FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by POLLOCK, A. S.
Right arrow Articles by LOVETT, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by POLLOCK, A. S.
Right arrow Articles by LOVETT, D. H.
(The FASEB Journal. 2003;17:203-213.)
© 2003 FASEB

The prodomain of interleukin 1{alpha} interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells

ALLAN S. POLLOCK*,{dagger}1, JOHANNA TURCK* and DAVID H. LOVETT*

* The Department of Medicine, University of California, San Francisco, Northern California Institute for Research and Education, Veterans Administration Medical Center and
{dagger} UCSF Comprehensive Cancer Center, San Francisco, California, USA

1Correspondence: Department of Medicine (111J), San Francisco VAMC, 4150 Clement St., San Francisco, CA 94121, USA. E-mail: pollock.allan{at}maelstrom.ucsf.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Interleukin 1{alpha} (IL-1{alpha}), a 33 kDa precursor, is cleaved releasing the 17 kDa carboxyl-terminal cytokine IL-1{alpha} to which all of the biological properties of IL-1{alpha} have been attributed. We investigated the potential independent properties of the remaining 16 kDa IL-1{alpha} amino-terminal propiece by expression in human tumor and primary human cell lines. The IL-1{alpha} propiece produced apoptosis in malignant but not normal cell lines. A minimal fragment comprised of amino acids 55–108 was required for apoptosis. Deletion and mutation studies identified an extended nuclear localization sequence required for nuclear localization, induction of apoptosis and concentration of the IL-1{alpha} propiece in interchromatin granule clusters, concentrations of proteins in the RNA splicing and processing pathways. The IL-1{alpha} propiece interacted with five known components of the RNA splicing/processing pathway, suggesting that the mechanism of action may involve changes in RNA splicing or processing. Expression of the IL-1{alpha} propiece caused a shift in the ratio of Bcl-Xl/Bcl-Xs toward the apoptotic direction. Our findings indicate that the IL-1{alpha} propiece induces apoptosis in a range of tumor cells and likely operates through a mechanism involving the RNA processing apparatus and the alternate splicing of apoptosis regulatory proteins.—Pollock, A. S., Turck, J., Lovett, D. H. The prodomain of interleukin-1 {alpha} interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells.


Key Words: IL-1{alpha} • nuclear localization signal • RNA processing • Bcl-X


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
INTERLEUKIN 1 (IL-1) IS A multifunctional cytokine with a broad spectrum of biological functions in the inflammatory response (reviewed in ref 1 ). Interleukin 1 encompasses two discrete gene products, IL-1{alpha} and interleukin 1ß (IL-1ß), which presumably resulted from a gene duplication event ~350 million years ago (2) . Both proteins are synthesized as 31–33 kDa precursors; proteolytic processing by either calpain in the case of IL-1{alpha} or ICE/caspase in the case of IL-1ß generates the 17 kDa carboxyl-terminal fragments that include all known activities attributed to the interaction of IL-1 with its membrane receptors.

There are clear differences between the cellular distributions and biological activities of the IL-1{alpha} and ß precursor proteins. The IL-1{alpha} precursor protein is biologically active, and its amino-terminal prodomain is subject to several potentially significant post-translational modifications, including phosphorylation and myristyl acylation (3 , 4) . In contrast to the IL-1ß amino-terminal propiece, the IL-1{alpha} amino-terminal propiece includes a latent nuclear localization sequence that is functional after cleavage of the precursor (5) . Free amino-terminal IL-1{alpha} propiece peptide is present within the cytosol and nuclei of endotoxin-stimulated human peripheral blood mononuclear cells, leading to the suggestion that this component has a specific intracellular role distinct from the plasma membrane receptor-linked IL-1 signaling pathway (4 , 6) .

Transfection of transformed vascular endothelial cells with the cDNA encoding the 31 kDa IL-1{alpha} precursor diminishes cellular proliferation rates and migratory ability (7 , 8) , a process dependent on nuclear transport. IL-1{alpha} expression is associated with cellular senescence in these cells (8) . These observations suggested that the amino-terminal portion of the IL-1{alpha} precursor has a separate biological function independent of the carboxyl-terminal cytokine.

To analyze the structural requirements for IL-1{alpha} propiece action in the nucleus we initially used transient transfection of 293tsa cells with IL-1{alpha} propiece-enhanced green fluorescence protein (EGFP) chimeras. The most prominent result of these initial studies was the rapid development of apoptosis. Apoptosis was dependent on nuclear localization, which in turn required a more extended nuclear localization sequence than previously described (5) . Within the nucleus, the IL-1{alpha} propiece localized to discreet interchromatin granule clusters (IGCs) that represent concentrations of proteins of the RNA processing pathway. IL-1{alpha} peptide interaction with RNA-processing proteins was confirmed by yeast two-hybrid interaction analysis. The apoptotic property of the IL-1{alpha} propiece was tightly correlated with localization to IGCs, and was associated with a change in ratio of pro- and anti-apoptotic forms of the alternately spliced Bcl-X apoptosis regulator. These results suggest that the amino-terminal propiece of the IL-1{alpha} precursor induces apoptosis through interaction with the RNA processing pathway, resulting in alternate splicing of apoptosis regulatory genes. These studies were extended to an examination of the potential proapoptotic activity of the IL-1{alpha} propiece in a 60 cell panel of malignant cells, as well as nontransformed primary cell types. A broad range of apoptotic susceptibility was observed within malignant cells whereas nontransformed cells were resistant. This suggests that the specific cellular context, and the balance between pro and anti-apoptotic forces, determines the ultimate pattern of response to the IL-1{alpha} propiece.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell lines and genetic materials
The 60 cell National Cancer Institute tumor cell panel was a gift from Dr. K. Paull, National Cancer Institute (Frederick, MD) and was maintained in RPMI 1640, 5% fetal bovine serum. Human 293 tsa cells and the VSVG pseudotyped retroviral transient transfection system were the gifts of Dr. M. Finer. HUVECs and normal human astrocytes were purchased from Clonetics (Walkersville, MD). Head and neck squamous cell carcinoma HlaC, (9) , HL-60 promyelocytic leukemia cells and the normal dermal fibroblast cell line WI-38 were obtained from the ATCC (Rockville, MD). Primary human melanoma cell lines from 2 patients as well as dermal fibroblasts from same patients were obtained from the UCSF Cancer Center. The EGFP expression vector pEGFP-N1 was obtained from Clontech (Palo Alto, CA).

IL-1 expression vectors
cDNAs encoding the human IL-1{alpha} amino-terminal propiece (amino acids 1–118) and the human IL-1ß amino-terminal propiece (amino acids 1–116) were prepared by RT-PCR using poly(A)+ RNA templates isolated from human promyelocytic leukemia HL-60 cells pretreated for 18 h with 10 nM phorbol 12-myristate 13-acetate (Sigma, St. Louis, MO). The respective PCR products were cloned into pEGFP-N1 and are denoted pEGFP-IL1{alpha} and pEGFP-ILß.

A series of IL-1{alpha} amino-terminal propiece truncation constructs were prepared by PCR and ligated into pEGFP-N1 using standard methodology. The core nuclear localization sequence 82KKRR of the IL-1{alpha} propiece was changed to 82AARR using PCR-based mutagenesis. The sequence 84RKML of the IL-1ß propiece was mutated to 84KKRR, thereby placing the core IL-1{alpha} propiece NLS in the analogous position of the IL-1ß propiece. This construct is designated pEGFP-ILß-NLS. An additional construct containing amino acids 1–83 of IL-1ß joined to amino acids 82–108 of IL-1{alpha} was created and designated IL-1ß/{alpha}. This construct contained the native IL-1{alpha} nuclear localization core sequence 82KKRR. Two chimeric constructs were prepared in which the canonical SV40 nuclear localization sequence PKKKRKV replaced the IL-1{alpha} propiece sequences 1–85 and 1–75 and are denoted IL1{alpha}-SV40–86-118 and IL1{alpha}-SV40–75-118 respectively. Mutants, chimeras, and RT-PCR products were verified by DNA sequencing.

Retroviral vectors
A 1100 bp fragment encoding the IL-1{alpha} propiece-EGFP fusion protein was ligated into pRT43.267, a retroviral vector designed to produce high titer preparations in transient transfections (10) . A control retroviral vector contained only the coding sequence for the EGFP protein. Retroviral preparations pseudotyped with the VSVG coat protein were prepared by calcium phosphate-mediated transient transfection of 293 tsa cells with the IL-1{alpha}-EGFP-pRT43.267 vector, a gag-pol vector, and a VSVG envelope vector (11) . Virus-containing medium was filtered and frozen in aliquots at -80°C. The viral titer was determined by the ability to transduce the EGFP protein as measured by flow cytometry. Titers of 3 x 107/mL were obtained for the control EGFP retrovirus and titers of 4–6 x 106/mL were obtained for the IL-1{alpha}-EGFP retrovirus.

The plasmid pREV-TET-IN (Clontech) expressing the Tet trans-activator and G418 resistance gene was used to transfect 293tsa cells along with gag-pol and VSVG vectors as described above. Virus containing supernatant was used to prepare A375 cells that supported tetracycline-suppressible transcription (12) .

Strategy for expression of the IL-1{alpha} propiece constructs
Transient transfections of 293 tsa cells using the plasmid-based vectors were performed with calcium phosphate; all other cell types were transfected using Lipofectin (Life Technologies, Grand Island, NY). Transfected cells were analyzed by epifluorescence and Nomarski DIC microscopy at serial time points after fixation in 4% buffered paraformaldehyde for 20 min at 4°C. Assessment of the morphological features of apoptosis, including nuclear condensation, cytoplasmic boiling and vacuolization, and formation of apoptotic bodies was performed using a combination of fluorescence microscopy and Nomarski DIC microscopy. For assessment of IL-1{alpha} propiece-mediated apoptosis of the 60 cell NCI tumor cell panel, 5 x 106 retroviral particles were applied to quadruplicate cultures (105 cells/dish) of each cell component. In each case as a control, parallel cultures were treated with a similarly packaged retrovirus expressing only the EGFP protein. Forty-eight hours after retroviral application, the cultures were washed, fixed in 1% buffered formaldehyde for 15 min at 4°C, extracted with 4°C, 70% methanol for 45 min, and stained for DNA strand breaks using a Cy-3 terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling (TUNEL) assay.

Evaluation of apoptosis
In selected cell populations, flow cytometry analysis of suspended cell preparations was performed by TUNEL assay. Cells were examined by Nomarski DIC microscopy for conventional morphological signs of apoptosis, including nuclear fragmentation and condensation and cytoplasmic vacuolization and boiling.

Immunohistochemistry and IL-1{alpha} propiece localization
Cells grown on coverslips and transfected with IL-1{alpha}-EGFP fusion vectors were fixed in 2% paraformaldehyde for 20 min, permeabilized with 0.5% Triton X-100 for 5 min and extracted with 250 mM NH4Cl in PBS for 10 min. For direct examination, coverslips were mounted using Aquamount and examined for EGFP fluorescence with a Zeiss Axiophot microscope. For colocalization studies, cells were extracted as described and stained with a monoclonal antibody to SC35 (13) (Sigma Chemical), coilin p80 (14) , or phosphorylated RNA polymerase-II (15) at 4°C overnight, followed by biotinylated (Fab'2) donkey anti-mouse antibody (Jackson, West Grove, PA) and Cy5-streptavidin (Jackson). Cells thus stained were examined with a Leica LCS confocal microscope using a 488 nm Argon laser line to detect EGFP and a 633 nm HeNe laser line to detect the Cy5 fluorophore. Multiple optical sections were obtained from each examination.

Yeast two-hybrid interaction analysis
Yeast two-hybrid interaction analysis was performed as described by Fields et al. and Brent et al. (16 17 18) using materials and vectors obtained from Clontech. A cDNA fragment encoding amino acids 55–108 of the IL-1{alpha} propiece was cloned into pLexA to maintain reading frame. The presence of the LexA-IL-1{alpha} fusion protein was verified by Western blot of extracts of yeast transformed with this construct and induced by substitution of glucose with galactose/raffinose in the medium. Blots were probed using anti-LexA antibodies and products were detected with ECL (Amersham). The yeast strain EGY48, containing integrated copies of p8op-LacZ, was transformed with pLexA-IL-1{alpha} (55–108), selected, and subsequently transfected with a HeLa cell cDNA library constructed in pB42AD. After initial selection on synthetic dropout (SD-his/-trp/-ura) medium, individual colonies were twice restreaked and isolated on the same selective media; finally, individual colonies were replica plated on either SD/gal/raf/-his/-trp/-ura/-leu/Xgal or on SD/-his/-trp/-ura plates. Colonies that both survived and turned blue on SD/gal/raf/-his/-trp/-ura/-leu/Xgal plates were isolated and used to prepare plasmid DNA, which was subsequently sequenced using automated methods. Interactions between IL-1{alpha} mutants and specific nucleoproteins were evaluated by cotransfecting EGY48(p2op-LacZ) with pLexA containing the IL-1{alpha} mutant cloned in-frame with the LexA protein and pB42AD expressing the interacting nucleoprotein sequence, also cloned in-frame. We used the less sensitive 2op-LacZ to allow us to detect a smaller decrease in interaction strength. Cotransfectants were plated on SD-his/-trp/-ura medium and multiple cotransfectants were streaked onto SD/gal/raf/-his/-trp/-ura/-leu/Xgal plates to assess interaction. These mutants, constructed by using PCR-based mutagenesis (Stratagene Quick Change Kit), consisted of changing the following residues to alanine: 61K, 68K, 73V, 79K, 90Q, 95D, 100I, and 106E.

Bcl-Xl/s ratio determination
For transient transfection studies, 293tsa cells were transfected with either pEGFP-N1 (control) or pEGFP-IL1{alpha}-EGFP plasmids using 10 µg/100 mm dish using a CaPO4 method. This method achieved {approx}80% efficiency based on expression of the EGFP marker. After 48 h, total RNA was prepared from the cells using the RNA-Stat60 reagent (TelTest Inc.). One microgram of total RNA was analyzed by RT-PCR using Superscript-II RT-PCR system (Invitrogen, San Diego, CA); the following primers for human Bcl-X, 5'CAGGGACAGCATATCAGAGCTTTG and 3'GGACGGAGGATGTGGTGGAG were used. PCR products were resolved on 1% agarose gels and either visualized by ethidium bromide staining or probed with a 32P-labeled probe for Bcl-X.

A375 cells were infected with a retrovirus expressing the tet trans-activator (12) and selected with G418. Surviving colonies were evaluated for transcription from vectors containing the tet-responsive element (pTRE2-EGFP). Clones supporting transcription and suppressible with 1 µg/mL doxycycline were selected. One of these clones was transfected with pTRE2-IL-1{alpha}-EGFP or the identical vector with the mutation 82KK- > 82AA either in the presence or absence of 1 µg/mL doxycycline. After 48 h, total RNA was prepared and analyzed as above.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Functional analysis of IL-1{alpha} propiece nuclear localization and apoptosis
For the initial series of studies, a transient transfection approach using the 293tsa cell line was chosen because of high transfection efficiency. To facilitate intracellular localization, the IL-1{alpha} propiece peptide was expressed as a chimera with the EGFP carboxyl-terminal to the IL-1{alpha} sequence. Preliminary experiments indicated that placement of the 28 kDa EGFP protein on either the amino or carboxyl termini of the IL-1{alpha} propiece did not affect the resultant localization nor the induction of apoptosis. At 18 h after transient transfection of 293tsa cells, EGFP-tagged IL-1{alpha} propiece was localized to nuclei of the cells (Fig. 1 , panel I); by 24–48 h, IL-1{alpha} propiece-EGFP fusion protein was concentrated in the large, irregular nuclear condensations characteristic of apoptotic bodies (Fig. 1) . This was confirmed by FACS-TUNEL assay (Fig. 1 , panel II) in selected cells. Finally, we performed a cell survival experiment in which cells were infected with a replication defective retrovirus expressing the IL-1{alpha}-EGFP fusion protein (or EGFP as a control) and allowed to grow. After 17 days, there were markedly fewer colonies in the IL-1{alpha} vs. the control (EGFP) flasks (Fig. 1 , panel III). These studies confirm the presence of apoptosis.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Localization of IL-1{alpha}-EGFP in 293 cells. Panel I: 293tsa cells were transfected with a CMV-driven IL-1{alpha} propiece-EGFP fusion construct (pEGFP-IL-1{alpha}) or with EGFP alone. Cells were fixed in 4% paraformaldehyde and examined 16 h after transfection using epifluorescence microscopy with fluorescein filters. A) Cells transfected with EGFP alone at 16 h. B) Cells transfected with the IL-1{alpha}-EGFP expression vector at 24 h. Original magnification 400x. Panel II: FACS TUNEL assay on representative cells treated with control or IL-1{alpha} propiece. There is a marked increase in the TUNEL positive fraction of cells treated with IL-1{alpha}. Panel III: Clonal survival of cells in response to IL-1{alpha}. Two tumor cells were evaluated (U251 and A375). 104 cells were plated in 75 cm2 flasks and infected with a >50 MOI of a murine retrovirus bearing the VSVG coat protein and expressing either EGFP (control) or the IL-1{alpha}-EGFP fusion protein. Essentially 100% of the cells were infected as judged by epifluorescence microscopy. Cells were allowed to grow for 17 days, then fixed and stained with crystal violet.

To determine whether a subsequence of the IL-1{alpha} propiece was sufficient for the induction of apoptosis, a series of amino- and carboxyl-terminal deletion constructs was prepared with termini detailed in Fig. 2 A. The apoptotic activities of these truncations are summarized in the figure. A minimal linear sequence extending from residues 55–108 was required for proapoptotic activity (Fig. 2) , and the activity of this construct was indistinguishable from the intact propiece. This sequence corresponds fairly closely to the exon 4 of the IL-1{alpha} gene (19) . Carboxyl-terminal removal of residues 91–108, which encode an acidic sequence, resulted in the loss of all proapoptotic activity although the chimeric protein was readily transported to the nucleus. Amino-terminal deletion of residues 55–74, in which the core nuclear localization sequence remained intact, yielded a construct that neither localized to the nucleus nor produced apoptosis. Previous studies (5 6 7 8) have defined a core nuclear localization sequence located between residues 82 and 85 (KKRR) that is required for transport of the IL-1{alpha} propiece to the nucleus. To determine whether this sequence and subsequent nuclear transport are required for the induction of apoptosis in 293tsa cells, lysines 82 and/or 83 were mutated to alanine. These mutations resulted in elimination of IL-1{alpha} propiece-EGFP transport to the nucleus and loss of apoptotic activity (Fig. 2B ). These findings indicate that the sequence 82KKRR is required but not sufficient to effect nuclear localization of the IL-1{alpha} propiece. The functional significance of the extended nuclear localization region (amino acids 55–85) was further probed by examining two constructs in which the canonical SV40 nuclear localization sequence PKKKRKV replaced the regions 55–85 or 55–74 (described in Fig. 2A ). These constructs yielded intense nuclear localization but did not induce apoptosis. Taken together, the mutation, deletion, and substitution studies pinpoint the significance of at least two functional linear domains of the IL-1{alpha} propiece. The sequence 55–78 plays a dual role. It mediates nuclear transport and in addition to the core NLS is required but not sufficient to induce apoptosis. Though not required for nuclear transport, the acidic domain encompassing residues 91 to 108 is required, but not sufficient, for apoptotic activity.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Truncations and alterations of the core nuclear localization sequence of the IL-1{alpha} propiece. A) 293tsa cells were transfected with a series of truncation mutants of the IL-1{alpha} propiece. B) 293tsa cells were transfected with either an IL-1{alpha} propiece vector or an NLS mutant in which the sequence 82KKRR was mutated to 82AARR. 24 h after transfection, cells were fixed in 4% paraformaldehyde and examined by epifluorescence microscopy for nuclear localization and apoptosis. Original magnification 400x.

The IL-1{alpha} prodomain is phosphorylated on serine 90 in macrophages (20) . Since the distribution of many nucleoproteins is regulated by phosphorylation (21) , we mutated serine 90 to alanine in the context of the IL-1{alpha} EGFP expression vector. On transfection into 293tsa cells, no alteration in either nuclear localization or apoptotic properties was observed (data not shown). Thus, the nuclear localization of the IL-1{alpha} propiece is not dependent on the known 90S phosphorylation acceptor.

IL-1{alpha} and ß evolved as the consequence of a gene duplication event, and the amino-terminal propiece sequences of these molecules share a substantial degree of homology (Fig. 3 A). One notable difference between the two sequences is the absence of a basic core nuclear localization sequence in the Il-1ß propiece. IL-1ß also lacks several of the acidic residues found in the 91–108 region of IL-1{alpha}, and the predicted hydropathy/hydrophilicity profiles of this region are quite distinct. We therefore examined the potential proapoptotic activity of the IL-1ß amino-terminal propiece and whether modification of the IL-1ß propiece by insertion of IL-1{alpha} components could induce apoptotic activity.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Properties of IL-1{alpha}/ß chimeras. A) Alignment of the amino acid sequence of the human IL-1{alpha} and IL-1ß prodomains using the ClustalW alignment algorithm (62) . B) Nuclear localization and apoptotic properties of the IL-1ß propiece and various chimeras of IL-1{alpha} and ß propieces. The indicated chimeras were made as EGFP fusion construct and used to transfect 293tsa cells. The cells were fixed and examined 24 h after transfection. Original magnification 400x.

Transfection of 293tsa cells with an IL-1ß prodomain-EGFP fusion construct did not result in nuclear concentration of the chimeric EGFP protein and apoptosis was not induced (Fig. 3B ). Replacement of the IL-1ß propiece sequence 82LRKML with the analogous nuclear localization sequence of the IL-1{alpha} propiece 78KLKKRR did result in nuclear localization of the modified IL-1ß-EGFP construct; however, there was no evidence for apoptosis (Fig. 3B ). Another major difference between the IL-1{alpha} and IL-1ß propieces is the lack of a carboxyl-terminal acidic region in IL-1ß (corresponding to residues 91–108 of IL-1{alpha}). A chimera consisting of residues 1–83 of IL-1ß joined to the acidic domain encoded by amino acids 82–108 of IL-1{alpha} was constructed and used to transfect 293tsa cells. Although this chimera demonstrated some nuclear localization, it did not produce apoptosis (Fig. 3B ). Thus, proapoptotic activity could not be engineered into the IL-1ß propiece either by provision of a nuclear localization sequence or the inclusion of the carboxyl-terminal acidic domain found in IL-1{alpha}.

The preceding data indicate that a 53-residue portion of the IL-1{alpha} prodomain is capable of nuclear localization and induction of apoptosis in a range of malignant cells. To delineate mechanisms of action, we first explored the nuclear localization pattern of the IL-1{alpha}-EGFP protein in more detail. After gentle detergent extraction, some of the nuclear IL-1{alpha}-EGFP protein was removed; the remaining EGFP fluorescence was present in a punctate, speckled nuclear pattern (Fig. 4 ), suggestive of interchromatin granule clusters, also referred to as "nuclear speckles" (22) . Pretreatment of permeabilized cells with DNAase prior to fixation did not affect the localization, indicating that the IL-1{alpha} propiece was not binding to nuclear DNA.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Colocalization of detergent-resistant concentrations of the IL-1{alpha} propiece with nuclear components. 293tsa cells were transfected with pEGFP-IL-1{alpha}. After 24 h cells were fixed with 2% paraformaldehyde and extracted sequentially with 0.5% Triton-X100 and 250 mM NH4Cl. Cells were stained with antibodies directed to (left) the spliceosomal protein SC35; (center) H5, an antibody reacting with RNA polymerase-II; or (right) anti coilin p85. These antibodies were detected with Cy5-conjugated anti mouse antibodies. Cells were examined by confocal microscopy using s Leica TCS system and a 63x objective. The EGFP fluorophore (green) was excited with a 488 nm argon laser line and the Cy5 fluorophore (red) was excited with a 633 nm HeNe laser line. Detergent-resistant IL-1{alpha} colocalizes predominantly with the spliceosomal SC35 but not with RNA polymerase-II or coilin p80.

Localization to IGCs is characteristic of proteins of the RNA processing pathways (22 23 24 25 26 27) , including localized aggregates of proteins adjacent to RNA polymerase activity and spliceosomes/splicing complexes. We transfected 293tsa cells with pEGFP-IL-1{alpha} and costained the extracted nuclei with the following antibodies: H-5 (15) , which recognizes the phosphorylated form of RNA polymerase-II present in transcriptional complexes, anti-coilin p80 (14) , which stains nuclear coiled bodies, and anti-SC35, an antibody that stains a key spliceosomal SR protein (13) . Colocalization was performed by dual wavelength confocal laser microscopy using a two-antibody system and streptavidin-Cy5 as the fluorophore. As shown in Fig. 4 , most detergent-resistant IL-1{alpha}-EGFP product is closely associated with the spliceosomal structures detected by SC35. In contrast, there was no association of the IL-1{alpha}-propiece-EGFP product with transcriptional complexes or coiled bodies.

We correlated the punctate nuclear localization of the IL-1{alpha} propiece mutants and variants with the ability to produce apoptosis. Cells were transfected with the respective mutant or variant of IL-1{alpha} fused to EGFP, extracted, and examined by confocal microscopy. All IL-1{alpha} variants (as outlined in Fig. 2 ) that produced apoptosis localized to the IGCs costaining with anti-SC35 (not shown). This tight correlation suggests that the mechanism of IL-1{alpha} propiece action involves a direct interaction with elements of the RNA processing apparatus.

To define the protein partners of the IL-1{alpha} propiece and provide an independent confirmation of the interaction with proteins found in IGCs, we performed a yeast two-hybrid analysis. The bait protein consisted of the minimally active residues 55–108 of the IL-1{alpha} propiece fused to the LexA protein. Three major groups of interactors were identified in a HeLa cell cDNA library. The first consisted of importin-{alpha}1 and -{alpha}5. The importin protein family facilitates the majority of nuclear protein import mediated by conventional nuclear localization sequences and the interaction with the IL-1{alpha} propiece is consistent with import into the nucleus via an NLS-dependent process. The second most abundant interactor was tubulin and is consistent with our earlier demonstration of the interaction with IL-1{alpha} with microtubules (6) . The third group consisted of five proteins involved in RNA processing and included ASF/SF2, CC1.4, hnRNP A/B, SMA5, and prp8. ASF/SF2 and CC1.4 are SR proteins, a family of proteins centrally involved in pre-mRNA splicing (28 29 30 31 32) . hnRNPA/B is a member of the hnRNP protein family involved in RNA shuttling and selection of splice sites (33 34 35 36) . The SMA5 protein is involved in the assembly of snRNPs in the spliceosome (37) . Prp8 is a spliceosomal protein involved in the formation of the splicing complex (38 39 40) . The yeast two-hybrid studies thus confirm the spliceosomal localization observed with the confocal studies described above.

We probed the structure–function properties of the IL-1{alpha} propiece by creating single amino acid mutations and evaluating them for elimination of interaction with the RNA binding proteins identified by yeast two-hybrid analysis. The deletion studies pointed to the region between 55–82. This region, part of the extended nuclear localization sequence, is necessary for the concentration of the IL-1{alpha} propiece to IGCs and for apoptosis. The binding of several mutants (61K->A, 68K->A, 73V->A, 79K->A and 82KK->AA) to the five RNA processing proteins identified above was first evaluated using yeast two-hybrid interaction analysis. One of the mutants evaluated 73V->A, failed to interact strongly with any of the five nuclear RNA processing proteins in the yeast two-hybrid format (Fig. 5 , panel I). This (73V->A) IL-1{alpha} mutant was further evaluated by transfection as an EGFP fusion protein into 293tsa cells. As demonstrated in Fig. 5 , panel II, the mutant (although well expressed and exhibiting nuclear localization) neither produced apoptosis nor associated with IGCs. These data indicate that the induction of apoptosis by the IL-1{alpha} propiece is not readily separable from its association with RNA processing proteins associated with IGCs.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 5. Effect of the 73V->A mutation on localization to IGC and apoptosis. Panel I: Yeast two-hybrid interaction between either the IL-1{alpha} propiece or the 73V->A mutant and the five RNA processing proteins. Representative yeast transformants, transfected with pLexA-IL-1{alpha} (or the 73V->A mutant) and the respective RNA processing protein in pB42AD, streaked on SD/gal/raf/-his/-trp/-ura/-leu/Xgal agar. The 73V->A mutation results in markedly decreased interaction. Panel II: 293tsa cells were transfected with either IL-1{alpha} propiece EGFP or an identical vector containing a 73V->A mutation. After 24 h, cells were fixed, stained with DAPI, and examined by epifluorescent microscopy (left and center panels) and photographed under epifluorescent illumination using a Hamamatsu CCD camera (original magnification 400x). Transfected cells were detergent extracted and examined by confocal microscopy (right panels, original magnification 630x). The 73V->A mutation, which markedly diminished the IL-1{alpha} interaction with RNA processing proteins in the yeast two-hybrid assay (panel I), also prevents localization to IGCs and apoptosis.

The invariant relationship between localization to IGCs and induction of apoptosis suggested that the proapoptotic effect of the IL-1{alpha} propiece is related to RNA processing, transport, or alternate splicing events. Many regulators of apoptosis are subject to alternate splicing, and the alternate protein products have opposite effects on apoptosis (see ref 41 for review). To determine whether the IL-1{alpha} propiece affects the splicing pattern of known regulators of apoptosis, we evaluated mRNA extracted from two cell lines after expression of the IL-1{alpha} propiece. Total RNA was isolated from 293tsa cells transiently transfected with either an EGFP expression vector (pEGFP-N1) or an IL-1{alpha}-EGFP vector expressing the IL-1{alpha}-EGFP fusion protein. Epifluorescence examination indicated these cells were transfected at >80% efficiency. A pair of PCR primers flanking the alternate exon of human Bcl-Xl/s was used in RT-PCR reactions. In the control cells transfected with the EGFP vector, the anti-apoptotic Bcl-Xl and the proapoptotic Bcl-Xs transcripts were both detected with a preponderance of the Bcl-Xs form. In contrast, the IL-1{alpha}-EGFP transfected cells showed a marked change in the Bcl-Xl/Bcl-Xs with a very significant decrease in the anti-apoptotic Bcl-Xl form.(Fig. 6 A).



View larger version (60K):
[in this window]
[in a new window]
 
Figure 6. Bcl-Xl and Bcl-Xs rations in response to IL-1{alpha} expression. A) 293tsa cells were transfected with either pEGFP or pEGFP-IL-1{alpha} with {approx}80% efficiency as judged by EGFP fluorescence. After 48 h, total RNA was prepared and used as an RT-PCR template using human Bcl-X-specific primers that flanked the alternately spliced exon. The PCR products were separated on 1% agarose gels and probed with 32P labeled probe for Bcl-X. Bcl-Xl yields a 419 bp product and Bcl-Xs is detected as a 230 bp product. RT-PCR detection of Bcl-Xl and Bcl-Xs in A375 melanoma cells. B) A375 cells expressing the tetoff trans-activator protein were transfected with a tet-responsive element IL-1{alpha}-EGFP in the absence or presence of 1 µg/mL doxycycline or a similar construct with a mutated NLS in the absence of doxycycline. RNA was isolated after 48 h and RT-PCR was performed as described in above except that PCR products were resolved on a 1.5% agarose gel. The relative intensities of the Bcl-Xl and Bcl-Xs bands were determined by densitometry. The Bcl Xl/s ratios are indicated in the figure.

The 293tsa cell system is capable of high levels of expression from CMV promoter-based plasmids. To evaluate the effect of more modest levels of expression of the IL-1{alpha} propiece, we engineered A375 melanoma cells to express the tet trans-activator (12) . These were in turn transfected with a plasmid expressing the IL-1{alpha}-EGFP protein from a tetracycline-trans-activator-responsive promoter. Clones were analyzed by RT-PCR of total RNA either in the presence or absence of doxycycline (48 h postwithdrawal). The overall transfection efficiency judged by EGFP fluorescence was > 50%. Figure 6B depicts the RT-PCR results of these studies. The Bcl-Xl/Xs ratio changed from 3.2:1 in the control cells repressed with doxycycline to 1.2:1 in cells after doxycycline withdrawal (measured by densitometry). Given the stoichiometric nature of apoptosis regulation, this represents a quantitative shift toward the induction of apoptosis. Cells transfected with the NLS mutant of the IL-1{alpha} propiece (82KKRR->AARR) in the absence of doxycycline had a ratio similar to the control (3.8:1).

Range of cells susceptible to IL-1{alpha} propiece-induced apoptosis
To determine the extent of IL-1{alpha} propiece apoptotic activity and gain insight into possible mechanisms of action, the effects of IL-1{alpha} propiece expression in the 60 cell NCI tumor panel (42) were assessed. We examined several normal, diploid primary human cell lines. Because the efficiency and toxicity of conventional transfection reagents is very cell specific, simple plasmid-based transfection applied to 60 discrete cell types could introduce considerable artifact, especially as to toxicity. Therefore, the IL-{alpha}-EGFP cassette and the EGFP control were placed within a retroviral expression vector (10) . Using retrovirus pseudotyped with the VSVG envelope protein prepared at high viral titers (11 , 43) , IL-1{alpha} was expressed in all members of the cell panel. We scored for apoptosis by FACS-TUNEL in cells demonstrating visible EGFP fluorescence and compared these scores to cells expressing EGFP alone. Application of the control EGFP retroviral vector yielded apoptosis rates that were not different from untreated cells (generally<5%-10%). In contrast, application of the IL-1{alpha}-EGFP retroviral vector produced very significant degrees of tumor cell apoptosis. The rates of apoptosis at 48 h varied considerably, ranging from 36% for SF-268 glioblastoma cells to 96% for OVCAR-4 ovarian carcinoma cells (Table 1 ). Based on tissue type, the highest rates of apoptosis were observed with ovarian carcinoma cells, melanoma, and colonic adenocarcinoma cell types. We evaluated two primary human melanoma isolates (passage 5) and found >90% apoptosis rates in response to the IL-1{alpha}-EGFP but not to EGFP. Retroviral delivery of the EGFP cassettes to nontransformed WI-38 fibroblasts, HUVEC, primary human dermal fibroblasts, or primary human astrocyte cultures resulted in a basal apoptosis rate of 4–5% in both cell types; cells infected with the IL-1{alpha}-EGFP virus demonstrated a 4–5% apoptosis rate. Taken together, the cell panel study and the results with the nontransformed cells indicate that the proapoptotic activity of the IL-1{alpha} propiece is restricted to tumor cells and spares normal, primary diploid cells.


View this table:
[in this window]
[in a new window]
 
Table 1. Fraction of NCI panel tumor cells undergoing apoptosis 48 h after expression of IL-1{alpha} propiece from a retroviral vector preparation. B. Additional tumor cells and nonmalignant primary cells are included.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The biological properties of IL-1{alpha} as an inflammatory mediator are well characterized and reside exclusively in the carboxyl-terminal half of the molecule. Before this work there had been limited description of the independent properties of the conserved amino-terminal portion of the molecule. Although the nuclear localization of the IL-1{alpha} propiece had been noted (5 , 6) , the novel finding of this report is the unexpected ability of the IL-1{alpha} propiece to induce apoptosis in a broad range of tumor cells. The apoptotic function of the IL-1{alpha} propiece requires nuclear localization and is inseparable from the ability of the propiece to localize to interchromatin granule clusters. The apoptotic activity of the IL-1{alpha} propiece is an intrinsic property of the molecule, as extensive efforts to convert the inactive IL-1ß propiece into an apoptotic form by insertion of functional IL-1{alpha} modules were unsuccessful.

The nuclear localization of the IL-1{alpha} propiece has been attributed to the 82KKRR sequence, because mutation of either or both lysines abrogates nuclear concentration (5) . The predominant cytoplasmic localization of the precursor protein before cleavage is presumably the result of cytoplasmic anchoring (6) . We found that the 82KKRR sequence is required but not sufficient to localize the IL-1{alpha} propiece to the nucleus. An extended region, including amino acids 55–90, appears to be necessary for nuclear localization. The 55–90 region contains neither a classic SV40 Tag-like NLS nor a classic bipartite NLS. The diversity of nuclear import signals is made possible by a range of nuclear import proteins with differing specificities (44 45 46) . The yeast two-hybrid analysis suggests an interaction with both importin-{alpha}1 and importin-{alpha}5, and interaction with multiple importin species has been reported for several NLS-bearing proteins (45) .

Besides the requirement for nuclear localization, the 55–90 region mediated concentration of the IL-1{alpha} propiece to IGCs. IGCs are sites of accumulation of proteins necessary for assembly of spliceosomes, multiprotein complexes that dynamically assemble on intron-bearing pre-mRNAs (22 23 24 25 26 27 , 47 , 48) . Spliceosomes consist of > 100 distinct proteins (23 , 49) concentrated in ICGs in nuclear region RNA processing (27) . While spliceosomes are thought to be self-assembling, in a few cases, the determinants of protein localization to spliceosomes have been addressed in deletion studies. The spliceosomal component SF3b135 has a functional NLS, and a {approx}300 amino acid region capable of directing heterologous protein to spliceosome/speckles (50) . Similarly, many protein components of spliceosomes, including SR proteins and hnRNP family members, have RNA recognition motifs (RRM) that may be required for spliceosomal localization (51 , 52) . There is no obvious RRM in the IL-1{alpha} propiece, nor is it as long as the {approx}300 amino acid SF3b135-targeting domain. A summation of weak protein-protein attractions appears to be the driving force for the dynamic assembly of spliceosomes (27) . We are currently mapping the structural regions of the IL-1{alpha} propiece and of the five-spliceosomal interactors that are required for interaction. Our initial studies point to a region around residue valine-73 as critical for interaction with IGCs and specific RNA binding proteins, and this is a starting point for interaction mapping at a more detailed level.

IGCs are the sites of multiple aspects of RNA metabolism, but the concentration of pre-mRNA splicing factors is perhaps the best-characterized feature of these structures. We believe that the interaction of the IL-1{alpha} propiece with elements of the splicing apparatus affects alternate splicing of genes involved in the regulation of apoptosis, and that this is responsible at least in part for the apoptosis. Observations of apoptosis regulatory genes support a linkage between nuclear localization of the IL-1{alpha} propiece with the alternate splicing of apoptosis regulatory proteins. Proteins of the Bcl2 family, as well as some of the apoptosis-related caspase proteases, exist in multiply spliced forms that often have opposing effects on apoptosis (reviewed by Jiang et al. in ref 41 ). The Bcl-X protein is prominent among alternately spliced apoptosis regulators. The alternate forms Bcl-Xl and Bcl-Xs have divergent effects on apoptosis, the former opposing and the latter favoring cell death. Manipulation of the Bcl-Xl/s ratio by transfection of oligonucleotides that affect splicing produced apoptosis in some cell types (53) . This suggests that the apoptotic regulatory set point or milieu of a given cell dictates whether a change in the Bcl-Xl/s ratio will produce apoptosis. Since the Bcl-X protein is only one of a myriad of apoptosis regulators, including several that may be alternately spliced, an isolated change in Bcl-Xl/s ratio may not be determinative of apoptosis in itself. The forces determining the Bcl-Xl/s ratios are generally unknown, although there is at least one example wherein alternative transcriptional start sites favor alternatively spliced forms of Bcl-X (54) . Expression of the IL-1{alpha} propiece changed the Bcl-Xl/s ratio in two cell types toward the apoptotic direction, suggesting a potential mechanism of action.

These studies focused on induced expression of the IL-1{alpha} propiece in a variety of tumor cells and normal cell types not generally considered capable of proteolytic processing of the 33 kDa IL-1{alpha} precursor. Several cell types, including keratinocytes (55) , endothelial cells (8 , 56) , and macrophages, synthesize and release the 33 kDa IL-1{alpha} precursor, but only macrophages can generate free IL-1{alpha} propiece detectable within cellular extracts (4) . Activated macrophages are resistant to many apoptotic stimuli, including proteolytic enzymes and reactive oxygen species (57 , 58) , yet undergo apoptosis during the resolution phase of granulomatous involution (59 , 60) . Intracellular calcium transients are associated with the activation of calpain leading to generation of the free IL-1{alpha} propiece and also with apoptosis (61) . The release of the amino-terminal IL-1{alpha} propiece coincident with its calpain-mediated cleavage may serve as another mechanism by which the life span of the activated macrophage is limited. Recent studies (A. S. Pollock, J. Turck, and D. H. Lovett, unpublished results) indicate that the terminal differentiation of activated macrophages to multinucleated giant cells and eventual apoptosis is driven by the IL-1{alpha} propiece peptide, a product generated as a result of macrophage activation, providing a physiological correlate for the studies summarized in this report.


   ACKNOWLEDGMENTS
 
This work was supported by National Institutes of Health grants R01DK31398 and R55 CA91038 (A.S.P), R01DK39776 (D.H.L), the Charlotte Geyer Foundation (A.S.P.), and general support from the Northern California Institute of Research and Education and the Department of Veterans Affairs.

Received for publication July 12, 2002. Accepted for publication October 15, 2002.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Dinarello, C. A. (1996) Biologic basis for interleukin-1 in disease. Blood 87,2095-2147[Abstract/Free Full Text]
  2. Dinarello, C. A. (1997) Interleukin-1. Cytokine Growth Factor Rev 8,253-265[CrossRef][Medline]
  3. Kobayashi, Y., Nagatake, H., Shimozato, O., Watanabe, N. (1997) Interaction of the pre-domain of interleukin-1 with the mature domain. J. Biochem. 121,896-901[Abstract/Free Full Text]
  4. Stevenson, F. T., Bursten, S. L., Fanton, C., Locksley, R. M., Lovett, D. H. (1993) The 31-kDa precursor of interleukin 1 alpha is myristoylated on specific lysines within the 16-kDa N-terminal propiece. Proc. Natl. Acad. Sci. USA 90,7245-7249[Abstract/Free Full Text]
  5. Wessendorf, J. H., Garfinkel, S., Zhan, X., Brown, S., Maciag, T. (1993) Identification of a nuclear localization sequence within the structure of the human interleukin-1 alpha precursor. J. Biol. Chem. 268,22100-22104[Abstract/Free Full Text]
  6. Stevenson, F. T., Torrano, F., Locksley, R. M., Lovett, D. H. (1992) Interleukin 1: the patterns of translation and intracellular distribution support alternative secretory mechanisms. J. Cell. Physiol. 152,223-231[CrossRef][Medline]
  7. McMahon, G. A., Garfinkel, S., Prudovsky, I., Hu, X., Maciag, T. (1997) Intracellular precursor interleukin (IL)-1alpha, but not mature IL-1alpha, is able to regulate human endothelial cell migration in vitro. J. Biol. Chem. 272,28202-28205[Abstract/Free Full Text]
  8. Maier, J. A., Statuto, M., Ragnotti, G. (1994) Endogenous interleukin 1 alpha must be transported to the nucleus to exert its activity in human endothelial cells. Mol. Cell. Biol. 14,1845-1851[Abstract/Free Full Text]
  9. Tomson, A. M., Scholma, J., Dijkhuizen, T., Wijnakker, A. P., van der Werf, M., de Jong, K. M., van Leeuwen, M. B., Koning, J. G. (1995) Characterization of human larynx carcinoma cell lines HLaC'79 and HLaC'82: a common origin but diverged malignancies. Clin. Exp. Metastasis 13,319-327[Medline]
  10. Finer, M. H., Dull, T. J., Qin, L., Farson, D., Roberts, M. R. (1994) kat: a high-efficiency retroviral transduction system for primary human T lymphocytes. Blood 83,43-50[Abstract/Free Full Text]
  11. Sharma, S., Cantwell, M., Kipps, T. J., Friedmann, T. (1996) Efficient infection of a human T-cell line and of human primary peripheral blood leukocytes with a pseudotyped retrovirus vector. Proc. Natl. Acad. Sci. USA 93,11842-11847[Abstract/Free Full Text]
  12. Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W., Bujard, H. (1995) Transcriptional activation by tetracyclines in mammalian cells. Science 268,1766-1769[Abstract/Free Full Text]
  13. Fu, X. D., Maniatis, T. (1990) Factor required for mammalian spliceosome assembly is localized to discrete regions in the nucleus. Nature (London) 343,437-441[CrossRef][Medline]
  14. Bohmann, K., Ferreira, J. A., Lamond, A. I. (1995) Mutational analysis of p80 coilin indicates a functional interaction between coiled bodies and the nucleolus. J. Cell Biol. 131,817-831[Abstract/Free Full Text]
  15. Bregman, D. B., Du, L., van der Zee, S., Warren, S. L. (1995) Transcription-dependent redistribution of the large subunit of RNA polymerase II to discrete nuclear domains. J. Cell Biol. 129,287-298[Abstract/Free Full Text]
  16. Mendelsohn, A., a. B., R. (1994) Applications of interaction traps/two-hybrid systems to biotechnology research. Curr. Opin. Cell Biol. 5,482-486
  17. Fields, S., a. S., R. (1994) The two hybrid system: an assay for protein-protein interactions. Trends Genet 10,286-292[CrossRef][Medline]
  18. Chien, C. T., , B. P., Sternglanz, R., Fields, S. (1991) The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88,9578-9582[Abstract/Free Full Text]
  19. Furutani, Y., Notake, M., Fukui, T., Uhue, M., Nomura, H., Yamada, M., Nakamura, S. (1986) Complete nucleotide sequence of the gene for human interleukin 1 alpha. Nucleic Acids Res 14,3167-3179[Abstract/Free Full Text]
  20. Beuscher, H. N., Nickells, M. W., Colten, H. R. (1988) The precursor of interleukin-1 alpha is phosphorylated at residue serine 90. J. Biol. Chem. 263,4023-4028[Abstract/Free Full Text]
  21. Jans, D., Hubner, S. (1996) Regulation of protein transport to the nucleus: central role of phosphorylation. Physiol. Rev. 76,651-685[Abstract/Free Full Text]
  22. Mintz, P. J., Spector, D. L. (2000) Compartmentalization of RNA processing factors within nuclear speckles. J. Struct. Biol. 129,241-251[CrossRef][Medline]
  23. Sleeman, J. E., Lamond, A. I. (1999) Nuclear organization of pre-mRNA splicing factors. Curr. Opin. Cell Biol. 11,372-377[CrossRef][Medline]
  24. Wei, X., Somanathan, S., Samarabandu, J., Berezney, R. (1999) Three-dimensional visualization of transcription sites and their association with splicing factor-rich nuclear speckles. J. Cell Biol. 146,543-558[Abstract/Free Full Text]
  25. Puvion, D., Puvion-Dutilleul, F. (1996) Ultrastructure of the nucleus in relation to transcription and splicing: roles of perichromatin fibrils and interchromatin granules. Exp. Cell Res. 229,217-225[CrossRef][Medline]
  26. Zeng, C., Kim, E., Warren, S. L., Berget, S. M. (1997) Dynamic relocation of transcription and splicing factors dependent upon transcriptional activity. EMBO J 16,1401-1412[CrossRef][Medline]
  27. Lewis, J. D., Tollervey, D. (2000) Like attracts like: getting RNA processing together in the nucleus. Science 288,1385-1389[Abstract/Free Full Text]
  28. Manley, J. L., Tacke, R. (1996) SR proteins and splicing control. Genes Dev 10,1569-1579[Free Full Text]
  29. Valcarcel, J., Green, M. R. (1996) The SR protein family: pleiotropic functions in pre-mRNA splicing. Trends Biochem. Sci 21,296-301[CrossRef][Medline]
  30. Bruzik, J. P. (1996) Splicing glue: a role for SR proteins in trans splicing?. Microb. Pathogen. 21,149-155[CrossRef][Medline]
  31. Tacke, R., Manley, J. L. (1999) Functions of SR and Tra2 proteins in pre-mRNA splicing regulation. Proc. Soc. Exp. Biol. Med. 220,59-63[CrossRef][Medline]
  32. Blencowe, B. J., Bowman, J. A., McCracken, S., Rosonina, E. (1999) SR-related proteins and the processing of messenger RNA precursors. Biochem. Cell Biol. 77,277-291[CrossRef][Medline]
  33. Caputi, M., Mayeda, A., Krainer, A. R., Zahler, A. M. (1999) hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing. EMBO J 18,4060-4067[CrossRef][Medline]
  34. Weighardt, F., Biamonti, G., Riva, S. (1996) The roles of heterogeneous nuclear ribonucleoproteins (hnRNP) in RNA metabolism. BioEssays 18,747-756[CrossRef][Medline]
  35. Hanamura, A., Caceres, J. F., Mayeda, A., Franza, B. R., Jr, Krainer, A. R. (1998) Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. RNA 4,430-444[Abstract]
  36. Mayeda, A., Helfman, D. M., Krainer, A. R. (1993) Modulation of exon skipping and inclusion by heterogeneous nuclear ribonucleoprotein A1 and pre-mRNA splicing factor SF2/ASF. [published erratum: p. 4458].Mol. Cell. Biol. 13,2993-3001[Abstract/Free Full Text]
  37. Pellizzoni, L., Kataoka, N., Charroux, B., Dreyfuss, G. (1998) A novel function for SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing. Cell 95,615-624[CrossRef][Medline]
  38. Siatecka, M., Reyes, J. L., Konarska, M. M. (1999) Functional interactions of Prp8 with both splice sites at the spliceosomal catalytic center. Genes Dev 13,1983-1993[Abstract/Free Full Text]
  39. Luo, H. R., Moreau, G. A., Levin, N., Moore, M. J. (1999) The human Prp8 protein is a component of both U2- and U12-dependent spliceosomes. RNA 5,893-908[Abstract]
  40. Kuhn, A. N., Li, Z., Brow, D. A. (1999) Splicing factor Prp8 governs U4/U6 RNA unwinding during activation of the spliceosome. Mol. Cell 3,65-75[CrossRef][Medline]
  41. Jiang, Z. H., Wu, J. Y. (1999) Alternative splicing and programmed cell death. Proc. Soc. Exp. Biol. Med. 220,64-72[CrossRef][Medline]
  42. Budde, R. J., Ke, S., Levin, V. A. (1994) Activity of pp60c-src in 60 different cell lines derived from human tumors. Cancer Biochem. Biophys. 14,171-175[Medline]
  43. Liu, M. L., Winther, B. L., Kay, M. A. (1996) Pseudotransduction of hepatocytes by using concentrated pseudotyped vesicular stomatitis virus G glycoprotein (VSV-G)-Moloney murine leukemia virus-derived retrovirus vectors: comparison of VSV-G and amphotropic vectors for hepatic gene transfer. J. Virol. 70,2497-2502[Abstract]
  44. Conti, E., Izaurralde, E. (2001) Nucleocytoplasmic transport enters the atomic age. Curr. Opin. Cell Biol. 13,310-319[CrossRef][Medline]
  45. Jans, D., Xiao, C.-Y., Lam, M. (2000) Nuclear targeting signal recognition: a key control point in nuclear transport?. BioEssays 22,532-544[CrossRef][Medline]
  46. Wozniak, R. W., Rout, M. P., Aitchison, J. D. (1998) Karyopherins and kissing cousins. Trends Cell Biol 8,184-188[CrossRef][Medline]
  47. Lamond, A. I., Earnshaw, W. C. (1998) Structure and function in the nucleus. Science 280,547-553[Abstract/Free Full Text]
  48. Pombo, A., Cook, P. (1996) The localization of sites containing nascent RNA and splicing factors. Exp. Cell Res. 229,201-203[CrossRef][Medline]
  49. Krämer, A. (1996) The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu. Rev. Biochem. 65,367-409[CrossRef][Medline]
  50. Eilbracht, J., Schmidt-Zachmann, M. S. (2001) Identification of a sequence element directing a protein to nuclear speckles. Proc. Natl. Acad. Sci. USA 98,3849-3854[Abstract/Free Full Text]
  51. Cáceres, J. F., Screaton, G. R., Krainer, A. R. (1998) A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev 12,55-66[Abstract/Free Full Text]
  52. Dye, B., Patton, J. G. (2001) An RNA recognition motif (RRM) is required for the localization of PTB-associated splicing factor (PSF) to subnuclear speckles. Exp. Cell Res. 263,131-144[CrossRef][Medline]
  53. Mercatante, D. R., Bortner, C. D., Cidlowski, J. A., Kole, R. (2001) Modification of alternative splicing of Bcl-x Pre-mRNA in prostate and breast cancer cells. analysis of apoptosis and cell death. J. Biol. Chem. 276,16411-16417
  54. Pecci, A., Viegas, L. R., Baranao, J. L., Beato, M. (2001) Promoter choice influences alternative splicing and determines the balance of isoforms expressed from the mouse bcl-x gene. J. Biol. Chem. 276,21062-21069[Abstract/Free Full Text]
  55. Kupper, T. (1990) The activated keratinocyte: a model for inducible cytokine production by non-bone marrow-derived cells in cutaneous inflammatory and immune responses. J. Invest. Dermatol. 96(Suppl.),146S-150S
  56. Beasley, D., McGuiggin, M. E., Dinarello, C. A. (1995) Human vascular smooth muscle cells produce an intracellular form of interleukin-1 receptor antagonist. Am. J. Physiol. 269,C961-C968[Abstract/Free Full Text]
  57. Sanz, C., Benito, A., Silva, M., Albella, B., Richard, C., Segovia, J. C., Insunza, A., Bueren, J. A., Fernández-Luna, J. L. (1997) The expression of Bcl-x is downregulated during differentiation of human hematopoietic progenitor cells along the granulocyte but not the monocyte/macrophage lineage. Blood 89,3199-3204[Abstract/Free Full Text]
  58. Perera, L. P., Waldmann, T. A. (1998) Activation of human monocytes induces differential resistance to apoptosis with rapid down regulation of caspase-8/FLICE. Proc. Natl. Acad. Sci. USA 95,14308-14313[Abstract/Free Full Text]
  59. Honma, T., Hamasaki, T. (1996) Ultrastructure of multinucleated giant cell apoptosis in foreign-body granuloma. Virchows Arch 428,165-176[Medline]
  60. Matsunaga, K. I.M (2000) Quantitative analysis of apoptotic cell death in granulomatous inflammation induced by intravenous challenge with Cryptococcus neoformans and bacillus Calmette-Guérin vaccine. Pathol. Int. 50,206-218[CrossRef][Medline]
  61. Kavita, U., Mizel, S. B. (1995) Differential sensitivity of interleukin-1alpha and beta precursor proteins to cleavage by calpain, a calcium-dependent protease. J. Biol. Chem. 270,27758-27765[Abstract/Free Full Text]
  62. Thompson, J. D., Higgins, D. G., Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22,4673-4680[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
W. Cheng, P. Shivshankar, Y. Zhong, D. Chen, Z. Li, and G. Zhong
Intracellular Interleukin-1{alpha} Mediates Interleukin-8 Production Induced by Chlamydia trachomatis Infection via a Mechanism Independent of Type I Interleukin-1 Receptor
Infect. Immun., March 1, 2008; 76(3): 942 - 951.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Revil, J. Toutant, L. Shkreta, D. Garneau, P. Cloutier, and B. Chabot
Protein Kinase C-Dependent Control of Bcl-x Alternative Splicing
Mol. Cell. Biol., December 15, 2007; 27(24): 8431 - 8441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Portnoy, T. Pan, C. A. Dinarello, J. M. Shannon, J. Y. Westcott, L. Zhang, and R. J. Mason
Alveolar type II cells inhibit fibroblast proliferation: role of IL-1{alpha}
Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L307 - L316.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. P. Mishra, R. Pal, and C. Shaha
Changes in Cytosolic Ca2+ Levels Regulate Bcl-xS and Bcl-xL Expression in Spermatogenic Cells during Apoptotic Death
J. Biol. Chem., January 27, 2006; 281(4): 2133 - 2143.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. D. Thompson, S. R. Holbrook, K. Katoh, P. Koehl, D. Moras, E. Westhof, and O. Poch
MAO: a Multiple Alignment Ontology for nucleic acid and protein sequences
Nucleic Acids Res., July 25, 2005; 33(13): 4164 - 4171.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. P. Venables
Aberrant and Alternative Splicing in Cancer
Cancer Res., November 1, 2004; 64(21): 7647 - 7654.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Werman, R. Werman-Venkert, R. White, J.-K. Lee, B. Werman, Y. Krelin, E. Voronov, C. A. Dinarello, and R. N. Apte
The precursor form of IL-1{alpha} is an intracrine proinflammatory activator of transcription
PNAS, February 24, 2004; 101(8): 2434 - 2439.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Buryskova, M. Pospisek, A. Grothey, T. Simmet, and L. Burysek
Intracellular Interleukin-1{alpha} Functionally Interacts with Histone Acetyltransferase Complexes
J. Biol. Chem., February 6, 2004; 279(6): 4017 - 4026.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
F. J. Schaub, W. C. Liles, N. Ferri, K. Sayson, R. A. Seifert, and D. F. Bowen-Pope
Fas and Fas-Associated Death Domain Protein Regulate Monocyte Chemoattractant Protein-1 Expression by Human Smooth Muscle Cells Through Caspase- and Calpain-Dependent Release of Interleukin-1{alpha}
Circ. Res., September 19, 2003; 93(6): 515 - 522.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by POLLOCK, A. S.
Right arrow Articles by LOVETT, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by POLLOCK, A. S.
Right arrow Articles by LOVETT, D. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS