGCAtgaag); IP6 (ccaaTGACCTaaaaccAGGTGActtc). Binding specificity was assessed by the parallel use of an unrelated probe (agcttctctgtgatttaatgccagcgcg). Highly purified mitochondrial protein extracts were prepared on heparin agarose columns, as described (16) . The presence of mt-RXR and p43 in the binding complex was assessed respectively with monoclonal antibodies 4RX-3A2 and LA038 (Quality Biotech, Camden, NJ, USA) raised against a specific sequence of the DNA binding domain of c-Erb A. An antibody raised against GST was used as a control.

Coimmunoprecipitation experiments
Immunoprecipitations of mitochondrial proteins were performed with antisera raised against RXR{alpha} (4RX-3A2) (31) , c-Erb A (RHTII) (16) , and ADP/ATP translocator. Purified mitochondrial matrix extracts (200 µg) were mixed with 1 µL of antiserum and 300 µL of binding buffer (HEPES 50 mM, NaCl 400 mM, Nonidet P40 1%, Aprotinin 1 µg/mL, phenylmethylsulfonyl fluoride 100 µg/mL) for 3 h at 4°C. Samples were incubated with 30 µL of protein G-Sepharose for 1 h at 4°C and washed four times with binding buffer. Antibodies specificities were assessed using [35S]-p43, [35S]-RXR{alpha}/Cp, or [125I]-ANT.

In organello mitochondrial transcription assays and Northern blot analysis
As described previously (33) , transcription assays were performed using isolated rat liver mitochondria at a final concentration of 2 mg of protein/mL in 0.5 mL of incubation buffer (sucrose 25 mM, sorbitol 75 mM, KCl 100 mM, K2HPO4 10 mM, EDTA 0.5 mM, MgCl2 5 mM, ATP 1 mM, glutamate 10 mM, malate 2.5 mM, Tris pH7.4 10 mM, BSA 1 mg/mL). Incubation was at 37°C for 60 min in the presence of 5 µL of rabbit reticulocyte lysate (containing RXR{alpha}/Cp, p43 or unprogrammed lysate for control). Mitochondrial RNA was extracted twice at room temperature (33) , then analyzed by electrophoresis through 1.4% formaldehyde-agarose gels and transferred onto a nylon membrane. Membranes were prehybridized at 65°C for 30 min (0.5 M phosphate buffer, 1 mM EDTA, 7% SDS, 1% BSA), and [32P]dCTP-labeled DNA probes were added. Specific DNA probes for the mouse mitochondrial cytochrome c oxydase subunit III (COX III) and NADH subunit I (ND I) were generated by PCR (17) . Hybridization was performed at 65°C for 24 h. After hybridization, membranes were washed according to the following protocol: 2x SSC buffer, 5 min at 65°C (25 mM phosphate buffer, 0.25% SDS and where 1x SSC is 150 mM NaCl, 15 mM sodium citrate); 0.6x SSC buffer, 2x 20 min at 65°C; 0.1x SSC buffer, 5 min at 65°C. Membranes were analyzed using a PhosphorImager (Molecular Dynamics).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
A 44kDa RXR{alpha}-related protein is located in the matrix of rat liver mitochondria
Highly purified rat liver mitochondrial extracts devoid of any significant contaminations by extramitochondrial components (16; unpublished results) were used to search for the possible occurrence of 9-cis retinoic acid receptors in the organelle (Fig. 1 A–C). A RXR{alpha}-related protein with an apparent molecular mass in SDS-PAGE of ~44 kDa was observed by immunoblotting analysis using two specific RXR{alpha} antibodies raised respectively against sequences overlapping the hinge domain and the ligand binding domain of the receptor (4RX-3A2), and located in the carboxyl-terminal part of the receptor (1RX-6G12) (Fig. 1A ). Western blot performed with an antibody raised against the NH2 terminus of RXR{alpha} (RPRX{alpha}) failed to detect any signal (Fig. 1A ). After mitochondrial subfractionation, we showed that the 44 kDa protein was detected in the matrix fraction (Fig. 1C ). We have thus provided the first evidence of the occurrence of a 44kDa protein immunologically related to RXR{alpha} in rat liver mitochondrial matrix (mt-RXR). We failed to detect this truncated protein in rat liver nuclear extracts, which indicates it displays a specific mitochondrial localization (data not shown).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. Identification of a RXR{alpha}-related protein in rat liver mitochondria. A) Western blot experiments were performed using 50 µg of highly purified mitochondrial extracts devoid of any nuclear contamination. Reference of the antibody used is indicated in the bottom of each blot; RXR{alpha} synthesized in reticulocyte lysate was used as a positive control. 1RX-6G12 antibody is raised against the RXR{alpha} E domain; 4RX-3A2 antibody is raised against the RXR{alpha} D/E domain; RXPR{alpha}(A) antibody is raised against the RXR{alpha} A/B domain. These antibodies were characterized by Rochette-Egly et al. (1995). Proteins were detected by a chemioluminescence procedure (ECF kit, Amersham) and analyzed using a PhosphorImager. Mito, highly purified mitochondrial extracts. B) Schematic comparison of the full-length RXR{alpha} receptor and mitochondrial RXR{alpha}-related protein resulting from SDS-PAGE experiments. C) mt-RXR is located in mitochondrial matrix. Western blot experiments using purified whole mitochondrial extracts, mitochondrial membrane preparations, or mitochondrial matrix extracts, and 4RX-3A2 antibody. Mito, highly purified mitochondrial extracts; Mb, mitochondrial membrane preparation; MA, mitochondrial matrix extracts.

In agreement with this set of data, using 4RX-3A2 antibody in electron microscopy studies we directly observed a specific liver mitochondrial labeling that does not appear when using the RXR{alpha} preabsorbed antibody (Fig. 2 A, C). Labeling associated with the organelle was at least as important as that recorded in nuclei (Fig. 2A, B ).



View larger version (67K):
[in this window]
[in a new window]
 
Figure 2. Observation of an RXR{alpha} related protein in rat liver mitochondria by electron microscopy (x45,000). A, B) Mitochondrial and nuclear labeling using 4RX-3A2 antibody. C) Absence of significant labeling in mitochondria after incubation with preabsorbed 4RX-3A2 antibody. Number of gold particles/area viewed (µm2) from 5 different preparations: A, 161/6.58; B, 63/5.74; C, 11/7.91. Number of gold particles/µm2: A, 24; B, 11; C, 1. Scale bar: 0.2 µm; M, mitochondria; N, nucleus; N-Mb, nuclear membrane.

RXR{alpha} nuclear receptor is cleaved by m-calpain or intramitochondrial calpain-like activity
Several arguments led us to test the possibility that the mitochondrial 44 kDa-RXR{alpha}-related protein could be a truncated version of the nuclear receptor. Previous studies reported the presence in hepatocytes of a 44kDa RXR{alpha} protein resulting from the amino-terminal cleavage of the nuclear receptor (34 35 36) . This cleavage significantly reduces the amounts of RXR{alpha} located in the nucleus, suggesting an extranuclear location for this truncated protein (35) . Consequently, we examined the possibility that this protein could be addressed to mitochondria. We performed digestion experiments with [35S]-RXR{alpha} synthesized in rabbit reticulocyte lysate as described by Noguchi et al. (32) (Fig. 3 A, B). According to Matsushima-Nishiwaki et al. (34) , we found that m-calpain (Sigma) efficiently cleaved [35S]-RXR{alpha} to generate a 44 kDa protein (Fig. 3A ). As shown for the mitochondrial RXR{alpha}-related protein, the absence of a signal in Western blot experiments using an antibody raised against the A/B domain (Fig. 3B ) proved that the truncated RXR{alpha} protein produced by m-calpain cleavage (RXR{alpha}/Cp) was deleted from the receptor amino-terminal domain. Mobility of the resulting protein in SDS-PAGE was similar to that recorded for mt-RXR (Fig. 3C ).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. RXR{alpha} is cleaved by m-calpain. A) Digestion experiments were performed as described by Noguchi et al. (32) using [35S]-RXR{alpha} synthesized in reticulocyte lysate and purified m-calpain (Sigma) used in two concentrations (0.5 and 1 unit). B) After cleavage, RXR{alpha} lacks the NH2 terminus of the nuclear receptor. Western blot experiments using RXR{alpha} synthesized in reticulocyte lysate and truncated RXR{alpha} produced by m-calpain cleavage of the nuclear receptor (RXR{alpha}/Cp) and RPXR{alpha}(A) antibody. C) Truncated RXR{alpha} product has a molecular mass similar to mt-RXR. Western blot experiment using RXR{alpha}/Cp, purified mitochondrial extracts and 4RX-3A2 antibody. Mito, highly purified mitochondrial extracts.

In addition to cytosolic calpain, several studies have reported the occurrence of a calpain-like activity in mitochondria (37 38 39) . To test the possibility that such activity in mitochondria could cleave RXR{alpha}, we performed digestion experiments by incubating [35S]-RXR{alpha} synthesized in rabbit reticulocyte lysate with 1) whole mitochondrial extracts, 2) proteins belonging to mitoplast, 3) proteins belonging to mitochondrial outer membrane and intermembrane space, 4) mitochondrial outer and inner membranes extracts (Fig. 4 A). We found that protein extracts from whole mitochondria and outer membrane/intermembrane space efficiently cleaved [35S]-RXR{alpha} to generate a 44 kDa protein (Fig. 4A ), whereas mitoplast and outer membrane/inner membrane extracts failed to do so (Fig. 4A ). Therefore, it appeared that proteolytic activity is restricted to the mitochondrial intermembrane space. To exclude the possibility that the full-length RXR{alpha} could be cleaved by some cytosolic proteases copurified with mitochondria, we performed digestion experiments by incubating [35S]-RXR{alpha} with the supernatant collected after mitochondrial removal from the incubation medium used in these assays. That no cleavage was recorded in these conditions strongly argues in favor of the occurrence of an intramitochondrial cleavage (Fig. 4B ).



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. RXR{alpha} is cleaved by a mitochondrial calpain-like activity. A) RXR{alpha} is cleaved by proteolytic activity within the mitochondrial intermembrane space. Digestion experiments were performed using [35S]-RXR{alpha} synthesized in reticulocyte lysate and mitochondrial fractions obtained as described previously. Mito, highly purified mitochondrial extracts; IMS/OM, intermembrane space and outer mitochondrial membrane extracts; OM/IM, outer and inner mitochondrial membrane extracts. B) RXR{alpha} is not cleaved by contaminating cytosolic proteases copurified with mitochondria. Digestion experiments were performed using [35S]-RXR{alpha} and supernatant collected after mitochondrial removal from the incubation medium. C) RXR{alpha} is cleaved by mitochondrial calpain-like activity. Digestion experiments were performed using [35S]-RXR{alpha} and mitochondrial extracts in the presence of several protease inhibitors (EGTA, ALLN, EDTA, antipain, leupeptin, pepstatin, aprotinin, and PMSF).

To extend our knowledge of proteolytic activity involved in intramitochondrial RXR{alpha} cleavage, several protease inhibitors were used in digestion experiments performed by incubating [35S]-RXR{alpha} with whole mitochondrial extracts. We found that proteolytic cleavage of the nuclear receptor was inhibited by cysteine protease inhibitors, such as antipain and leupeptin, and by a calpain inhibitor such as ALLN (Fig. 4C ). However, it was not inhibited by most serine protease inhibitors (aprotinin, PMSF), metalloprotease inhibitors (EDTA, EGTA), or an aspartate protease inhibitor (pepstatin) (Fig. 4C ). These data imply that the enzymatic activity is related a cysteine protease belonging to the calpain family, in agreement with previous studies describing a calpain-like activity in mitochondria (37 38 39) . We observed that cytosolic m-calpain or mitochondrial calpain-like activity generated truncated RXR{alpha} products with a similar apparent molecular weight. All these data raised the possibility that mt-RXR could be a truncated form of RXR{alpha} resulting from cleavage by cytosolic m-calpain or by mitochondrial calpain-like activity.

After cytosolic or intramitochondrial enzymatic cleavage, RXR{alpha} is imported into the mitochondrial matrix
To test the possibility that after cleavage, RXR{alpha} could be addressed to mitochondria, we studied the import of [35S]-RXR{alpha} or of [35S]-RXR{alpha}/Cp in isolated rat liver mitochondria as described previously for p43 (17) (Fig. 5 A–D). At the end of the import experiment, the reaction mixture was treated with proteinase K to rule out contamination by nonimported proteins. In these conditions, we found that both proteins are protected against proteolytic activity inside the organelles (Fig. 5 , lanes 3, 7). The observation that after import, RXR{alpha} and RXR{alpha}/Cp protein sensitivity to proteinase K is restored after solubilization of mitochondrial membranes by a detergent treatment (Fig. 5A , lanes 4, 8), conclusively demonstrated that protection of RXR{alpha} proteins to peptidase enzyme is provided by mitochondrial membranes. Therefore, these data establish that both RXR{alpha} proteins are translocated into the organelle. However, whereas RXR{alpha}/Cp was not cleaved during the import processes, the apparent molecular mass of full-length RXR{alpha} decreased to 44 kDa after internalization (Fig. 5A , lane 3).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. RXR{alpha} synthesized in vitro is imported into mitochondria. A–D) Import experiments were performed in isolated mitochondria using [35S]-RXR{alpha} or [35S]-RXR{alpha}/Cp. A) Lanes 1, 5: RXR{alpha} and RXR{alpha}/Cp alone; lanes 2, 6: RXR{alpha} and RXR{alpha}/Cp are sensitive to proteinase K; lanes 3, 7: RXR{alpha} and RXR{alpha}/Cp are internalized in mitochondria as shown by the acquired protection against proteinase K added at the end of the experiment; lanes 4, 8: at the end of the experiment, protection of RXR{alpha} and RXR{alpha}/Cp against proteinase K is abolished by solubilization of mitochondrial membranes by Tris-NP-40. B) Influence of outer membrane removal using mitoplast (lanes 3, 8); influence of depletion of mitochondrial ATP stores by apyrase (lanes 4, 9) or membrane potential dissipation by FCCP (lanes 5, 10) on RXR{alpha} or RXR{alpha}/Cp mitochondrial import. C) Influence of T3 (10-8M), RA (10-8M) and ALLN (calpain inhibitor) on RXR{alpha} mitochondrial import. D) Time-related changes in the amounts of labeled RXR{alpha} or RXR{alpha}/Cp imported into mitochondria.

To extend our knowledge of mitochondrial import of RXR{alpha} proteins, we used mitoplasts (mitochondria deleted from the outer membrane) or pharmacological agents such as apyrase (ATP/ADP phosphatase) and FCCP, respectively, to deplete ATP stores in the organelle and dissipate membrane potential. First, RXR{alpha}/Cp translocation effectively occurred in mitoplast, ruling out the necessity to interact with the translocator outer membrane complex (Fig. 5B , lane 8). Second, it was not abrogated by an FCCP-induced dissipation of mitochondrial membrane potential and remained unaltered by depletion of ATP stores by apyrase (Fig. 5B , lanes 9, 10). In parallel experiments, we found that the full-length receptor was not imported into mitoplasts, indicating that RXR{alpha} amino-terminal cleavage in the intermembrane space by a calpain-like activity is a prerequisite for its translocation through the inner membrane (Fig. 5B , lane 3). Using integral organelle, this import was, as observed for RXR{alpha}/Cp, independent of ATP stores or mitochondrial membrane potential (Fig. 5B , lanes 4, 5). Last, we found that RXR{alpha} import was not influenced by thyroid hormone or retinoic acid (Fig. 5 C , lanes 3, 4). In this set of import experiments, we established that in the calpain inhibitor (ALLN) presence, only the full-length RXR{alpha} form, unable to reach the matrix, is detected in mitochondria, as shown by protection against external proteinase K (Fig. 5 C , lane 5). This conclusively demonstrates that intramitochondrial cleavage of RXR{alpha} occurs in the intermembrane space after its internalization in the organelle.

We studied the time course of RXR{alpha} and RXR{alpha}/Cp import (Fig. 5D ). RXR{alpha}/Cp was detected in mitochondria within the first minutes of the experiment; in addition, the maximal mitochondrial RXR{alpha}/Cp level was recorded after 15 min of incubation and did not change thereafter, suggesting the involvement of a saturable import process (Fig. 5D ). We observed that significant amounts of the truncated protein were only detected in mitochondria after 15 min of incubation when using full-length RXR{alpha}. This more delayed import probably results from the additional step of RXR{alpha} cleavage in the intermembrane space.

mt-RXR binds to specific sequences of the mitochondrial genome in complex with p43
The apparent molecular mass of mt-RXR in SDS-PAGE suggests that amino-terminal cleavage occurs some amino acids upstream the DNA binding domain of the nuclear receptor (Fig. 1B ), raising the possibility that like its nuclear counterpart, it could bind to specific sequences of the mitochondrial genome. Several sequences homologous to nuclear hormone response elements have already been described in the mitochondrial genome (21) . We performed EMSA experiments using these sequences as probes and highly purified mitochondrial extracts devoid of any significant nuclear contamination.

In agreement with a previous report (17) , we found that a mitochondrial protein complex specifically bound to all specific probes (Fig. 6 ). In contrast, no binding was detected using a probe corresponding to another D-loop sequence (NS; Fig. 6 ), indicating that this complex only binds to particular sequences of the mitochondrial genome. Binding specificity was demonstrated by efficient removal of the radioactive complex resulting from the addition of an excess of the corresponding cold probe in association with the inability of an unrelated DNA probe to compete for binding (Fig. 6) . Whatever the probe used in EMSA experiments, this mitochondrial complex displayed the same migration pattern, suggesting that a common complex binds to all probes. Preincubation of mitochondrial extracts with an antibody raised against RXR{alpha} fully abrogated this binding, but unrelated antibodies (raised against GST) did not, indicating that mt-RXR is a component of this complex (Fig. 6) . The first indication that mt-RXR could heterodimerize with p43 (mitochondrial truncated form of c-Erb A{alpha}1) was provided by data demonstrating that preincubation of mitochondrial extracts with an antibody raised against c-Erb A prevented such binding (Fig. 6) .



View larger version (105K):
[in this window]
[in a new window]
 
Figure 6. mt-RXR specifically binds to several sequences of the mitochondrial genome by forming a complex with p43. EMSA experiments were performed using 0.7 µg of mitochondrial protein extract purified by passage onto a heparin-agarose column (mt-hep) and specific [32P]-labeled nucleotidic probes. When indicated, an excess (100-fold molar excess) of cold-specific or unrelated probe (a sequence belonging to the myogenin promoter) was added to assess binding specificity. When indicated, monoclonal antibodies (Ab) raised respectively against RXR{alpha} (4RX-3A2), c-Erb A (LA038, Quality Biotech), and GST were incubated for 15 min with the mitochondrial extract before the addition of the labeled probe. A mitochondrial probe (NS; gactatactgaaactttaccag) corresponding to the Rattus norvegicusmitochondrial genome positions 15744 to 15765, was used to demonstrate that mt-RXR and p43 bind to particular sequences of the mitochondrial genome.

To test the possibility that mt-RXR could heterodimerize with p43, we performed coimmunoprecipitation experiments using highly purified mitochondrial extracts (Fig. 7 A–E). We found that p43 was coimmunoprecipitated by an antibody raised against RXR{alpha} and, conversely, that mt-RXR was coimmunoprecipitated by an antibody raised against c-Erb A (Fig. 7B ). Additional experiments ruled out the possibility that this observation could result from antibodies cross-reactivity (Fig. 7C-E ).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 7. mt-RXR and p43 physically interact in mitochondria. A) p43 was coimmunoprecipitated by an antibody raised against RXR{alpha}. Immunoprecipitation experiments were performed using mitochondrial protein extracts purified by passage onto a heparin-agarose column (300 µg) and with antibodies (Ab) raised respectively against RXR{alpha} (4RX-3A2), c-Erb A (RHTII), or ADP/ATP translocase (anti-ANT). Western blot experiments using RHTII antiserum. B) mt-RXR was coimmunoprecipitated by an antibody raised against c-Erb A. Immunoprecipitation experiments were performed with antibodies raised respectively against RXR{alpha} (4RX-3A2), c-Erb A (RHTII), or ADP/ATP translocase (anti-ANT). Western blot experiments using 4RX-3A2 antibody. C) 4RX-3A2 antibody does not cross-react with [35S]-p43, as shown by the absence of a radioactive signal in immunoprecipitation experiments performed in the absence of [35S]-RXR{alpha}/Cp. D) RHTII does not cross-react with [35S]-RXR{alpha}/Cp, as shown by the absence of a radioactive signal in immunoprecipitation experiments performed in the absence of [35S]-p43. E) As a positive control concerning functionality of the antibody raised against purified ANT, purified [125I]-ANT is immunoprecipitated by anti-ANT. F) mt-RXR levels in mitochondria collected from different tissues. Western blot experiments using purified mitochondrial extracts (50 µg) from brain, heart, liver, spleen, kidney, gastronemius, soleus, and white adipose tissue (WAT) and with 4RX-3A2 antibody.

Finally, we assessed the relative mitochondrial amounts of mt-RXR in several tissues. Mt-RXR was detected in mitochondria collected from all tissues tested but the brain (Fig. 7F ). The highest amounts of the protein were found in liver organelles (Fig. 7F ). These data underscore that mt-RXR levels displays a strong tissue specificity, close to that reported for p43 (18) .

Mt-RXR is a ligand-dependent transcription factor of the mitochondrial genome
To elucidate the function of mitochondrial RXR{alpha} protein, by analogy with p43 (17) , we examined directly the ability of mt-RXR to activate mitochondrial genome transcription in in organello transcription experiments using isolated rat liver mitochondria, RXR{alpha}/Cp, and/or p43 proteins synthesized in rabbit reticulocyte lysate (Fig. 8 A, B).



View larger version (94K):
[in this window]
[in a new window]
 
Figure 8. mt-RXR induces a ligand-dependent increase in mitochondrial RNA levels. A, B) In organello transcription experiments were performed using isolated rat liver mitochondria and unprogrammed reticulocyte lysate as control, RXR{alpha}/Cp or p43. After in organello transcription and Northern blot experiments, precursor transcripts were detected after hybridization with mitochondrial probes. Mitochondrial precursor transcripts were detected using a COX III probe. Mature mitochondrial RNA levels were detected using an ND1 probe. Where indicated, 10-8 M T3 or 5.10-8 M 9-cis-retinoic acid was added to the incubation medium.

Using a COX III probe, two precursor transcripts were detected by Northern blot in mitochondria incubated in the presence of RXR{alpha}/Cp or p43 (Fig. 8A ). Detection of these transcripts in mitochondria incubated in the presence of unprogrammed rabbit reticulocyte lysate required a much longer film exposure (up to 3 days vs. 20 min, data not shown). However, since both strands of mt-DNA are transcribed, hybridization analysis could not distinguish between H or L strand-derived precursor RNA. As observed for p43 after T3 loading, RXR{alpha}/Cp transcriptional activity was strongly increased by the addition of 9-cis-retinoic acid in the incubation medium (Fig. 8A ). The size of precursor transcripts induced by RXR{alpha}/Cp or p43 differed significantly (Fig. 8A ). Using a ND1 probe, we found that the increase in precursor transcript levels was associated with a rise in mature transcript levels (Fig. 8A ).

RXR/Cp-p43 interaction was assessed in additional experiments. In the presence of both receptors, only precursor transcripts corresponding to the influence of p43 alone were detected (Fig. 8B ), suggesting that p43 heterodimerization with mt-RXR induced recognition of p43-specific binding sequences, as shown for nuclear genes. RXR/Cp-p43 transcriptional influence increased after the addition of 9-cis-retinoic acid or T3 to the incubation medium and was even greater in the presence of both ligands (Fig. 8B ).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The physiological importance of mitochondria has recently been reevaluated by the observation that in parallel to their well-known involvement in the regulation of energy metabolism, they are involved in the regulation of developmental processes including apoptosis or cell proliferation and differentiation. These data highlight the fact that development requires tight regulation of mitochondrial activity. Mitochondrial biogenesis is the result of complex mechanisms involving a coordinated rise in the expression of nuclear genes encoding mitochondrial proteins and in the expression of the mitochondrial genome. This observation shows the importance of mitochondrial genome transcription for organelle function, including mitochondriogenesis and regulation of the activity of each mitochondrion (21) .

Therefore, identification of hormonal receptors in the organelle such as p43 has provided new insight into the regulation of mitochondrial genome transcription (17) and clarified the direct regulation of mitochondrial activity by thyroid hormone (10 , 13 , 19) . Identification of mitochondrial complexes, including p43 and a truncated form of PPAR{gamma}2 that binds a specific mitochondrial DNA sequence (18) , already suggested that mitochondrial genome transcription could be regulated in a similar way to nuclear transcription. Consequently, in addition to the retinoid influence on organelle function, the alterations of mitochondrial activity observed after disruption of the RXR{alpha} gene led us to search for the presence of RXR-related proteins in the organelle.

In this study we provide convincing evidence that a truncated RXR{alpha} protein is located in the mitochondrial matrix. First, in all instances, we used highly purified mitochondria devoid of any significant contamination by nuclei or components of other cell compartments. Contaminations by lysosome, microsome, and membrane proteins were always minimal, as verified by measurements of specific markers. Nucleus-specific proteins were not detected in our mitochondrial preparations (ref 16 and data not shown). Second, two antibodies specifically raised against different sequences of RXR{alpha} recognized the same 44 kDa mitochondrial protein. Third, in situ electron microscopy studies provide direct evidence of the presence of a protein related to RXR{alpha} in the mitochondrion. Last, in vitro synthesized RXR{alpha} is indeed translocated into the matrix of isolated organelles and gives rise to a 44 kDa protein during the import process. Subfractionation experiments established that, like in vitro synthesized RXR{alpha}, the endogenous protein is located in the mitochondrial matrix. All these data strongly argue in favor of the presence of a truncated version of the nuclear receptor RXR{alpha} in the organelle. This is also well supported by the observation that as in vitro synthesized RXR{alpha} after mitochondrial import, mt-RXR lacks the amino-terminal domain of the nuclear receptor as shown by the absence of recognition of both proteins by an antibody raised against a part of this sequence.

Previous studies reported that RXR{alpha} undergoes cytoplasmic amino-terminal cleavage by cathepsin L (35) or m-calpain (34) giving rise to a 44 kDa protein probably displaying an extranuclear location (35) . RXR{alpha} cleavage was associated with a significant decrease in the amounts of receptor located in the nucleus (35 , 36) , suggesting that the truncated protein could display an extranuclear location.

After confirmation that m-calpain efficiently cleaves in vitro synthesized RXR{alpha} to generate a 44kDa protein, we found that this truncated protein is imported into isolated organelles without any apparent change in its molecular mass, providing a first molecular origin for mt-RXR. In agreement with previous studies (37 38 39) , we also observed that a calpain-like proteolytic activity located in the intermembrane space cleaves RXR{alpha} to generate a 44kDa protein, providing a second molecular origin for mt-RXR. This led us to conclude that, on the one hand, after a cytosolic cleavage of RXR{alpha}, the resulting protein is directly addressed to the mitochondrial matrix. On the other, the nuclear receptor is imported into the organelle and reaches the mitochondrial matrix after a cleavage occurring in the intermembrane space (Fig. 9 ).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 9. Molecular origin of mt RXR. Mt-RXR is generated through two different pathways: 1) after a cytosolic cleavage of the nuclear receptor RXR{alpha} by calpain, the resulting protein is directly addressed into the mitochondrial matrix; 2) the nuclear receptor is imported into the organelle; after cleavage by calpain-like activity occurring in the intermembrane space, it reaches the mitochondrial matrix.

Typical steps involved in mitochondrial protein import have already been described: 1) binding of the protein to a mitochondrial outer membrane receptor; 2) translocation through the outer and inner mitochondrial membranes, a process generally driven by the mitochondrial membrane potential; 3) unfolding to an active conformation involving ATP-dependent interactions with mitochondrial heat-shock proteins (40) . The targeting sequence of almost all mitochondrial protein is cleaved by matrix proteases. Using mitoplasts or pharmacological agents such as apyrase and FCCP, we found that after calpain cleavage, the import of a 44 kDa-RXR{alpha} protein does not involve interaction with the outer membrane receptor and does not depend on mitochondrial membrane potential or ATP stores. These results provide a third example of a protein imported into mitochondria by this unusual process, apart from p43 (17) and MTF1 (41) . Work is in progress to characterize this unknown mitochondrial translocation process.

During these experiments, we observed that the full-length nuclear receptor RXR{alpha} is not imported into the matrix compartment when import assays are performed with mitoplasts and therefore in the absence of outer membrane and components of the intermembrane space, including calpain-like activity. As this import, associated with a cleavage of the receptor to give rise to a 44 kDa protein is easily observed when using integral organelles, it appears that the enzymatic cleavage occurring in the intermembrane space is a decisive event for addressing the full-length receptor to the mitochondrial matrix.

We have previously shown that p43 binds several sequences homologous to nuclear hormone response elements (HRE) located in the mitochondrial genome (17) . In this study, we have also provided evidence that p43 did not bind to these sequences as a monomer, which suggests the presence of dimerization partners of this receptor in the organelle. The apparent molecular weight of mt-RXR clearly suggests that the amino-terminal cleavage occurs some amino acids upstream the DNA binding domain of the nuclear receptor, raising the possibility that like its nuclear counterpart, it could bind to specific sequences of the mitochondrial genome.

In agreement with this possibility, in EMSA experiments we found that a mitochondrial protein complex including mt-RXR specifically bound to five probes corresponding to the mitochondrial HREs described previously (21) . The abrogation of DNA binding by antibodies raised against RXR{alpha} or c-Erb A demonstrated that mt-RXR and p43 are major components of this complex. Coimmunoprecipitation experiments confirmed that mt-RXR and p43 interact directly. These data therefore establish that, as observed at nuclear level, p43 and RXR bind to mitochondrial DNA by forming heterodimerical complexes. In line with this possibility, the assessment of relative mitochondrial amounts of mt-RXR in several tissues demonstrates a strong tissue specificity, very close to that reported for p43 (18) .

To study the possible transcriptional activity of mt-RXR mediated by binding to the specific mitochondrial DNA sequences, we examined directly the ability of mt-RXR to activate mitochondrial genome transcription in in organello transcription experiments. We found that like p43 and T3 (present data and ref 17 ), mt-RXR induced a dramatic increase in the levels of mitochondrial precursor transcripts in the presence of exogenous 9-cis-retinoic acid, paralleled by a rise in the levels of mature transcripts.

The different sizes of precursor transcripts induced by mt-RXR or p43 suggest that each receptor could stimulate transcription through the use of different promoters, as previously reported for the activities of p43 and mt-TFA (17) . However, characterization of these promoters did not enter into the scope of this study.

Finally, in the presence of both receptors, only precursor transcripts corresponding to the influence of p43 were detected, and transcriptional influence of mt-RXR/p43 increased after the addition of 9-cis-retinoic acid or T3 to the incubation medium and was even greater in the presence of both ligands. As shown for nuclear genes, these data suggest that the mt-RXR/p43 heterodimerical complex induced specific recognition of p43 binding sequences.

Several observations rule out the possibility that this RXR and RXR/p43-induced rise in mitochondrial transcript levels could result from an increase in RNA stability. First, Enriquez et al. (10) have established that T3 directly influences mitochondrial genome transcription in association with a decrease in mt-RNA half-life. Second, in a previous study (17) , we found that the dramatic rise in mitochondrial transcripts levels induced by p43 in the presence of T3 is detected in <5 min, too brief a delay to involve only mRNA stabilization.

This study demonstrates that post-translational events substantially alter RXR{alpha} location by addressing the receptor to mitochondria and provides important data for the comprehension of hormonal action at the cellular level. First, it throws new light on the influence of retinoids or vitamin A on organelle activity (7 , 11 , 26 , 27) . It also contributes to explain the metabolic abnormalities recorded after disruption of the RXR{alpha} gene (24 , 25) . Second, in association with the identification of truncated c-Erb A{alpha}1 (16) and PPAR{gamma}2 (18) proteins in the organelle, it opens up a new field in endocrine research as it proves that besides membrane and nuclear receptors, a new class of receptors occurs in mitochondria. Finally, it provides new insight into understanding mitochondrial physiology. Mitochondrial proteins are mostly encoded by nuclear genes; however, 13 enzyme subunits required for organelle activity are encoded by the mitochondrial genome, highlighting the necessity for cooperation between nuclear and mitochondrial gene expression for mitochondriogenesis. Therefore, as put forward in a recent review (19) , nuclear genes simultaneously encoding a nuclear and a mitochondrial receptor such as c-Erb A{alpha} (p43) and RXR{alpha} (mt-RXR) could play a crucial role in these processes. With regard to the origin of mitochondria as a bacterium-like organelle engulfed by a primitive cell not subjected to endocrine regulation, it appears that the organelle and the host cell’s response to hormones probably evolved in parallel. One of the most surprising aspects of this finding was that truncated forms of the nuclear receptor could act in mitochondria in much the same way as their full-length counterparts act at the nuclear level: recognition of responsive elements of the mitochondrial genome similar to those described in nuclear genes, heterodimerization leading to recruitment of RXR on the binding sequences of the other partner, p43 in this study, and ligand-dependent stimulation of transcription (Fig. 10 ). A major goal will be to elucidate how this complex could induce activation or recruitment of mitochondrial RNA polymerase on the circular mitochondrial genome. A search for the occurrence of deregulation of mt receptor expression or import and mutations of hormone response elements present in mitochondrial DNA could be a promising way to better understand mitochondrial diseases whose etiology remains unclear.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 10. Hormonal regulation of mitochondrial transcription occurs through processes similar to those identified at nuclear level. Truncated forms of the nuclear receptor could act in mitochondria like their full-length counterparts act at the nuclear level: heterodimerization, binding to specific sequences leading to a transcriptional activation. Involvement of coactivators (coA) or corepressors (coR) remains to be established.


   ACKNOWLEDGMENTS
 
We thank Pr. P. Chambon and Dr. C. Rochette-Egly for the gift of antibodies raised against RXR (IGBMC-Strasbourg, France) and Dr. G. Brandolin for the gift of antibody raised against ADP/ATP translocator and [125I]-ANT (UMR 314 CEA-CNRS, Grenoble, France). We are grateful to J. Chanel for technical assistance. This work was supported by grants from the Institut National de la Recherche Agronomique, the Association de Recherche contre le Cancer. The following received fellowships from the Ligue Nationale contre le cancer (L.D.), Ministère de la Recherche et de l'Enseignement (S.G. and M.B.), and INRA (P.S. and A.C.).

Received for publication July 30, 2002. Accepted for publication November 18, 2002.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Loeffler, M., Kroemer, G. (2000) The mitochondrion in cell death control: certainties and incognita. Exp. Cell Res. 256,19-26[CrossRef][Medline]
  2. Hamai, N., Nakamura, M., Asano, A. (1997) Inhibition of mitochondrial protein synthesis impaired C2C12 myoblast differentiation. Cell Struct. Funct. 22,421-431[Medline]
  3. Kaneko, T., Watanabe, T., Oishi, M. (1988) Effect of mitochondrial protein synthesis inhibitors on erythroid differentiation of mouse erythroleukemia (Friend) cells. Mol. Cell. Biol. 8,3311-3315[Abstract/Free Full Text]
  4. Rochard, P., Rodier, A., Casas, F., Cassar-Malek, I., Marchal-Victorion, S., Daury, L., Wrutniak, C., Cabello, G. (2000) Mitochondrial activity is involved in the regulation of myoblast differentiation through myogenin expression and activity of myogenic factors. J. Biol. Chem. 275,2733-2744[Abstract/Free Full Text]
  5. Van den Bogert, C., Spelbrink, J. N., Dekker, H. L. (1992) Relationship between culture conditions and the dependency on mitochondrial function of mammalian cell proliferation. J. Cell. Physiol. 152,632-638[CrossRef][Medline]
  6. Larsson, N. G., Wang, J., Wilhelmsson, H., Oldfors, A., Rustin, P., Lewandoski, M., Barsh, G. S., Clayton, D. A. (1998) Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet. 18,231-236[CrossRef][Medline]
  7. Berdanier, C. D., Everts, H. B., Hermoyian, C., Mathews, C. E. (2001) Role of vitamin A in mitochondrial gene expression. Diabetes Res. Clin. Pract. 54,S11-S27
  8. Cai, Y., Nelson, B. D., Li, R., Luciakova, K., de Pierre, J. W. (1996) Thyromimetic action of the peroxisome proliferators clofibrate, perfluorooctanoic acid, and acetylsalicylic acid includes changes in mRNA levels for certain genes involved in mitochondrial biogenesis. Arch. Biochem. Biophys. 325,107-112[CrossRef][Medline]
  9. Chou, S. Y., Hannah, S. S., Lowe, K. E., Norman, A. W., Henry, H. L. (1995) Tissue-specific regulation by vitamin D status of nuclear and mitochondrial gene expression in kidney and intestine. Endocrinology 136,5520-5526[Abstract]
  10. Enriquez, J. A., Fernandez-Silva, P., Garrido-Perez, N., Lopez-Perez, M. J., Perez-Martos, A., Montoya, J. (1999) Direct regulation of mitochondrial RNA synthesis by thyroid hormone. Mol. Cell. Biol. 19,657-670[Abstract/Free Full Text]
  11. Estournell, E., Tormo, J. R., Martin, P., Renau-Piqueras, J., Timoneda, J., Barber, T. (2000) Effects of vitamin A deficiency on mitochondrial function in rat liver and heart. Br. J. Nutr. 84,927-934[Medline]
  12. Lieberherr, M. (1987) Effects of vitamin D3 metabolites on cytosolic free calcium in confluent mouse osteoblasts. J. Biol. Chem. 262,13168-13173[Abstract/Free Full Text]
  13. Martino, G., Covello, C., De Giovanni, R., Filippelli, R., Pitrelli, G. (1986) Direct in vitro action of thyroid hormones on mitochondrial RNA-polymerase. Mol. Biol. Rep. 11,205-211[CrossRef][Medline]
  14. Van Itallie, C. (1992) Dexamethasone treatment increases mitochondrial RNA synthesis in a rat hepatoma cell line. Endocrinology 130,567-576[Abstract/Free Full Text]
  15. Van Itallie, C., Dannies, P. S. (1988) Estrogen induces accumulation of the mitochondrial ribonucleic acid for subunit II of cytochrome oxidase in pituitary tumor cells. Mol. Endocrinol. 2,332-337[Abstract/Free Full Text]
  16. Wrutniak, C., Cassar-Malek, I., Marchal, S., Rascle, A., Heusser, S., Keller, J. M., Fléchon, J., Dauça, M., Samarut, J., Ghysdael, J., et al (1995) A 43-kDa protein related to c-Erb A alpha 1 is located in the mitochondrial matrix of rat liver. J. Biol. Chem. 270,16347-16354[Abstract/Free Full Text]
  17. Casas, F., Rochard, P., Rodier, A., Cassar-Malek, I., Marchal-Victorion, S., Wiesner, R. J., Cabello, G., Wrutniak, C. (1999) A variant form of the nuclear triiodothyronine receptor c-ErbAalpha1 plays a direct role in regulation of mitochondrial RNA synthesis. Mol. Cell. Biol. 19,7913-7924[Abstract/Free Full Text]
  18. Casas, F., Domenjoud, L., Rochard, P., Hatier, R., Rodier, A., Daury, L., Bianchi, A., Kremarik-Bouillaud, P., Becuwe, P., Keller, J., et al (2000) A 45 kDa protein related to PPARgamma2, induced by peroxisome proliferators, is located in the mitochondrial matrix. FEBS Lett. 478,4-8[CrossRef][Medline]
  19. Wrutniak-Cabello, C., Casas, F., Cabello, G. (2001) Thyroid hormone action in mitochondria. J. Mol. Endocrinol. 26,67-77[Abstract]
  20. Hertz, R., Aurbach, R., Hashimoto, T., Bar-Tana, J. (1991) Thyromimetic effect of peroxisomal proliferators in rat liver. Biochem. J. 274,745-751
  21. Wrutniak, C., Rochard, P., Casas, F., Fraysse, A., Charrier, J., Cabello, G. (1998) Physiological importance of the T3 mitochondrial pathway. Ann. N.Y. Acad. Sci. 839,93-100[CrossRef][Medline]
  22. Desvergne, B., Wahli, W. (1999) Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr. Rev. 20,649-688[Abstract/Free Full Text]
  23. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. (1995) The nuclear receptor superfamily: the second decade. Cell 83,835-839[CrossRef][Medline]
  24. Ruiz-Lozano, P., Smith, S. M., Perkins, G., Kubalak, S. W., Boss, G. R., Sucov, H. M., Evans, R. M., Chien, K. R. (1998) Energy deprivation and a deficiency in downstream metabolic target genes during the onset of embryonic heart failure in RXRalpha-/- embryos. Development 125,533-544[Abstract]
  25. Imai, T., Jiang, M., Chambon, P., Metzger, D. (2001) Impaired adipogenesis and lipolysis in the mouse upon selective ablation of the retinoid X receptor alpha mediated by a tamoxifen-inducible chimeric Cre recombinase (Cre-ERT2) in adipocytes. Proc. Natl. Acad. Sci. USA 98,224-228[Abstract/Free Full Text]
  26. Gaemers, I. C., Van Pelt, A. M. M., Themmen, A. P. N., De Rooij, D. G. (1998) Isolation and characterization of all-trans-retinoic acid-responsive genes in the rat testis. Mol. Reprod. Dev. 50,1-6[CrossRef][Medline]
  27. Li, G., Liu, Y., Tsang, S. S. (1994) Expression of a retinoic acid-inducible mitochondrial ND5 gene is regulated by cell density in bovine papillomavirus DNA-transformed mouse C127 cells but not in revertant cells.. Int. J. Oncol. 5,301-307
  28. Fleischer, S., Kervina, M. (1974) Subcellular fractionation of rat liver. Methods Enzymol 31,6-41[Medline]
  29. Ragan, C. I., Wilson, M. T., Darley-Usmar, V. M., Lowe, P. M. (1987) Sub-fractionation of mitochondria and isolation of the proteins of oxidative phosphorylation. Darley-Usmar, I. M. Rickwood, D. Wilson, M. T. eds. Mitochondria, A Practical Approach ,79-112 IRL Press Limited Oxford, Washington, D.C..
  30. Greenawalt, J. W. (1974) The isolation of outer and inner mitochondrial membranes. Methods Enzymol 31,310-323[Medline]
  31. Rochette-Egly, C., Lutz, Y., Pfister, V., Heyberger, S., Scheuer, I., Chambon, P., Gaub, M. P. (1994) Detection of retinoid X receptors using specific monoclonal and polyclonal antibodies. Biochem. Biophys. Res. Commun. 204,525-536[CrossRef][Medline]
  32. Noguchi, M., Sarin, A., Aman, M. J., Nakajima, H., Shores, E. W., Henkart, P. A., Leonard, W. J. (1997) Functional cleavage of the common cytokine receptor gamma chain (gamma) by calpain. Proc. Natl. Acad. Sci. USA 94,11534-11539[Abstract/Free Full Text]
  33. Ostronoff, L. K., Izquierdo, J. M., Enriquez, J. A., Montoya, J., Cuezva, J. M. (1996) Transient activation of mitochondrial translation regulates the expression of the mitochondrial genome during mammalian mitochondrial differentiation. Biochem. J. 15,183-191
  34. Matsushima-Nishiwaki, R., Shidoji, Y., Nishiwaki, S., Moriwaki, H., Muto, Y. (1996) Limited degradation of retinoid X receptor by calpain. Biochem. Biophys. Res. Commun. 225,946-951[CrossRef][Medline]
  35. Nagaya, T., Murata, Y., Yamaguchi, S., Nomura, Y., Ohmori, S., Fujieda, M., Katunuma, N., Yen, P. M., Chin, W. W., Seo, H. (1998) Intracellular proteolytic cleavage of 9-cis-retinoic acid receptor alpha by cathepsin L-type protease is a potential mechanism for modulating thyroid hormone action. J. Biol. Chem. 273,33166-33173[Abstract/Free Full Text]
  36. Prufer, K., Schroder, C., Hegyi, K., Barsony, J. (2002) Degradation of RXRs Influences Sensitivity of Rat Osteosarcoma Cells to the Antiproliferative effects of Calcitriol. Mol. Endocrinol. 16,961-976[Abstract/Free Full Text]
  37. Beer, D. G., Hjelle, J. J., Petersen, D. R., Malkinson, A. M. (1982) Calcium-activated proteolytic activity in rat liver mitochondria. Biochem. Biophys. Res. Commun. 109,1276-1283[Medline]
  38. Gao, G., Dou, P. (2000) N-terminal cleavage of bax by calpain generates a potent proapoptotic 18-kDa fragment that promotes bcl-2-independent cytochrome C release and apoptotic cell death. J. Cell. Biochem. 80,53-72[CrossRef][Medline]
  39. Wood, D. E., Thomas, A., Devi, L. A., Berman, Y., Beavis, R. C., Reed, J. C., Newcomb, E. W. (1998) Bax cleavage is mediated by calpain during drug-induced apoptosis. Oncogene 17,1069-1078[CrossRef][Medline]
  40. Neupert, W. (1997) Protein import into mitochondria. Annu. Rev. Biochem. 66,863-917[CrossRef][Medline]
  41. Sanyal, A., Getz, G. S. (1995) Import of transcription factor MTF1 into the yeast mitochondria takes place through an unusual pathway. J. Biol. Chem. 270,11970-11976[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
T. S. Wong, S. Rajagopalan, F. M. Townsley, S. M. Freund, M. Petrovich, D. Loakes, and A. R. Fersht
Physical and functional interactions between human mitochondrial single-stranded DNA-binding protein and tumour suppressor p53
Nucleic Acids Res., February 1, 2009; 37(2): 568 - 581.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pettersson, N. Hanna, M. Lagodich, D. Dupere-Richer, M.-C. Couture, C. Choi, and W. H. Miller Jr.
Rexinoids Modulate Steroid and Xenobiotic Receptor Activity by Increasing Its Protein Turnover in a Calpain-dependent Manner
J. Biol. Chem., August 8, 2008; 283(32): 21945 - 21952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. D. Arrington, T. R. Van Vleet, and R. G. Schnellmann
Calpain 10: a mitochondrial calpain and its role in calcium-induced mitochondrial dysfunction
Am J Physiol Cell Physiol, December 1, 2006; 291(6): C1159 - C1171.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J.-Z. Zeng, D.-F. Sun, L. Wang, X. Cao, J.-B. Qi, T. Yang, C.-Q. Hu, W. Liu, and X.-K. Zhang
Hypericum sampsonii induces apoptosis and nuclear export of retinoid X receptor-alpha
Carcinogenesis, October 1, 2006; 27(10): 1991 - 2000.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. J. De Blasio, K. L. Gatford, J. S. Robinson, and J. A. Owens
Placental restriction alters circulating thyroid hormone in the young lamb postnatally
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2006; 291(4): R1016 - R1024.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. V. Sionov, O. Cohen, S. Kfir, Y. Zilberman, and E. Yefenof
Role of mitochondrial glucocorticoid receptor in glucocorticoid-induced apoptosis
J. Exp. Med., January 23, 2006; 203(1): 189 - 201.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Takiyama, N. Miyokawa, A. Sugawara, S. Kato, K. Ito, K. Sato, K. Oikawa, H. Kobayashi, S. Kimura, and M. Tateno
Decreased Expression of Retinoid X Receptor Isoforms in Human Thyroid Carcinomas
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5851 - 5861.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by CASAS, F.
Right arrow Articles by WRUTNIAK-CABELLO, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by CASAS, F.
Right arrow Articles by WRUTNIAK-CABELLO, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS