FASEB J. Pierce now sold as Thermo Scientific
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FISCHER, D. F.
Right arrow Articles by VAN LEEUWEN, F. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FISCHER, D. F.
Right arrow Articles by VAN LEEUWEN, F. W.
(The FASEB Journal. 2003;17:2014-2024.)
© 2003 FASEB

Disease-specific accumulation of mutant ubiquitin as a marker for proteasomal dysfunction in the brain

DAVID F. FISCHER, ROB A. I. DE VOS*, RENSKE VAN DIJK, FEMKE M. S. DE VRIJ, EVELIEN A. PROPER{dagger}, MARC A. F. SONNEMANS, MARIAN C. VERHAGE, JACQUELINE A. SLUIJS, BARBARA HOBO, MOHAMED ZOUAMBIA, ERNST N. H. JANSEN STEUR*, WOUTER KAMPHORST{ddagger}, ELLY M. HOL and FRED W. VAN LEEUWEN1

Graduate School for Neurosciences Amsterdam and Netherlands Institute for Brain Research, Amsterdam, The Netherlands;
* Pathological Laboratory Oost Nederland and Medisch Spectrum Twente, Enschede, The Netherlands;
{dagger} Rudolf Magnus Institute for Neurosciences, Utrecht Medical Centre, The Netherlands; and
{ddagger} Department of Neuropathology, University Hospital Free University, Amsterdam, The Netherlands

1Correspondence: Netherlands Institute for Brain Research, Meibergdreef 33, 1105 AZ Amsterdam The Netherlands. E-mail: f.van.leeuwen{at}nih.knaw.nl


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Molecular misreading of the ubiquitin-B (UBB) gene results in a dinucleotide deletion in UBB mRNA. The resulting mutant protein, UBB+1, accumulates in the neuropathological hallmarks of Alzheimer disease. In vitro, UBB+1 inhibits proteasomal proteolysis, although it is also an ubiquitin fusion degradation substrate for the proteasome. Using the ligase chain reaction to detect dinucleotide deletions, we report here that UBB+1 transcripts are present in each neurodegenerative disease studied (tauo- and synucleinopathies) and even in control brain samples. In contrast to UBB+1 transcripts, UBB+1 protein accumulation in the ubiquitin-containing neuropathological hallmarks is restricted to the tauopathies such as Pick disease, frontotemporal dementia, progressive supranuclear palsy, and argyrophilic grain disease. Remarkably, UBB+1 protein is not detected in the major forms of synucleinopathies (Lewy body disease and multiple system atrophy). The neurologically intact brain can cope with UBB+1 as lentivirally delivered UBB+1 protein is rapidly degraded in rat hippocampus, whereas the K29,48R mutant of UBB+1, which is not ubiquitinated, is abundantly expressed. The finding that UBB+1 protein only accumulates in tauopathies thus implies that the ubiquitin-proteasome system is impaired specifically in this group of neurodegenerative diseases and not in synucleinopathies and that the presence of UBB+1 protein reports proteasomal dysfunction in the brain.—Fischer, D. F., de Vos, R. A. I., van Dijk, R., De Vrij, F. M. S., Proper, E. A., Sonnemans, M. A. F., Verhage, M. C., Sluijs, J. A., Hobo, B., Zouambia, M., Jansen Steur, E. N. H., Kamphorst, W., Hol, E. M., van Leeuwen, F. W. Disease-specific accumulation of mutant ubiquitin as a marker for proteasomal dysfunction in the brain.


Key Words: tauopathies • synucleinopathies • molecular misreading • UBB+1 • lentivirus


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ALZHEIMER DISEASE(AD) is a multifactorial disease. Current views on the etiology of AD range from the ß-amyloid hypothesis (1) and aberrant tau metabolism (2) to a combination of genetic (apolipoprotein E polymorphism) (3) and nongenetic risk factors, such as age, and a reduction of neuronal activity (4) . Regarding the genetic contribution, only a minority of cases concerns autosomal dominant forms of AD with mutations in the ß-amyloid precursor protein (APP) or the presenilin genes (5) . The presence of one or two ApoE4 alleles can contribute to neurodegeneration in ~30% of all AD cases (3) .

We earlier reported on a novel type of transcript mutation in neurons of elderly people and in those of sporadic AD and Down syndrome (DS) patients (6 , 7) . In these patients, dinucleotide deletions ({Delta}GA, {Delta}GU, {Delta}CU) were found in two transcripts (i.e., ßAPP and ubiquitin B, UBB) implicated in these neurodegenerative diseases (7) . Hot spots for these dinucleotide deletions appear to be simple repeats, such as GAGAG motifs (8) . The process of unfaithful transcription of genomic information into aberrant mRNA and the subsequent production of frameshifted proteins has been termed "molecular misreading" (9) . These mutant proteins, carboxyl-terminally translated in the +1 reading frame of the mRNA, have been called +1 proteins. In Alzheimer disease and Down syndrome, APP+1 and UBB+1 accumulate in affected regions of the brain and coexist in the neuritic plaques and tangles (7) . During the development of neuropathology and/or aging, neurons either start producing aberrant transcripts or lose the ability to degrade these transcripts and +1 proteins. In other words, during aging and particularly in neurodegenerative disease, transcript and protein quality control mechanisms, such as proteasomal protein degradation, may work less efficiently (9) . Several groups have already shown that UBB+1 protein blocks the proteasome (10 , 11) , which can result in neuronal apoptosis (12) .

The accumulation of UBB+1 protein in the hallmarks of AD and DS raises the question whether the manifestation of molecular misreading is restricted to these forms of dementia or whether it occurs in other non-Alzheimer type neurodegenerative diseases (i.e., the tauo- and synucleinopathies) as well. In a great number of neurodegenerative disease, ubiquitin or ubiquitinated proteins accumulate, which are thought to be involved in the development of these diseases (18) . In the present study we examined the major forms of tauopathies—Pick disease (PiD), frontotemporal dementia (FTD), progressive supranuclear palsy (PSP), and argyrophilic grain disease (AGD) (13 , 14) —and the most frequently occurring forms of synucleinopathies (15 , 16) —Lewy body disease (LBD, clinically Parkinson’s disease) and multiple system atrophy (MSA)—for the presence of mutant ubiquitin. We detected a clear difference in UBB+1-containing inclusions between tauopathies and synucleinopathies. Experiments performed with lentiviral vectors in the rat hippocampus indicate that proteasomal dysfunction could be the reason for the differential accumulation in neurodegenerative disease.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ligase chain reaction
Detection of UBB mRNA containing a GU dinucleotide deletion was performed using a ligase chain reaction (LCR) (17) . Two micrograms of total RNA was reverse-transcribed with hexanucleotides and Expand reverse transcriptase (Roche Diagnostics Nederland BV, Almere, The Netherlands). The UBB cDNA was amplified by PCR using primers 5'ACCGGCAAGACCATCACCCT and 5'-GGGTCTTCACGAAGATCTGCA and Expand High Fidelity polymerase (Roche). The PCR product was purified on silica powder in guanidine thiocyanate and used in a ligase chain reaction of 20 µL containing 20 mM Tris-Cl (pH7.5), 20 mM KCl, 10 mM MgCl2, 0.1% NP-40, 0.01 mM ATP, 1 mM DTT, 5 µg salmon sperm DNA, 8 u Pfu DNA ligase (Stratagene Europe, Amsterdam, The Netherlands), and 5 pmol of each oligonucleotide: 5'-TTCCTGGTCCTGCGTCTGAGAGG, 5'-phosphate-CTCTCAGACGCAGGACCAGG, 5'-phosphate-GTATGCAGATCTTCGTGAAGACC, 6-FAM-5'TTGTCTTCACGAAGATCTGCATACC. Reaction conditions were: 4 min 92°C, 4 min 65°C, 35 cycles of 20 s 92°C, 20 s 65°C. Samples were run on an 8% polyacrylamide gel and scanned with a STORM 860 imager (Molecular Dynamics, Sunnyvale, CA, USA). Sensitivity of the {Delta}GU LCR was 10 amol dsDNA; specificity was 1 {Delta}GU cDNA in 80,000 wild-type UBB cDNA.

Autopsy material
Postmortem material of the major types of tauopathies and synucleinopathies was obtained from different sources (Pathological Laboratory Oost-Nederland, Enschede; Netherlands Brain Bank, Amsterdam and Utrecht Medical Center). We were able to identify almost pure forms of each type of neurological disorder by neurohistological prescreenings, excluding cases showing a combination of different neuropathological entities, such as Lewy body disease and AD. All these neurological disorders were studied in 6 µm paraffin sections using reported immunocytochemical methodology (7) .

Antibodies
Specificity (including Western blot analysis, ref 12 ) of four different UBB+1 antisera [rabbits were immunized with different specific peptides of the UBB+1 protein: Y-Q (11AA, #160294), UBB1+1, R-Q (11AA, UBB 2+1, #010994, and #020698 Ubi2A), and Y-Q (20AA, # 050897, Ubi3] has been reported before (7 , 12) and was confirmed in the present study (Fig. 2) . Absorption with the homologous antigen resulted in an absence of staining. Other antibodies were used as the positive immunohistochemical controls: MC 1 and AT 8, both markers for aberrant or hyperphosphorylated tau (19) ; human leukocyte antigen (HLA) DP-DR-DQ (CR3/43, DAKO) for activated microglia; 22C11, a gift from Dr. T. Hartmann, Heidelberg, Germany, for ßAPP; MoAb 3-39 (7) and a rabbit antibody (Z 0458, DAKO, Glostrup, Denmark) for ubiquitin; NCL-A SYN (clone KM51, Novacastra) for {alpha}-synuclein.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 2. Consecutive sections (a–c) of the hippocampus of a Pick’s disease patient (#93082) incubated with three different UBB+1 antisera. a) Ubi 1+1 #160294;1;300, b) Ubi 2+1 #010994;1;400, c) Ubi2A #020698;1:400) showing UBB+1 immunoreactive inclusions in the pyramidal cells of the CA1 area. Note their colocalization in various cells ({blacktriangleup}). * = capillary. d) In an adjacent section the same cell group was stained with UBB+1 antiserum Ubi3 #050897 (1:400) whereas e) the absorption control of #020698 (1:400) was shown. Amino acid sequences against which the antibodies to UBB+1 were raised are shown below panels a–e. Magnification bar = 25 µm.

Lentiviral injections
cDNAs for GFP, UBB+1, and UBB+1 containing a Lys to Arg mutation at positions 29 and 48 were cloned in the lentiviral transfer plasmid pRRLsin-PPThCMV-GFP-pre (20 , 21) . VSV-G pseudotyped lentivirus was produced by cotransfection of the transfer plasmid and helper plasmids (pCMVdeltaR8.74 and pMD.G.2) in 293T cells. Medium was harvested 24 and 48 h after transfection and concentrated by ultracentrifugation. Virus pellets were resuspended in PBS containing 0.5% bovine serum albumin. Stocks were titered with a HIV-1 p24 coat protein ELISA (NEN Research, Boston, MA, USA). Lentiviral vectors were used to infect SH-SY5Y neuroblastoma cells at a multiplicity of infection (moi) of 10. After 48 h epoxomicin was added to the culture medium (0.5 µM, Affinity Research, Exeter, UK) for 16 h to inhibit the proteasome. Cells were scraped in Laemmli buffer and analyzed on Western blot (Ubi3 antibody). Detection was performed with enhanced chemiluminescence (ECL, Perkin-Elmer Life Science, Norwalk, CT, USA).

Before injection into rat brain, stocks for LV-UBB+1 and GFP (green fluorescent protein) were mixed and diluted with PBS containing 0.5% BSA, resulting in 4.105 particles LV-UBB+1 and 4.104 particles LV-GFP per microliter. Male adult Wistar rats (200–250 g, Harlan NL, n=3) were anesthestized with 1 mL/kg Hypnorm (0.315 mg/mL fentanyl citrate, 10 mg/mL fluanisone). The skull was exposed and coordinates for injection (-3.3 mm anterior-posterior, 1.7 mm lateral, and -3.5 dorsoventral from the dura) were read against bregma (22) . Stereotactic injection of 1 µL was performed with a 30G stainless steel needle connected to a motor-driven Hamilton syringe for 5 min at 0.2 µL/min. After the needle was slowly (over 5 min) withdrawn, the skin was sutured. Seven days after injection the animals were perfused intracardially with PBS, followed by PBS containing 4% paraformaldehyde. Brains were cut on a vibratome in 50 µm-thick sections and stained with anti-UBB+1 (Ubi3, 1:500) or anti-GFP (Chemicon AB3080 1:50) serum, followed by a peroxidase/anti-peroxidase sandwich and DAB-Ni color reaction. GFP was imaged directly with confocal laser scanning microscopy (Zeiss LSM 410), whereas UBB+1 protein was visualized with the Ubi3 antibody and donkey anti-rabbit Cy3. DNA was counterstained with TO-PRO-3 (Molecular Probes, Leiden, The Netherlands). All animal experiments were performed under the guidance of the local animal experimentation committee.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
UBB mRNA with a dinucleotide deletion is not disease-specific
To analyze dinucleotide deletions ({Delta}GU) in ubiquitin-B transcripts in an array of neurological disorders, we analyzed the mRNA from a large number of samples. The mRNA was isolated from the areas affected in the disease studied (e.g., hippocampus in Pick disease, amygdala in AGD, Table 1 and Table 2 ). A new strategy was followed, enabling a sensitive and specific assessment of molecular misreading of the UBB gene at the mRNA level. Dinucleotide deletions ({Delta}GU) in UBB mRNA are detected by a ligase chain reaction (LCR) (17 , 23) . In this assay four primers flank the GT dinucleotide in UBB cDNA. If these primers hybridize on a cDNA lacking this dinucleotide, adjacent oligonucleotides can be ligated by a thermostable ligase. The ligated oligonucleotides are a substrate in the subsequent rounds of amplification. If the oligonucleotides hybridize on wild-type UBB cDNA (which is present in excess), the high reaction temperature and specificity of the ligase do not allow ligation. We can detect UBB mRNA containing a dinucleotide deletion in every tested brain sample of all types of neurological disorders, but not in samples of genomic DNA or in various neuronal cell lines (Fig. 1 and Table 1 ). Unexpectedly, even brain samples (hippocampus and cortex) of young nondemented controls (i.e., 38–49 years old) contain UBB{Delta}GU mRNA.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of +1 immunoreactivities (ICC) and transcript detection by LCR in various types of neuropathology


View this table:
[in this window]
[in a new window]
 
Table 2. Details of patients with different types of neurological disease



View larger version (61K):
[in this window]
[in a new window]
 
Figure 1. Ligase chain reaction was performed on human genomic DNA and on a nontemplate RT-PCR (left lanes) as negative controls or on mRNA from human brain tissue (1 µL of RT-PCR or 0.1 µL of RT-PCR in pairs of lanes). The samples were 1 and 2: nondemented controls # 97162 and # 98169; 3 and 4: DS # 94058 and # 93028; 5 and 6: AGD # 97204 and # 94043; 7 and 8 FTD # 94111 and # 99005; 9: PSP # 98208; 10 and 11: PiD # 95086 and # 92079; 12: LBD # 97252. No signal was obtained in various cell lines (SK-N-SH, SK-N-AS and CHP-100, data not shown). Primers and reaction product (UBB{Delta}GU) are indicated. Other samples tested are indicated in Table 2 by an asterisk (*).

Neuropathological hallmark identification and antibody specificity studies
Characteristic neuropathological hallmarks of each disease (e.g., Pick bodies and tangles, see also legends of Fig. 2 and Fig. 3 ) were first positively identified using antibodies against aberrant, hyperphosphorylated tau (13 , 19) , ubiquitin, or {alpha}-synuclein (15) (Fig. 3 and Fig. 4 , left and right column, Table 1 ). In consecutive sections of the hippocampus of four Pick patients (boldface in Table 2 ), four UBB+1 antisera directed against three different epitopes stained the same population of pyramidal cells in the CA1 area (Fig. 2a-d ). Antibody specificity controls for UBB+1 staining (e.g., preabsorption with the antigen) were negative (Fig. 2e ).



View larger version (147K):
[in this window]
[in a new window]
 
Figure 3. Immunocytochemical staining of various tauopathies. a–c) Pick’s disease (#18001); d–f) frontotemporal dementia (#99005); g–k) progressive supranuclear palsy (#98198); l–n) argyrophilic grain disease (#98058). Hyperphosphorylated tau (MC1) staining in left column (a, d, g, l), UBB+1 protein staining in middle column (b, e, h, I, m) and ubiquitin in right column (c, f, j, k, n). a–c) Note MC1, UBB+1, and ubiquitin-positive Pick bodies in granular cells of the gyrus dentatus (gd) of the hippocampus. b) Insert shows nuclei next to dense Pick bodies ({blacktriangleup}). In FTD (#99005, d–f) within the granular layer of the gd of the hippocampus, tangle-like (globoid) inclusions can be seen with MC1, UBB+1 protein and ubiquitin. The same goes for the pyramidal cells of CA1 of the hippocampus. In PSP in the gray matter of the preforontal cortex both MC1 (g), UBB+1 protein (h), and ubiquitin (k) immunoreactive tangles can be seen. UBB+1 protein (i) and ubiquitin (k) immunoreactive cytoplasmic inclusions can be seen in the glial cells of the white matter. In argyrophilic grain disease (l–n), abundant MC1, UBB+1, and ubiquitin-positive grains can be seen in the amygdala. Magnification bars in all panels = 25 µm; b) insert = 15 µm.



View larger version (149K):
[in this window]
[in a new window]
 
Figure 4. Immunocytochemical staining in two synucleinopathies. In adjacent sections of LBD (a–c) the characteristic {alpha}-synuclein (a), UBB+1 (b), and ubiquitin (c) immunoreactive fibers can be seen in CA2 of the hippocampus (a–c #96028). Inserts: a) Lewy neurites (right corner), immunoreactive for {alpha}-synuclein or ubiquitin can be seen. Left insert shows {alpha}-synuclein-positive Lewy bodies (#21044); c) ubiquitin immunoreactive cortical Lewy bodies in the gyrus cinguli (#96056; arrowheads) are shown. On the other hand, UBB+1 protein (b) is not detectable in CA2 (GD=dentate gyrus) nor in cortical Lewy bodies of the gyrus cingulatus. Classical Lewy bodies in the substantia nigra had already been shown to be negative (7) . b)Insert shows UBB+1 protein negative Lewy body. In multisystem atrophy (d–f, #20991), astroglial cells (f, note characteristic ubiquitin immunoreactive cytoplasmic structure: "hood") are present in the white matter of the putamen of consecutive sections, immunoreactive for {alpha}-synuclein (d) and ubiquitin (f), whereas UBB+1 protein is absent (e) (*=capillary). In both types of synucleinopathies it can be seen that {alpha}-synuclein (a, d) is more abundant than ubiquitin (c, f). Magnification = 100 µm (a–f), 25 µm (inserts: a–c, f).

Tauopathies
In each of the tauopathies reported here [Pick disease (PiD, Fig. 2a-d , and 3b ), (Fig. 2e ), progressive supranuclear palsy (PSP, Fig. 3h, i ; see also ref 24 ), and argyrophilic grain disease (AGD, Fig. 3m )], we could detect UBB+1 protein in their neuropathological hallmark inclusions. UBB+1 protein is observed in a subpopulation of the ubiquitin-positive inclusions, such as Pick bodies in PiD (granular cells of the dentate gyrus of the hippocampus and pyramidal cells in the CA1 area), neurofibrillary and glial tangles in gray matter of the prefrontal cortex in PSP, and coiled bodies in white matter of PSP (Fig. 3i ). These data show that besides neurons, glial cells can express proteins derived from mRNAs with dinucleotide deletions. In all AGD cases (13 , 25) , grains in the amygdala (Fig. 3m ) and hippocampus (not shown) are very intensely labeled by the UBB+1antibodies.

In cases of FTD, a disease that can be linked to a mutation in tau (26 27) (see Tables 1 and 2 for details and type of mutation), three of eight examples show UBB+1 protein staining (Fig. 3e ). The immunopositive structures, such as cytoplasmic inclusions in the dentate gyrus (globoid tangles) and pyramidal cells of the CA1 of the hippocampus, are also positive for abnormal, hyperphosphorylated tau and for ubiquitin. The heterogeneity in the clinical phenotype of frontotemporal dementia, perhaps reflected here in the heterogeneous UBB+1 protein staining, has recently been discussed (27 28) . The observation that in most cases ubiquitin staining is more intense than UBB+1 staining could be due to sensitivity; for instance, ubiquitinated UBB+1 with several ubiquitin molecules attached, ref 10 ) has only one epitope for anti-UBB+1, but most likely several epitopes for ubiquitin antibodies. On the other hand, this difference in staining pattern could reflect the accumulation of UBB+1 after the accumulation of other ubiquitinated proteins.

Synucleinopathies
We have examined two synucleinopathies: Lewy body disease (clinically Parkinson disease) and MSA. We failed to detect UBB+1-positive inclusions in LBD, Lewy neurites, or cortical or classical Lewy bodies (Fig. 4a-c ) in an even larger group of patients than previously reported (7) . MSA reveals no detectable UBB+1 protein (Fig. 4e ), whereas {alpha}-synuclein (Fig. 4d ) and ubiquitin (Fig. 4f ) stainings were intense.

UBB+1 does not accumulate due to neuronal damage or overactivation
To investigate the mechanism for the differential accumulation of UBB+1 in neurodegenerative disease, we checked the expression of UBB+1 protein in two other neurological diseases (multiple sclerosis and epilepsy) as a control for neuronal damage or overactivation, respectively. UBB+1 protein was not detected in areas surrounding the various types of plaques in multiple sclerosis (29) , whereas ßAPP could be readily detected in damaged axons (29) and HLA-expressing microglia can be seen in an active lesion (Fig. 5 ). Furthermore, in the hippocampal area in temporal lobe epilepsy, we did not detect UBB+1 (data not shown). These data suggest that UBB+1 accumulation is not a secondary response to neurodegeneration.



View larger version (95K):
[in this window]
[in a new window]
 
Figure 5. Adjacent sections of an MS patient (#91070). Intense staining for ßAPP by antibody 22C11 (a) and HLA DP-DR-DQ(c) is shown in the capsula interna near an active MS lesion (for details, see ref 29 ), whereas UBB+1 protein is not detected (b). c) Magnification bar = 80 µm.

UBB+1 is degraded by the ubiquitin-proteasome system in the hippocampus
Our findings indicate that in syncleinopathies and control subjects (7) , either UBB+1 mRNA is not translated or, which is more likely, the degradation of UBB+1 protein occurs very efficiently as we have shown in cell lines (11) . The degradation in vitro of UBB+1 is dependent on the proteasome and requires ubiquitination of the lysine residues at positions 29 and 48 of UBB+1 (11) . We wanted to test whether UBB+1 expression is monitored by the proteasome in vivo in the hippocampus, an area affected in a number of neurodegenerative diseases. Lentiviral vectors (19 , 20) were generated for UBB+1 and a stable mutant of UBB+1 that lacks the lysine residues at positions 29 and 48. We first tested the activity of the lentiviral vectors on SH-SY5Y neuroblastoma cells. UBB+1 protein was expressed at low levels, whereas the K29,48R mutant is expressed at high levels (Fig. 6 A). The low expression of UBB+1 is due to degradation by the proteasome, as addition of the proteasome inhibitor epoxomicin to the culture medium boosts the expression levels. The K29,48R mutant is not degraded by the proteasome and, as expected, expression is not stimulated by epoxomicin (which is slightly cytotoxic at these concentrations). Note the presence of ubiquitinated UBB+1 protein, which is not present in the K29,48R mutant.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 6. A) Western blot of lentivirus-transduced SH-SY5Y neuroblastoma cells. After transduction with UBB+1 or K29,48R mutant UBB+1 viral vectors, the proteasome was inhibited with epoxomycin (Epx). Lysates were probed with Ubi3 antibody. UBB+1 protein has an apparent molecular mass of 11 kDa (indicated by the arrowhead). Note the presence of UBB+1 in the UBB+1 lentiviral vector transduced cells after proteasome inhibition, whereas K29,48R mutant UBB+1 expression does not depend on proteasome inhibition. B) Adjacent sections of the rat brain after lentiviral transduction of the dentate gyrus of the hippocampus. 4.105 particles LV-UBB+1 and 4.104 particles LV-GFP were mixed and injected. Representative animal, stained for GFP (left panel) or UBB+1 protein (middle panel). In the right panel, UBB+1 protein expression of granule cells of the dentate gyrus is visualized in the red channel, GFP in the green channel; DNA staining (TO-PRO) is in the blue channel. The upper panels are from an animal injected with a mixture of LV-GFP and LV-UBB+1, the lower panels from an animal injected with LV-GFP and LV-UBB+1-K29,48R constructs. Note that in the upper panel only a single UBB+1-positive cell (red) is present, whereas in the lower panel many UBB+1-positive cells are visible. Colocalization of UBB+1-K29,48R and GFP immunoreactvity is detectable (yellow).

Subsequently, lentiviral vectors were spiked with a lentiviral GFP vector as a positive control and injected stereotactically in the adult rat hippocampus. The animals were perfused after 7 days and stained for UBB+1 and GFP protein expression (Fig. 6B ). Clearly, very few cells are positive for UBB+1 protein whereas the K29,48R mutant of UBB+1 is abundantly present in the dentate gyrus of the hippocampus. The GFP vector gives similar expression in all animals, indicating that UBB+1 protein in the neurologically intact brain is efficiently degraded by the ubiquitin-proteasome system.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Previously we reported that we did not detect UBB+1 protein in young controls as long as they were devoid of neuropathology, whereas in an elderly control (with some neuropathology) {Delta}GU deleted transcripts and UBB+1 protein were found (7) . The present study shows that UBB+1 transcripts are generated in the human brain, irrespective of neuropathology, and can even be detected in nondemented controls. The process of molecular misreading (i.e., the generation of transcripts with a dinucleotide deletion) is apparently widespread in tissues, and neuropathological differences arise at the UBB+1 protein level. The possibility that the accumulation of UBB+1 protein is a secondary response to general neuronal dysfunctioning is unlikely, as indicated by the absence of staining in multiple sclerosis and in epilepsy. Moreover, molecular misreading was first described in apparently normally functioning vasopressin neurons (30) and also occurs in non-neuronal cells such as hepatocytes (31) . The data presented in this paper show that UBB+1 accumulates in those neuropathological aggregates that also contain ubiquitin or ubiquitinated proteins. We have shown that UBB+1 is a ubiquitin fusion degradation substrate that is ubiquitinated (11) . If UBB+1 is expressed at low levels in cell lines, it can be degraded by the proteasome (Fig. 6A ) (11) . However, at higher levels UBB+1 can also inhibit the proteasome in vitro and in cell lines (10 , 11) and subsequently induce cell death (12) . The expression of UBB+1 protein could thus, after it has crossed a threshold, induce further accumulation of UBB+1. In the rat hippocampus transduced with lentiviral vectors, UBB+1 protein is degraded efficiently by the proteasome whereas (K29,48R) mutant UBB+1 protein, which is neither tagged by ubiquitin nor degraded by the proteasome, accumulates to high levels. Consequently, we suggest that accumulation of UBB+1 protein is a marker for proteasomal dysfunction in the human brain.

The remarkable differential neuropathological accumulation of UBB+1 protein (tauopathies vs. synucleinopathies) and the presence of UBB+1 transcripts in both diseases could be caused by differences in protein degradation via the ubiquitin-proteasome system (32) . As we cannot detect UBB+1 protein in synucleinopathies, whereas tauopathies show high levels of UBB+1 protein, we propose that specifically in tauopathies the proteasome is inhibited. Recently it has been shown biochemically that the proteasome is (partially) inhibited in Alzheimer disease (41 , 47) . In vitro, tau paired helical filaments can inhibit the proteasome (47) , which is further evidence for our proposal that UBB+1 accumulates in tauopathies due to proteasome inhibition. An impairment of the ubiquitin-proteasome system resulting in the aggregation of aberrant proteins has been suggested in a number of neurological disorders (33) . Ubiquitinated dot-like structures and accumulation of ßAPP were observed in the nervous system of mice suffering from axonal gracile dystrophy due to an intragenic deletion of the UCH-L1 gene (43) . Furthermore, mutation of the E6-AP ubiquitin ligase gene can modify the number of nuclear inclusions in a mouse model for spinocerebellar ataxia-1 (SCA-1) (44) .

For Parkinson disease it has been suggested that {alpha}-synuclein, present in Lewy bodies, is mono- and di-ubiquitinated (34 , 45) . It was shown that Parkin, which is mutated in autosomal recessive Parkinson disease, acts as an E3 ubiquitin ligase for {alpha}-synuclein (34) . Very recently a mutation in the DJ-1 gene was reported with autosomal recessive early-onset Parkinsonism (35) . Database comparison suggests the involvement of DJ-1 protein in the oxidative stress response. It is of great interest that ubiquitin-conjugation is not required for the degradation of oxidized proteins by the proteasome (36) . Indeed, it was reported that {alpha}-synuclein metabolism and aggregation are linked to ubiquitin-independent degradation by the proteasome (37) . The fact that in LBD as well as in MSA, {alpha}-synuclein is more prominent in cells than ubiquitin (Fig. 4) , also points to a less important role for general proteasome dysfunction in synucleinopathies (ref 38 ; R. A. I. de Vos, unpublished data). Nevertheless, it was also shown that a loss of {alpha} subunits of the proteasome occurs in the substantia nigra in Parkinson’s disease (39) . However, it has been suggested that a systemic, global disturbance in the catalytic activity and degradation ability of the proteasome itself is probably not causal for Parkinson disease (40 , 42 , 46) .

In conclusion, the presence of UBB+1 protein in neuronal and glial inclusions acts as a reporter for an impaired activity of the proteasome in these cells. We believe that UBB+1 levels can be used as a general measure for proteasome inhibition in a variety of human tissues (e.g., the liver; ref 31 ). The accumulation of ubiquitinated UBB+1 could inhibit the proteasome even further (10 11 12) , an aspect that is under further study. Apparently, proteasomal activity in tauopathies is more severely impaired compared with synucleinopathies.


   ACKNOWLEDGMENTS
 
We thank Dr. Naldini of the Institute for Cancer Research, University of Torino Medical School, Italy for the lentiviral plasmids and protocols. We thank Simone Niclou, Ruben Eggers, and Joost Verhaagen for their help with the lentiviral experiments and Inge Huitinga for the experiments on MS. We thank Dr. J. M. Ruijter (University of Amsterdam) for his critical remarks and Nienke Nieuwenhuizen, Olga Pach, Wilma Verweij, and Gerben van der Meulen for their skilled assistance. We are grateful to the technicians of the Netherlands Brain Bank (Anne Holtrop, Michiel Kooreman, José Wouda, and Afra van den Berg; coordinator Rivka Ravid, Amsterdam, the Netherlands), to G. Jansen, C. W. M. van Veelen, and P. C. van Rijen (Utrecht Medical Centre) for supplying brain material and to P. Davies (New York) for MC1 antiserum. Dr. R. Benne and the Department of Biochemistry of the University of Amsterdam are thanked for helpful discussions and the use of the STORM apparatus, respectively. Financial support was given by the 5th Framework "Quality of life and management of living resources" EU grant (QLRT-1999-02238), IBRO (research fellowship M. Zouambia), The van Leersum Foundation, Human Frontier Science Program Organization (HFSP: RG0148/1999-B), Hersenstichting Nederland (H00.06), Platform Alternatieven voor Dierproeven (#98-19) Jan Dekker en dr. Ludgardine Bouwmanstichting, Internationale Stichting Alzheimer Onderzoek (ISAO), Van Leersum Fund, and NWO Geheugenprocessen en Dementie.

Received for publication March 25, 2003. Accepted for publication June 12, 2003.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Selkoe, D. J. (2001) Alzheimer’s disease: genes, proteins, and therapy. Physiol. Rev. 81,741-766[Abstract/Free Full Text]
  2. Lee, V. M., Goedert, M., Trojanowski, J. W. (2001) Neurodegenerative tauopathies. Annu. Rev. Neurosci. 24,1121-1159[CrossRef][Medline]
  3. Corder, E. H., Saunders, A. M., Strittmatter, W. J., Schmechel, D. E., Gaskell, P. C., Small, G. W., Roses, A. D., Jaines, J. L., Pericak-Vance, M. A. (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families. Science 261,921-933[Abstract/Free Full Text]
  4. Swaab, D. F., Lucassen, P. J., Salehi, A., Scherder, E. J. A., Van Someren, E. J. W., Verwer, R. W. H. (1998) Reduced neuronal activity and reactivation in Alzheimer’s disease.. Van Leeuwen, F. W. Salehi, A. Giger, R. J. Holtmaat, A. J. G. D. Verhaagen, J. eds. Neuronal Degeneration and Regeneration: From Basic Mechanisms to Prospects for Therapy Progress in Brain Research 117,343-377 Elsevier Amsterdam. [Medline]
  5. Van Broeckhoven, C. (1998) Alzheimer’s disease: identification of genes and genetic risk factors. Van Leeuwen, F. W. Salehi, A. Giger, R. J. Holtmaat, A. J. G. D. Verhaagen, J. eds. Neuronal Degeneration and Regeneration: From Basic Mechanisms to Prospects for Therapy Progress in Brain Research 117,315-325 Elsevier Amsterdam. [Medline]
  6. Van Leeuwen, F. W., Fischer, D. F., Kamel, D., Sluijs, J. A., Sonnemans, M. A. F., Benne, R., Swaab, D. F., Salehi, A., Hol, E. M. (2000) Molecular misreading: a new type of transcript mutation expressed during aging. Neurobiol. Aging 21,879-891[CrossRef][Medline]
  7. Van Leeuwen, F. W., De Kleijn, D. P. V., Van den Hurk, W. H., Neubauer, A., Sonnemans, M. A. F., Sluijs, J. A., Köycü, S., Ramdjielal, R. D. J., Salehi, A., Martens, S. J., et al (1998) Frameshift mutants of ß amyloid precursor protein and ubiquitin-B in Alzheimer’s and Down patients. Science 279,242-247[Abstract/Free Full Text]
  8. Van den Hurk, W. H., Willems, H. J., Bloemen, M., Martens, G. J. (2001) Novel frameshift mutations near short simple repeats. J. Biol. Chem. 276,11496-11498[Abstract/Free Full Text]
  9. Van Leeuwen, F. W., Burbach, J. P. H., Hol, E. M. (1998) Mutations in RNA: a first example of molecular misreading in Alzheimer’s disease. Trends Neurosci. 21,331-335[CrossRef][Medline]
  10. Lam, Y. A., Pickart, C. M., Alban, A., Landon, M., Jamieson, C., Ramager, R., Mayer, R. J., Layfield, R. (2000) Inhibition of the ubiquitin-proteasome system in Alzheimer’s disease. Proc. Natl. Acad. Sci. USA 97,9902-9906[Abstract/Free Full Text]
  11. Lindsten, K., De Vrij, F. M., Verhoef, L. G., Fischer, D. F., Van Leeuwen, F. W., Hol, E. M., Masucci, M. G., Dantuma, N. P. (2002) Mutant ubiquitin found in neurodegenerative disorders is a ubiquitin fusion degradation substrate that blocks proteasomal degradation. J. Cell Biol. 157,417-427[Abstract/Free Full Text]
  12. De Vrij, F. M. S., Sluijs, J. A., Gregori, L., Fischer, D. F., Hermens, W. T. J., Goldgaber, D., Verhaagen, J., Van Leeuwen, F. W., Hol, E. M. (2001) Mutant ubiquitin expressed in Alzheimer’s disease causes neuronal death. FASEB J. 15,2680-2688[Abstract/Free Full Text]
  13. Braak, H., Braak, E. (1998) Argyrophilic grain disease: frequency of occurrence in different age categories and neuropathological diagnostic criteria. J. Neural Transm. 105,801-819[CrossRef][Medline]
  14. Spillantini, M. G., Goedert, M. (1998) Tau protein pathology in neurodegenerative diseases. Trends Neurosci. 21,428-433[CrossRef][Medline]
  15. Spillantini, M. G., Schmidt, M. L., Lee, V. M., Trojanowski, J. Q., Jakes, R., Goedert, M. (1997) Alpha-synuclein in Lewy bodies. Nature (London) 388,839-840[CrossRef][Medline]
  16. Goedert, M. (2001) The significance of tau and alpha-synuclein inclusions in neurodegenerative diseases. Curr. Opin. Genet. Dev. 11,343-351[CrossRef][Medline]
  17. Barany, F. (1991) Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. USA 88,189-193[Abstract/Free Full Text]
  18. Alves-Rodrigues, A., Gregori, L., Figueiredo-Pereira, M. E. (1998) Ubiquitin, cellular inclusions and their role in neurodegeneration. Trends Neurosci. 21,516-520[CrossRef][Medline]
  19. Jicha, G., Bowser, A. R., Kazam, I. G., Davies, P. (1997) Alz-50 and MC 1, a new monoclonal antibody raised to paired helical filaments, recognize conformational epitopes on recombinant tau. J. Neurosci. Res. 48,128-132[CrossRef][Medline]
  20. Naldini, L., Blomer, U., Gage, F. H., Trono, D., Verma, I. M. (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. USA 93,11382-11388[Abstract/Free Full Text]
  21. Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., Trono, D. (1996) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272,263-267[Abstract]
  22. Paxinos, G., Watson, C. (1998) The Rat Brain in Stereotaxic Coordinates 4th ed Academic Press Sydney.
  23. Wiedmann, M., Wilson, W. J., Czajka, J., Luo, J., Batt, C. A. (1994) Ligase chain reaction (LCR)—overview and applications. PCR Methods Appl. 3,S51-S64[Medline]
  24. Fergusson, J., Landon, M., Lowe, J., Ward, L., Van Leeuwen, F. W., Mayer, R. J. (2000) Neurofibrillary tangles in progressive supranuclear palsy brains exhibit immunoreactivity to frameshift mutant ubiquitin-B protein. Neurosci. Lett. 279,69-72[CrossRef][Medline]
  25. Braak, H., Del Tredici, K., Bohl, J., Bratzke, H., Braak, E. (2000) Pathological changes in parahippocampal region in select non-Alzheimer’s dementias. Ann. N. Y. Acad. Sci. 911,221-239[Abstract/Free Full Text]
  26. Hutton, M., Lendon, C. L., Rizzu, P., Baker, M., Froehlich, S., Houlden, H., Pickering-Brown, S., Chakraverty, S., Isaacs, A. (1998) Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature (London) 393,702-705[CrossRef][Medline]
  27. Ingram, E. M., Spillantini, M. G. (2002) Tau gene mutations: dissecting the pathogenesis of FTDP-17. Trends Mol. Med. 8,555-562[CrossRef][Medline]
  28. Poorkaj, P., Grossman, M., Steinbart, E., Payami, H., Sadnovnick, A., Nochlin, D., Tabira, T., Trojanowski, J. Q., Borson, S., Galasko, D., et al (2001) Frequency of tau gene mutations in familial and sporadic cases of non-Alzheimer dementia. Arch. Neurol. 58,383-387[Abstract/Free Full Text]
  29. Huitinga, I., De Groot, C. J. A., Van der Valk, P., Kamphorst, W., Tilders, F. J. H., Swaab, D. F. (2001) Hypothalamic lesions in multiple sclerosis. J. Neuropathol. Exp. Neurol. 60,1208-1218[Medline]
  30. Evans, D. A. P., Van der Kleij, A. A. M., Sonnemans, M. A. F., Burbach, J. P. H., Van Leeuwen, F. W. (1994) Frameshift mutations at two hotspots in vasopressin transcripts in post-mitotic neurons. Proc. Natl. Acad. Sci. USA 91,6059-6063[Abstract/Free Full Text]
  31. McPhaul, L. W., Wang, J., Hol, E. M., Sonnemans, M. A. F., Riley, N., Nguyen, V., Yuan, Q. X., Lue, Y. H., Van Leeuwen, F. W., French, S. W. (2002) Molecular misreading of the ubiquitin B gene and hepatic Mallory body formation. Gastroenterology 122,1878-1885[CrossRef][Medline]
  32. Schwartz, A. L., Ciechanover, A. (1999) The ubiquitin-proteasome pathway and pathogenesis of human diseases. Annu. Rev. Med. 50,57-74[CrossRef][Medline]
  33. Bence, N. F., Sampat, R. M., Kopito, R. R. (2001) Impairment of the ubiquitin-proteasome system by protein aggregation. Science 292,1552-1555[Abstract/Free Full Text]
  34. Hasegawa, M., Fujiwara, H., Nonaka, T., Wakabayashi, K., Takahashi, H., Lee, V. M., Trojanowski, J. Q., Mann, D., Iwatsubo, T. (2002) Phosphorylated alpha-synuclein is ubiquitinated in alpha-synucleinopathy lesions. J. Biol. Chem. 277,49071-49076[Abstract/Free Full Text]
  35. Bonifati, V., Rizzu, P., Van Baren, M. J., Schaap, O., Breedveld, G. J., Krieger, E., Dekker, M. C., Squitieri, F., Ibanez, P., Joosse, M., et al (2003) Mutations in the DJ-1 gene associated with autosomal recessive early-onset Parkinsonism. Science 299,256-259[Abstract/Free Full Text]
  36. Shringarpure, R., Grune, T., Mehlhase, J., Davies, K. J. (2002) Ubiquitin-conjugation is not required for the degradation of oxidized proteins by the proteasome. J. Biol. Chem. 278,311-318
  37. Tofaris, G. K., Layfield, R., Spillantini, M. G. (2001) {alpha}-Synuclein metabolism and aggregation is linked to ubiquitin-independent degradation by the proteasome. FEBS Lett. 509,22-26[CrossRef][Medline]
  38. Spillantini, M. G., Crowther, R. A., Jakes, R., Ciarns, N. J., Lantos, P. L., Goedert, M. (1998) Filamentous {alpha}-synuclein inclusions link multiple system atrophy with Parkinson’s disease and dementia with Lewy bodies. Neurosci. Lett. 251,205-208[Medline]
  39. McNaught, K., St., P., Belizaire, R., Jenner, P., Olanow, C. W., Isaacson, O. (2002) Selective loss of 20S proteasome {alpha}-subunits in the substantia nigra pars compacta in Parkinson’s disease. Neurosci. Lett. 326,155-158[CrossRef][Medline]
  40. Furukawa, Y., Vigouroux, S., Wong, H., Guttman, M., Rajput, A. H., Ang, L., Briand, M., Kish, S. J., Briand, Y. (2002) Brain proteasomal function in sporadic Parkinson’s disease and related disorders. Ann. Neurol. 51,779-782[CrossRef][Medline]
  41. Keller, J. N., Hanni, K. B., Markesbery, W. R. (2000) Impaired proteasome function in Alzheimer’s disease. J. Neurochem. 75,436-439[CrossRef][Medline]
  42. Leroy, E., Boyer, R., Auburger, G., Leube, B., Ulm, G., Mezey, E., Harta, G., Brownstein, M. J., Jonnalagada, S., Chernova, T., et al (1998) The ubiquitin pathway in Parkinson’s disease. Nature (London) 395,451-452[CrossRef][Medline]
  43. Saigoh, K., Wang, Y.-L., Suh, J.-G., Yamanishi, T., Sakai, Y., Kiyosawa, H., Harada, T., Ichihara, N., Wakana, S., Kikuchi, T., et al (1999) Intragenic deletion in the gene encoding ubiquitin carboxy-terminal hydrolase in gad mice. Nat. Genet. 25,47-51
  44. Cummings, C. J., Reinstein, E., Sun, Y., Antalffy, B., Jiang, Y., Ciechanover, A., Orr, H., Beaudet, A. L., Zoghbi, H. Y. (1999) Mutation of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency while accelerating polyglutamine-induced pathology in SCA1 mice. Neuron 24,879-892[CrossRef][Medline]
  45. Shimura, H., Schlossmacher, M. G., Hattori, N., Frosch, M. P., Trockenbacher, A., Schneider, R., Mizuno, Y., Kosik, K. S., Selkoe, D. J. (2001) Ubiquitination of a new form of {alpha}-synuclein by parkin from human brain: implications for Parkinson’s disease. Science 293,263-269[Abstract/Free Full Text]
  46. Liu, Y., Fallon, L., Lashuel, H. A., Liu, Z., Lansbury, P. T., Jr (2002) The UCH-L1 gene encodes two opposing enzymatic activities that affect alpha-synuclein degradation and Parkinson's disease susceptibility. Cell 111,209-218[CrossRef][Medline]
  47. Keck, S., Nitsch, R., Grune, T., Ullrich, O. (2003) Proteasome inhibition by paired helical filament-tau in brains of patients with Alzheimer's disease. J. Neurochem. 85,115-122[Medline]



This article has been cited by other articles:


Home page
BrainHome page
I. Ferrer, G. Santpere, and F. W. van Leeuwen
Argyrophilic grain disease
Brain, June 1, 2008; 131(6): 1416 - 1432.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. van Tijn, F. M. S. de Vrij, K. G. Schuurman, N. P. Dantuma, D. F. Fischer, F. W. van Leeuwen, and E. M. Hol
Dose-dependent inhibition of proteasome activity by a mutant ubiquitin associated with neurodegenerative disease
J. Cell Sci., May 1, 2007; 120(9): 1615 - 1623.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
N. M. Wills and J. F. Atkins
The potential role of ribosomal frameshifting in generating aberrant proteins implicated in neurodegenerative diseases
RNA, July 1, 2006; 12(7): 1149 - 1153.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
V. Askanas and W. K. Engel
Inclusion-body myositis: A myodegenerative conformational disorder associated with A{beta}, protein misfolding, and proteasome inhibition
Neurology, January 24, 2006; 66(1_suppl_1): S39 - S48.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
F. W. van Leeuwen, P. van Tijn, M.A.F. Sonnemans, B. Hobo, D. M.A. Mann, C. Van Broeckhoven, S. Kumar-Singh, P. Cras, G. Leuba, A. Savioz, et al.
Frameshift proteins in autosomal dominant forms of Alzheimer disease and other tauopathies
Neurology, January 24, 2006; 66(1_suppl_1): S86 - S92.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
P. Fratta, W. K. Engel, F. W. Van Leeuwen, E. M. Hol, G. Vattemi, and V. Askanas
Mutant ubiquitin UBB+1 is accumulated in sporadic inclusion-body myositis muscle fibers
Neurology, September 28, 2004; 63(6): 1114 - 1117.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. de Pril, D. F. Fischer, M. L.C. Maat-Schieman, B. Hobo, R. A.I. de Vos, E. R. Brunt, E. M. Hol, R. A.C. Roos, and F. W. van Leeuwen
Accumulation of aberrant ubiquitin induces aggregate formation and cell death in polyglutamine diseases
Hum. Mol. Genet., August 15, 2004; 13(16): 1803 - 1813.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by FISCHER, D. F.
Right arrow Articles by VAN LEEUWEN, F. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by FISCHER, D. F.
Right arrow Articles by VAN LEEUWEN, F. W.


HOME HELP FEEDBACK