FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by PAI, R.
Right arrow Articles by TARNAWSKI, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by PAI, R.
Right arrow Articles by TARNAWSKI, A. S.
(The FASEB Journal. 2003;17:1640-1647.)
© 2003 FASEB

Prostaglandins promote colon cancer cell invasion; signaling by cross-talk between two distinct growth factor receptors

RAMA PAI1, TOSHIKAZU NAKAMURA*, WOO S. MOON and ANDRZEJ S. TARNAWSKI

Medical Service, Department of Veterans Affairs Medical Center, Long Beach, California, USA; Department of Medicine, University of California, Irvine, California, USA; and
* Osaka University Graduate School of Medicine, Osaka, Japan

1Correspondence: Gastroenterology Section (111G), DVA Medical Center, Long Beach (CA), 5901 East Seventh St., Long Beach, CA 90822, USA. E-mail: rpai{at}uci.edu.com


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Colorectal cancer is the second most frequent cancer in the Western world, often lethal when invasion and/or metastasis occur. In addition to hepatocyte growth factor (HGF), colon cancer invasion may be driven by prostaglandins, especially the E2 series (PGE2), generated by the cyclooxygenase-2 (Cox-2) enzyme. While concentration of PGE2 as well as expression of Cox-2, HGF receptor (c-Met-R), epidermal growth factor receptor (EGFR), and ß-catenin are all dramatically increased in colon cancers and implicated in their growth and invasion, the precise role of PGE2 in the latter process remains unclear. Here we provide evidence that PGE2 transactivates c-Met-R (contingent upon functional EGFR), increases tyrosine phosphorylation and nuclear accumulation of ß-catenin, and induces urokinase-type plasminogen activator receptor (uPAR) mRNA expression. This is accompanied by increased ß-catenin association with c-Met-R and enhanced colon cancer cell invasiveness. Inactivation of EGFR and c-Met-R significantly reduced PGE2-induced cancer cell invasiveness. Clinical relevance of these findings is confirmed by our immunohistochemical studies demonstrating that cancer cells in the invasive front overexpress Cox-2, c-Met-R, and ß-catenin. Our findings explain a functional relationship between prostaglandins, EGFR, and c-Met-R in colon cancer growth and invasion.—Pai, R., Nakamura, T., Moon, W. S., Tarnawski, A. S. Prostaglandins promote colon cancer cell invasion; signaling by cross-talk between two distinct growth factor receptors.


Key Words: EGFR • Met-R • ß-catenin • uPAR • PGE2


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
PROSTAGLANDINS exert diverse physiological actions in gastrointestinal tract including maintenance of mucosal integrity, regulation of secretion and motility (1) . They are also implicated in pathological processes such as neoplasia (2 , 3) . Clinical and experimental data indicate that prostaglandin E2 (PGE2) could enhance invasiveness of colon cancer cells and tumorigenic potential of intestinal epithelial cells (4 5 6 7) . While concentration of PGE2 as well as expression of prostaglandin synthesizing enzyme, cyclooxygenase-2 (Cox-2), hepatocyte growth factor receptor (c-Met-R), epidermal growth factor receptor (EGFR), and ß-catenin are all dramatically increased in colon cancers and implicated in their growth and invasion, the precise role of PGE2 in the latter process remains unclear (1 , 8 9 10 11 12) .

An early event in cancer progression is the loss of cell–cell adhesion within the primary tumor, development of an invasive phenotype and subsequent migration and tumor cell invasion into the matrix and adjacent tissues. Cell adhesion and polarity, which determine epithelial phenotype, are mediated by cell surface expression of E-cadherin. E-Cadherin, a 120 kDa protein, is expressed in the adherens junctions of epithelial cells and interacts with the cytoskeleton via associated cytoplasmic proteins, the catenins (13) . While ß-catenin associated with E-cadherin and {alpha}-catenin at the plasma membrane regulates cell adhesion, cytoplasmic ß-catenin is involved in signal transduction and activation of genes (c-myc, gastrin, Cox-2, MMP-7, cyclin D1, uPAR, CD44, and P-glycoprotein), which play important roles in the development and progression of colorectal carcinoma (14) . It has been suggested that ß-catenin activity is crucial for cancer invasion and metastases through its role in cell adhesion and that different mechanisms, including mutations in the adenomatous polyposis coli gene, inside or outside the regulatory domain ß-catenin can alter its signaling properties (14) . Tyrosine phosphorylation of ß-catenin is suggested to promote metastatic potential and tumor invasiveness by stabilizing ß-catenin and binding of TCF/Lef1 DNA transcription factors, which in turn stimulate cell proliferation in normal and cancer cells (14) . Overexpression of ß-catenin and down-regulation of E-cadherin in highly invasive and poorly differentiated cancers (12) , implicate E-cadherin and ß-catenin in the development and progression of cancer invasiveness. HGF promotes tyrosine phosphorylation of ß-catenin and impairs association of ß-catenin with E-cadherin in human colorectal cancer cells (15) . These changes are accompanied by the loss of intercellular adhesions and acquisition of invasive phenotype reflected by increased cell motility and invasiveness (15) . Whether PGE2 affects tyrosine phosphorylation of ß-catenin and association with c-Met-R in colon cancer cells remains unknown.

The urokinase-type plasminogen activator (uPA) is a serine protease that induces conversion of the inactive zymogen plasminogen into plasmin. Plasmin is a proteolytic enzyme capable of degrading both extracellular matrix and components of basement membrane and activating latent matrix metalloproteinases. Binding of pro-uPA to its specific receptor (uPAR) increases the conversion of plasminogen to plasmin (16) . uPA and uPAR are implicated to stimulate cell migration and invasiveness in a paracrine and/or autocrine manner (9 , 17) . They play an important role in cancer invasiveness (9 , 17) . Colon cancers display overexpression of uPAR at the invasive front (18) , and this overexpression correlates with a reduced 5 year survival in colon cancer patients (19) . ß-Catenin induces uPAR expression, but the mechanism of this action is unclear although a possible involvement of oncoproteins whose promoters bear TCF binding sites (c-jun and fra-1) has been suggested (14) .

Because activation of c-Met-R has been shown to stimulate invasive growth in almost every tissue and prostaglandin concentration in colon cancers is significantly increased, we hypothesized that PGE2 increases colon cancer cell invasiveness by transactivating c-Met-R and increases tyrosine phosphorylation of ß-catenin. Stabilized ß-catenin would subsequently translocate into the nucleus and trigger uPAR expression (target gene of ß-catenin) and increase colon cancer invasiveness. Our results demonstrate that PGE2 significantly increases colon cancer cell invasiveness and that this action involves activation of the EGFR-c-Met-R-ß-catenin-uPAR signaling pathway. We also demonstrate the clinical relevance of these findings by performing immunohistochemical studies of human colon cancer specimens. These showed that cancer cells forming the invasive front overexpress c-Met-R, ß-catenin and Cox-2.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell culture
The human colon cancer cell lines Caco-2, LoVo, and SW 480 (ATCC, Rockville, MD, USA) were grown according to the supplier’s instructions. The cells lines were selected for the present study based on degree of differentiation and invasiveness. The cell lines represent: 1) well-differentiated, poorly invasive (Caco-2), 2) moderately differentiated, moderately invasive (SW 480), and 3) poorly differentiated, highly invasive (LoVo) cells. The SW 480 cell line was established from a patient with primary adenocarcinoma who eventually developed lymph node metastasis; therefore, these cells are regarded as cells in progression to metastasis. The phenotype of these cells appears to be stable since they showed no significant change with passage of time. Serum-starved cells were incubated with EGFR kinase-specific inhibitor tyrphostin AG 1478 (250 nM, 20 min; Calbiochem, San Diego, CA, USA), c-Met-R inhibitor NK-4 (1 µg/mL, 16 h) before addition of PGE2 (10 µM; 5, 30, or 60 min; Sigma, St. Louis, MO, USA). AG1478 is a potent and selective inhibitor of EGFR kinase that binds to the substrate binding site and inactivates tyrosine kinase (20). NK-4 is an antagonist for HGF composed of the NH2-terminal hairpin domain and four kringle domains in the {alpha} chain of HGF. NK-4 binds to the c-Met-R and selectively inhibits c-Met-R phosphorylation (21).

Preparation of cytoplasmic and nuclear proteins
Colon cancer cells were lysed in buffer containing 0.5% NP-40, 20 mM Tris-HCl pH 7.4, 10 mM NaCl, and 2 mM MgCl2 for 2 min at 4°C. After centrifugation at 500 g for 5 min, supernatants were collected as cytoplasmic protein; 0.1% SDS, 25 µg/mL aprotinin, and 25 µg/mL leupeptin were added into the lysates. The nuclear pellets were washed in lysis buffer lacking NP-40, then repelleted. Nuclear pellets were resuspended by vortexing in 1 pellet volume of nuclear extraction buffer (20 mM Tris, pH 8.0, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 1 mM PMSF, and 2.3 µg/mL aprotinin, leupeptin, and pepstatin). All cytoplasmic and nuclear extracts were centrifuged and transferred to fresh tubes. Glycerol was added to cytoplasmic extracts to a final concentration of 20%. Protein concentrations were determined by using a BCA protein assay kit (Pierce, Rockford, IL, USA). Equal amounts of denatured nuclear and cytoplasmic protein (30 µg) were resolved on 7.5% SDS PAGE at 60 V and immunoblotted following the procedure detailed below.

Immunoprecipitation
Cells were lysed in ice-cold lysis buffer (20 mmol/L Tris-HCl pH 7.5, 50 mmol/L NaCl, 50 mmol/L sodium fluoride, 30 mmol/L sodium pyrophosphate, 5 mol/L EGTA, 10% glycerol, 1% Triton X-100, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L sodium orthovanadate, and 5 µg/mL aprotinin) and clarified by centrifugation at 14,000 rpm for 10 min. The protein concentration of the lysate was determined using a bicinchoninic acid protein assay kit (Pierce). Equal amounts of proteins (500 µg) were incubated with specific primary antibody immobilized onto protein A Sepharose for 2 h at 4°C under gentle rotation. Beads were washed extensively with lysis buffer; immunocomplexes were eluted by heating for 5 min at 95°C in Laemmli buffer and microcentrifuged. The supernatant was subjected to 7.5% SDS-PAGE at 60 V, then immunoblotted with specific antibodies following the procedure detailed below.

Western blot analysis
Western blot analysis was performed following the method described previously (22) . Supernatants from immunoprecipitates, nuclear and cytoplasmic proteins (30 µg) were subjected to 7.5% SDS-PAGE at 60 volts and transferred onto a nitrocellulose membrane. Blots were stained with Ponceau red to ensure equal loading and complete transfer of proteins. The membrane containing the transferred proteins was incubated with blocking buffer, subsequently washed, and incubated with specific primary antibodies for 1 h at room temperature. Blots were washed in Tris-buffered saline containing 0.1% Tween 20 (TBST, pH 7.4) and incubated with specific peroxidase-conjugated secondary antibodies for 1 h at room temperature. The antibodies used for immunoprecipitation and immunoblotting were anti-c-Met-R and ß-catenin mAbs from BD Transduction (San Diego, CA, USA), and anti-phosphotyrosine (PY99) and anti-E-cadherin mAb from Santa Cruz Biotech (Santa Cruz, CA, USA). After extensive washing in TBST, immunoreactive proteins were visualized by the ECL detection system (Amersham, Arlington Heights, IL, USA). Where indicated, membranes were stripped (Reblot-Plus; Chemicon, Temecula, CA, USA) and reprobed with another antibody. The densities of specific protein bands were analyzed using ImageQuant analysis system (Storm, optical scanner, Molecular Dynamics, Sunnyvale, CA, USA). Quantitative analyses of EGFR, c-Met-R, and ß-catenin phosphorylation levels were performed by determining the ratio between total protein and the phosphorylation using data from three separate experiments performed in triplicate. All the immunoprecipitation and Western blot analysis studies were performed in triplicate and repeated on three different occasions.

Determination of uPAR mRNA expression
Total RNA was isolated using the RNAqueous commercial kit (Ambion Inc., Austin, TX, USA) following the manufacturer’s protocol. Reverse transcription and polymerase chain reaction (RT/PCR) were performed using a GeneAmp RNA PCR kit and a DNA thermal cycler (Applied Biosystems, Foster City, CA, USA). The 253 bp fragment of the uPAR cDNA was PCR amplified using a 25-mer upstream primer (5' CATGCAGTGTAAGACCCAACGGGGA 3') identical to position 121-145 and 24-mer down stream primer (5' AATAGGTGACAGCCCGGCCAGAGT 3'). The PCR amplification was performed for 28 cycles of 1 min at 94°C for denaturing, 1 min at 60°C for annealing, and 2 min at 72°C for extension. Human specific ß-actin primers (Clontech, Palo Alto, CA, USA) served as positive controls. Ten microliter aliquots of the products were subjected to electrophoresis on a 1.25% agarose gel and DNA was visualized by ethidium bromide staining. Location of the products and their sizes were determined by using a 100 bp ladder (GIBCO, Gaithersburg, MD, USA). The gel was photographed under ultraviolet illumination.

Cell invasion assay
Studies were carried out in Transwell chambers as described (6) . Colon cancer cells (Caco-2, LoVo, SW 480) were serum starved for 24 h. Transwell chambers equipped with 8 µm Matrigel-coated filters (24-well format) (Becton Dickinson, Franklin Lakes, NJ, USA) were rehydrated, and 4 x 104 cells in 400 µL of serum-free medium in the presence or absence of AG 1478 (250 nM), NK-4 (1 µg/mL) were seeded in the upper chamber. Serum-free medium-containing vehicle or PGE2 was used in the lower chamber. After 24 h incubation at 37°C, cells on the upper surface of the filter were mechanically removed with a cotton swab. The filters were fixed and stained using a Diff-Quick staining kit (Dade Behring, Newark, DE, USA). Cells on the lower surface were counted under a microscope (magnification 100x). Five fields were counted per each filter and four wells were used for each treatment.

Colony formation assay
Colony formation or cell growth in Matrigel was determined following the protocol described previously (6) . Colon cancer (Caco-2, LoVo, SW 480) cells (1x104) were suspended in 0.5 mL of 1:1 diluted Matrigel (Collaborative Biomed, Bedford, MA, USA). The cell/Matrigel mixture was plated into 24-well polystyrene plates and incubated at 37°C. The vehicle, AG 1478 (250 nM), NK-4 (1 µg/mL) with or without PGE2 (10 µM), EGF (10 ng/mL), or HGF (10 ng/mL) was then added in fresh medium every 2 days. After incubating for 10 days, images were captured using a camera attached to an inverted Nikon (TE300) microscope.

Immunohistochemistry
This study was approved by the subcommittee for human studies of the Long Beach Department of Veterans Affairs Medical Center (Long Beach, CA, USA). Paraffin-embedded tissue sections of human colon cancers were double stained using the EnvisionTM Doublestain system (DAKO, Carpinteria, CA, USA). Staining was performed using anti-Cox-2, anti-c-Met-R (both 1:100 dilution; Santa Cruz Biotech) and anti-ß-catenin antibodies (1:100; BD Transduction) according to the manufacturer’s instructions (DAKO, CA, USA). 3,3'-Diaminobenzidine tetrachloride and 5-bromo-4-chloro-3-indoxylphosphate/nitro blue tetrazolium chloride (BCIP/NBT) was used as substrate for c-Met-R, Cox-2 (brown) and ß-catenin (black), respectively. The sections were counterstained with Mayer’s hematoxylin. Images were captured using a Nikon digital camera (DXL 1200) attached to a Nikon Optiphot microscope. Specificity of staining was confirmed by omitting the primary antibody.

Statistical analysis
Student’s t test was used to compare data between two groups. One-way ANOVA and Bonferroni correction were used to compare data between three or more groups. Values are expressed as mean ± standard error of the mean (SE). P values less than 0.05 were considered statistically significant.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Dose and time-response studies of PGE2 on colon cancer (Caco-2) cells
Treatment of Caco-2 cells with PGE2 (0.1–100 µM) significantly increased EGFR phosphorylation in a dose-dependent manner, with a maximal response at 10 µM (P<0.025) and plateaued beyond (Fig. 1 A). Treatment of Caco-2 cells with PGE2 (10 µM) at various intervals (5–60 min) demonstrated that PGE2-mediated EGFR phosphorylation peaks at 5 min (Fig. 1B ) and decreases thereafter.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Dose and time-response studies of prostaglandin E2 (PGE2) on colon cancer (Caco-2) cells. Serum-starved Caco-2 cells were treated with either vehicle or PGE2 in various concentrations (0.1–100 µM) (A) for varying intervals (5–60 min) (B). Top: EGFR phosphorylation was determined by immunoprecipitation (EGFR mAb) and immunoblotting with anti-phosphotyrosine antibody. Middle: Total EGFR in immunoprecipitates was determined by reprobing the same blot with anti-EGFR antibody. Representative blot from 3 separate experiments performed in triplicate. Bottom: Quantitative analysis of EGFR phosphorylation by determining the ratio between EGFR protein and phosphorylation levels from 3 separate experiments performed in triplicate (mean values ± SE). *P < 0.025, **< 0.05 vs. control

PGE2 transactivates c-Met-R in a manner dependent on functional EGFR in colon cancer cells
Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 5 min) significantly increased c-Met-R phosphorylation (P<0.03 and P<0.001) (Fig. 2 A, B). To determine whether EGFR activation is required for PGE2-induced c-Met-R phosphorylation in colon cancer cells, we inactivated EGFR with the specific inhibitor tyrphostin AG 1478. Inactivation of EGFR with AG 1478 (250 nM, 30 min) almost completely inhibited PGE2-induced c-Met-R phosphorylation, indicating that functional EGFR is required for PGE2-induced c-Met-R activation (Fig. 2A, B ).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. PGE2 transactivates c-Met-R in colon cancer cells. Serum-starved LoVo (A) and Caco-2 (B) cells were treated with vehicle or AG 1478 (EGFR inhibitor), followed by incubation with or without PGE2, EGF, or HGF. Top: c-Met-R phosphorylation was determined by immunoprecipitation (c-Met-R mAb) and immunoblotting with anti-phosphotyrosine antibody. Middle: Total c-Met-R in immunoprecipitates was determined by reprobing the same blot with anti-c-Met-R antibody. Bottom: Quantitative analysis of c-Met-R phosphorylation by determining the ratio between c-Met-R protein and phosphorylation levels from 3 separate experiments performed in triplicate (mean values ± SE). *P < 0.05 vs. control; **P < 0.01 vs. PGE2.

PGE2 alters ß-catenin activity and increases its nuclear accumulation in colon cancer cells
Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 5 min) significantly increased c-Met-R association with ß-catenin in LoVo and Caco-2 cells and reciprocally reduced E-cadherin association with ß-catenin (Fig. 3 A) compared with vehicle-treated control cells. Increased association of c-Met-R with ß-catenin was accompanied by a marked increase in tyrosine phosphorylation of ß-catenin (Fig. 3A ). Similar results showing increased c-Met-R association with ß-catenin and tyrosine phosphorylation of ß-catenin in response to PGE2 were obtained with another invasive colon cancer line, SW 480 (data not shown). One hour after PGE2 treatment, a marked increase in nuclear accumulation of ß-catenin occurred and pretreatment with EGFR inhibitor (AG 1478, 250 nM, 30 min) suppressed this effect (Fig. 3B ). To determine whether PGE2-mediated increase in nuclear ß-catenin levels was due to a decrease in GSK-3ß phosphorylation (negative regulator of ß-catenin), we treated LoVo and Caco-2 cells with PGE2 and assessed GSK-3ß phosphorylation levels. Treatment of colon cancer cells with PGE2 (10 µM, 5 min) did not cause any significant change in GSK-3ß phosphorylation levels (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. PGE2 enhances ß-catenin activity in colon cancer cells. A) Colon cancer cells (Caco-2, LoVo) were treated with vehicle or PGE2. ß-Catenin was immunoprecipitated and tyrosine phosphorylated ß-catenin was detected by immunoblotting with anti-phosphotyrosine Ab. The same blot was stripped and reprobed for E-cadherin association by immunoblotting with anti-E-cadherin Ab and with anti-ß-catenin Ab to assess total ß-catenin levels. Representative blot from 3 separate experiments performed in triplicate. B) PGE2 increases nuclear accumulation of ß-catenin in colon cancer cells. Colon cancer cells (Caco-2, LoVo) were treated with vehicle or AG 1478, followed by incubation with or without PGE2. Nuclear and cytoplasmic extracts after various treatments were subjected to immunoblotting using anti-ß-catenin Ab. Representative blot from 3 separate experiments performed in triplicate.

PGE2 induces uPAR mRNA expression in colon cancer cells
Since uPAR is overexpressed in colon cancers and is a target gene for ß-catenin, we investigated the effect of PGE2 on uPAR mRNA expression (14 , 17 , 18) . RT-PCR analysis demonstrated that PGE2 treatment markedly increases uPAR mRNA expression in an invasive type of cell (LoVo) and only slightly increases it in poorly invasive Caco-2 cells (Fig. 4 A). Pretreatment of LoVo and Caco-2 cells with EGFR inhibitor AG 1478 (250 nM, 30 min) suppressed PGE2-mediated uPAR expression less than c-Met-R inhibitor (NK-4, 1 µg/mL, 16 h) (Fig. 4A ).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. PGE2 increases urokinase-type plasminogen activator receptor mRNA expression and colon cancer cell invasiveness. A) Serum-starved colon cancer cells (LoVo, Caco-2) were treated with either vehicle, AG 1478 (EGFR inhibitor), or NK-4 (c-Met-R inhibitor), followed by incubation with or without PGE2. Total RNA was isolated and subjected to RT-PCR using specific primers for uPAR and ß-actin. DNA was visualized by ethidium bromide staining. B) Serum-starved LoVo and SW 480 cells were treated as above. 4 x 104 cells were seeded in the upper chamber in the presence or absence of AG 1478 or NK-4. Medium containing either vehicle or PGE2 was added to the lower chamber. After 24 h, cells on the upper surface of the filter were removed. Filters were fixed and stained. The cells on the lower surface were counted under a microscope (magnification 100x). Five fields were counted per each filter and 4 wells were used for each treatment. The experiment was repeated 3 times. *P < 0.01 vs. control; **P < 0.0001 vs. PGE2.

PGE2 increases colon cancer cell invasiveness
To determine whether PGE2-mediated transactivation of c-Met-R results in increased invasiveness of colon cancer cells, we performed in vitro cell invasion and colony formation assays. PGE2 treatment (10 µM, 24 h) significantly increased LoVo and SW 480 cell invasiveness but not Caco-2 cells, as reflected by a significant increase in the number of cells that migrated through the Matrigel and the porous polycarbonate filters (Fig. 4B ). This difference in responses could be attributed to the phenotypic characteristics of cells, since Caco-2 originated from a primary adenocarcinoma whereas LoVo was derived from lymph node metastasis. SW480 are regarded as cells in progression to metastasize because the patient eventually developed metastasis. EGFR inhibitor (AG 1478, 250 nM) and c-Met-R inhibitor (NK-4, 1 µg/mL) both significantly suppressed PGE2-induced colon cancer cell invasiveness (Fig. 4B ). c-Met-R inhibitor (NK-4) caused a greater reduction in PGE2-induced colon cancer invasiveness than EGFR inhibitor (AG 1478).

Next, we evaluated the ability of colon cancer cells to spread and grow in Matrigel by performing colony formation assay. Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 10 days) caused widespread growth, with a significant lateral invasion into the matrix resulting in formation of larger, asymmetrical colonies (Fig. 5 ). PGE2 treatment of colon cancer cells pretreated with c-Met-R inhibitor NK-4 (1 µg/mL) resulted in smaller and less spread, rounded colonies. Pretreatment with EGFR inhibitor AG 1478 (250 nM) had a weaker effect on PGE2-induced colon cancer cell invasion (Fig. 5) and colony formation than c-Met-R inhibition (Fig. 5) . The colon cancer cell colonies formed in the presence of PGE2 closely resembled those formed in the presence of HGF (Fig. 5) . Similar results were obtained with SW 480 cells subjected to colony formation in Matrigel under identical conditions. The SW 480 cells in Matrigel formed large asymmetrical colonies in response to PGE2 and pretreatment with EGFR and c-Met-R inhibitors significantly suppressed this growth (data not shown).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 5. PGE2 enhances colon cancer cells colony formation in Matrigel. Serum-starved LoVo and Caco-2 cells (1x104) were suspended in 0.5 mL of 1:1 diluted Matrigel. The cell/Matrigel mixture was plated into 24-well plates and incubated at 37°C. The vehicle, AG 1478, or NK-4 with or without PGE2, EGF, or HGF was then added in fresh serum-free medium every 2 days. Four wells were used for each treatment. After 10 days, images were captured using a camera attached to an inverted microscope. Representative image showing 1 of 5 fields captured from each well. Scale bar, 50 µM.

Cancer cells forming the invasive front overexpress c-Met-R, ß-catenin, and Cox-2 in human colon cancers
To determine the clinical relevance of the above findings, we examined the expression of c-Met-R, ß-catenin, and Cox-2 in surgical specimens of human colon cancers (Fig. 6 A, B). Immunostaining of human colon cancer tissue sections displayed overexpression of c-Met-R, ß-catenin (Fig. 6A ) and Cox-2 (Fig. 6B ) in cancer cells forming the invasive front. While increased c-Met-R staining was localized to the membrane and cytoplasm of cancer cells both in invasive and noninvasive areas with enhanced expression at the invasive front, ß-catenin was localized to the membrane in the noninvasive region and distinctly to the nucleus of cells in the invasive front (Fig. 6A , right panel). The Cox-2 staining was predominantly localized to the cytoplasm of cells, forming the invasive front; some cells also exhibited membrane localization (Fig. 6B , right panel).



View larger version (147K):
[in this window]
[in a new window]
 
Figure 6. Increased expression of c-Met-R, ß-catenin, and Cox-2 is localized to cells forming the invasive front of human colon cancers. A) Representative images under a low (left panel, 100x) and a high (right panel, 400x) power magnification. Paraffin embedded tissue sections of human colon cancers were double stained with polyclonal c-Met-R Ab (brown) and ß-catenin mAb (black) using the EnvisionTM Doublestain system (DAKO). 3,3'-Diaminobenzidine tetrachloride (DAB) and 5-bromo-4-chloro-3-indoxylphosphate/nitro blue tetrazolium chloride (BCIP/NBT) were used as substrate for c-Met-R (brown) and ß-catenin (black), respectively. Cells in the invasive front (indicated by arrows) clearly exhibit increased c-Met-R (brown) and ß-catenin expression in the membrane and nuclear localization of ß-catenin (black). Dark brown indicates colocalization of c-Met-R with ß-catenin. Increased c-Met-R expression is present in all poorly differentiated cancer cells (brown). B) Representative images under a low (left panel, 100x) and a high (right panel, 400x) power magnification of a different tissue section but from the same human colon cancer specimen (used above) stained using polyclonal Cox-2 antibody. 3,3'-Diaminobenzidine tetrachloride (DAB) and 5-bromo-4-chloro-3-indoxylphosphate/nitro blue tetrazolium chloride (BCIP/NBT) were used as substrate for Cox-2 (brown). Cells forming the invasive front (indicated by arrows) clearly display increased Cox-2 expression (brown) in the cytoplasm and membrane.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Colorectal carcinoma tissue has elevated concentrations of PGE2 and increased Cox-2 mRNA and protein levels compared with normal colonic tissue (1) . Clinical and experimental studies have demonstrated the efficacy of nonsteroidal anti-inflammatory drugs (NSAIDs), which inhibit the Cox-2 enzyme and thus prostaglandin generation, in reducing the number and size of colorectal adenomas (1 , 23 , 24) . These studies provide correlative evidence for the association between Cox-2, tissue prostaglandins and colorectal cancer growth and invasion. Although in our previous study we identified one possible mechanism and demonstrated that prostaglandin E2 increases colon cancer cell proliferation and growth through transactivation of EGFR and its mitogenic signaling, the mechanism by which prostaglandins promotes colon cancer cell invasiveness remains unknown (22) .

Previous studies demonstrated that Cox-2 expression in human colon cancer cells increases metastatic potential, but the involvement of c-Met-R or EGFR in PGE2-mediated colon cancer cell invasiveness was not implicated (6 , 7 , 25) . In the present study we demonstrated that PGE2 transactivates c-Met-R and the requirement of functional EGFR for this PGE2-induced c-Met-R activation in colon cancer cells. Our data are consistent with previous studies showing that activated EGFR can phosphorylate and activate c-Met-R in thyroid carcinoma cell lines and hepatocytes possibly by heterodimeric association between c-Met-R and EGFR (26 27 28) . We further demonstrated that PGE2-activated c-Met-R associates with ß-catenin and increases its tyrosine phosphorylation. Both EGFR and c-Met-R are capable of associating with ß-catenin and phosphorylating ß-catenin; however, activation of EGFR has been shown to stimulate invasiveness only transiently whereas c-Met-R activation causes prolonged stimulation of invasiveness (9 , 29 , 30) . Our study indicates that PGE2-induced colon cancer cell invasiveness could involve both EGFR and c-Met-R.

Although a recent study using human embryonic kidney cells suggested that PGE2 increases nuclear ß-catenin levels by decreasing GSK-3ß phosphorylation (negative regulator of ß-catenin), our present study demonstrated that PGE2 does not alter GSK-3ß phosphorylation levels (data not shown), implicating that in colon cancer cells, PGE2-induced ß-catenin stabilization and subsequent translocation into the nucleus are induced mostly by its tyrosine phosphorylation (31) .

In highly invasive and poorly differentiated cancers, overexpression ß-catenin and down-regulation of E-cadherin have been reported (12) . It has also been demonstrated that in human colorectal cancer cells, HGF-mediated tyrosine phosphorylation of ß-catenin and impaired association of ß-catenin with E-cadherin are accompanied by the loss of intercellular adhesions and acquisition of invasive phenotype reflected by increased cell motility and invasiveness (15) . Our datademonstrate that ligand-independent activation of c-Met-R could cause similar changes (significant loss of E-cadherin association with ß-catenin) and increase colon cancer cell invasiveness.

Degradation of the extracellular matrix by serine proteinases is an important step in tumor progression and invasion. Besides being a target gene for ß-catenin, uPAR expression has been shown to strongly correlate with the tumor cell invasiveness and aggressiveness (17) . Our findings show that PGE2 increases uPAR expression substantially in more invasive LoVo cells than in less invasive Caco-2 cells. This effect was also apparent during invasion and colony formation assays. In response to PGE2, Caco-2 cells (unlike LoVo and SW 480) did not show any significant change in the number of migrating cells across Matrigel-coated porous filter (24 h). However, they formed significantly large colonies in Matrigel after prolonged incubation (10 days), suggesting their colony-forming ability could be due to prolonged activation of c-Met-R and/or EGFR. Inactivation of c-Met-R suppressed PGE2-mediated colony formation to a greater extent than EGFR inactivation, suggesting that PGE2 potentiates colon cancer cell invasiveness via c-Met-R. The degree of cell differentiation and invasiveness could alter their response to prostaglandins. Utilization of three different cell lines with different characteristics in this study further demonstrated that in addition to stimulating cancer cell invasiveness in highly metastatic (LoVo) cells, PGE2 could also initiate invasiveness in nonmetastatic (Caco-2) cells and in cells progressing to metastasize (SW 480).

We also demonstrated in human colon cancer sections that cancer cells forming the invasive front coexpress c-Met-R and ß-catenin. ß-Catenin was localized to the membrane in the noninvasive region and distinctly to the nucleus of cells in the invasive front supporting ß-catenin involvement in cancer invasiveness. This agrees with a study by Hao and co-workers demonstrating a reciprocal relationship between reduced membranous and increased nuclear ß-catenin expression during transition of colorectal adenoma to carcinoma (32) . The same cancer tissue, but a different section, also displayed overexpression of Cox-2, implicating increased PG generation at the invasive front.

In summary, our present study provides evidence that PGE2 promotes colon cancer cell invasiveness and that this action involves activation of EGFR, c-Met-R, and ß-catenin and increased uPAR expression. These findings also explain a possible spatial and functional relationship between Cox-2 and generated prostaglandins, EGFR, and c-Met-R in colon cancer growth and invasion.


   ACKNOWLEDGMENTS
 
The authors thank Meredith Pavelka and Teresa Tran for technical assistance. This work was supported by the Department of Veterans Affairs Medical Research Service. Merit Review Award and Minority Initiative to A.S.T.

Received for publication January 7, 2003. Accepted for publication May 22, 2003.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Levy, G. N. (1997) Prostaglandin H synthases, nonsteroidal anti-inflammatory drugs, and colon cancer. FASEB J. 11,234-247[Abstract]
  2. Prescott, S. M., White, R. L. (1996) Self-promotion? Intimate connections between APC and prostaglandin H synthase-2. Cell 87,783-786[CrossRef][Medline]
  3. Kutchera, W., Jones, D. A., Matsunami, N., Groden, J., McIntyre, T. M., Zimmerman, G. A., White, R. L., Prescott, S. M. (1996) Prostaglandin H synthase 2 is expressed abnormally in human colon cancer: evidence for a transcriptional effect. Proc. Natl. Acad. Sci. USA 93,4816-4820[Abstract/Free Full Text]
  4. Adam, L., Mazumdar, A., Sharma, T., Jones, T. R., Kumar, R. (2001) A three-dimensional and temporo-spatial model to study invasiveness of cancer cells by heregulin and prostaglandin E2. Cancer Res. 61,81-87[Abstract/Free Full Text]
  5. Chen, W. S., Wei, S. J., Liu, J. M., Hsiao, M., Kou-Lin, J., Yang, W. K. (2001) Tumor invasiveness and liver metastasis of colon cancer cells correlated with cyclooxygenase-2 (COX-2) expression and inhibited by a COX-2-selective inhibitor, etodolac. Int. J. Cancer 91,894-899[CrossRef][Medline]
  6. Sheng, H., Shao, J., Washington, M. K., DuBois, R. N. (2001) Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J. Biol. Chem. 276,18075-18081[Abstract/Free Full Text]
  7. Tsujii, M., Kawano, S., DuBois, R. N. (1997) Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc. Natl. Acad. Sci. USA 94,3336-3340[Abstract/Free Full Text]
  8. Di Renzo, M. F., Olivero, M., Giacomini, A., Porte, H., Chastre, E., Mirossay, L., Nordlinger, B., Bretti, S., Bottardi, S., Giordano, S., et al (1995) Overexpression and amplification of the Met/HGF receptor gene during the progression of colon cancer. Clin. Cancer Res. 1,147-154[Abstract]
  9. Comoglio, P. M., Trusolino, L. (2002) Series Introduction: Invasive growth: from development to metastasis. J. Clin. Invest. 109,857-862[CrossRef][Medline]
  10. Messa, C., Russo, F., Caruso, G. M., Leo, A. D. (1998) EGF, TGF-{alpha}, and EGF-R in human colon adenocarcinoma. Acta Oncol. 37,285-289[CrossRef][Medline]
  11. Ozgul, C., Karaoz, E., Erdogan, D., Dursun, A. (1997) Expression of epidermal growth factor receptor in normal colonic mucosa and in adenocarcinomas of the colon. Acta Physiol. Hung. 85,121-128[Medline]
  12. Brabletz, T., Jung, A., Reu, S., Porzner, M., Hlubek, F., Kunz-Schughart, L. A., Knuechel, R., Kirchner, T. (2001) Variable ß-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc. Natl. Acad. Sci. USA 98,10356-10361[Abstract/Free Full Text]
  13. Barth, A. I., Natke, I. S., Nelson, W. J. (1997) Cadherins, catenins and APC protein: interplay between cytoskeletal complexes and signaling pathways. Curr. Opin. Cell Biol. 9,683-690[CrossRef][Medline]
  14. Alexander, N., Wong, C., Pignatelli, M. (2002) ß-Catenin—a linchpin in colorectal carcinogenesis?. Am. J. Pathol. 160,389-401[Abstract/Free Full Text]
  15. Hiscox, S., Jiang, W. G. (1999) Hepatocyte growth factor/scatter factor disrupts epithelial tumor cell–cell adhesion: involvement of beta-catenin. Anticancer Res. 19,509-518[Medline]
  16. Ellis, V., Pyke, C., Eriksen, J., Solberg, H., Dano, K. (1992) The urokinase receptor: involvement in cell surface proteolysis and cancer invasion. Ann. N. Y. Acad. Sci. 667,13-31[Medline]
  17. Andreasen, P. A., Kjoller, L., Christensen, L., Duffy, M. J. (1997) The urokinase-type plasminogen activator system in cancer metastasis: a review. Int. J. Cancer 72,1-22[CrossRef][Medline]
  18. Pyke, C., Kristensen, P., Ralfkiaer, E., Grondahl-Hansen, J., Eriksen, J., Blasi, F., Dano, K. (1991) Urokinase-type plasminogen activator is expressed in stromal cells and its receptor in cancer cells at invasive foci in human colon adenocarcinoma. Am. J. Pathol. 138,1059-1067[Abstract]
  19. Ganesh, S., Sier, C. F., Heerding, M. M., Griffioen, G., Lamers, C. B., Verspaget, H. W. (1994) Urokinase receptor and colorectal cancer survival. Lancet 344,401-402[CrossRef][Medline]
  20. Eguchi, S., Numaguchi, K., Iwasaki, H., Matsumoto, T., Yamakawa, T., Utsunomiya, H., Motley, E. D., Kawakatsu, H., Owada, K. M., Hirata, Y., et al (1998) Calcium-dependent epidermal growth factor receptor transactivation mediates the angiotensin II-induced mitogen-activated protein kinase activation in vascular smooth muscle cells. J. Biol. Chem. 273,8890-8896[Abstract/Free Full Text]
  21. Tomioka, D., Maehara, N., Kuba, K., Mizumoto, K., Tanaka, M., Matsumoto, K., Nakamura, T. (2001) Inhibition of growth, invasion, and metastasis of human pancreatic carcinoma cells by NK4 in an orthotopic mouse model. Cancer Res. 61,7518-7524[Abstract/Free Full Text]
  22. Pai, R., Soreghan, B., Szabo, I. L., Pavelka, M., Baatar, D., Tarnawski, A. S. (2002) Prostaglandin E2 transactivates EGF receptor and triggers mitogenic signaling in gastric mucosa and colon cancer cells. A novel mechanism for colon cancer growth and gastrointestinal hypertrophy. Nat. Med. 8,289-293[CrossRef][Medline]
  23. Dubois, R. N., Smalley, W. E. (1996) Cyclooxygenase, NSAIDs, and colorectal cancer. J. Gastroenterol. 6,898-906
  24. Yang, V. W., Geiman, D. E., Hubbard, W. C., Spannhake, E. W., Hylind, L., Hamilton, S. R., Giardiello, F. M. (2000) Tissue prostanoids as biomarkers for chemoprevention of colorectal neoplasia: correlation between prostanoid synthesis and clinical response in familial adenomatous polyposis. Prostaglandins Other Lipid Mediat. 60,83-96[CrossRef][Medline]
  25. Sheng, H., Shao, J., Morrow, J. D., Beauchamp, R. D., DuBois, R. N. (1998) Modulation of apoptosis and Bcl-2 expression by prostaglandin E2 in human colon cancer cells. Cancer Res. 58,362-366[Abstract/Free Full Text]
  26. Bergstrom, J. D., Westermark, B., Heldin, N.-E. (2000) Epidermal growth factor receptor signaling activates Met in human anaplastic thyroid carcinoma cells. Exp. Cell Res. 259,293-299[CrossRef][Medline]
  27. Scheving, L. A., Stevenson, M. C., Taylormore, J. M., Traxler, P., Russell, W. E. (2002) Integral role of the EGF receptor in HGF-mediated hepatocyte proliferation. Biochem. Biophys. Res. Commun. 290,197-203[CrossRef][Medline]
  28. Jo, M., Stolz, D. B., Esplen, J. E., Dorko, K., Michalopoulos, G. K., Strom, S. C. (2000) Cross-talk between epidermal growth factor receptor and c-Met signaling pathways in transformed cells. J. Biol. Chem. 275,8806-8811[Abstract/Free Full Text]
  29. Hoschuetzky, H., Aberle, H., Kemler, R. (1994) Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor. J. Cell Biol. 127,1375-1380[Abstract/Free Full Text]
  30. Khwaja, A., Lehmann, K., Marte, M. B., Downward, J. (1998) Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway. J. Biol. Chem. 273,18793-18801[Abstract/Free Full Text]
  31. Fujino, H., West, K. A., Regan, J. W. (2002) Phosphorylation of glycogen synthase kinase-3 and stimulation of T-cell factor signaling following activation of EP2 and EP4 prostanoid receptors by prostaglandin E2. J. Biol. Chem. 277,2614-2619[Abstract/Free Full Text]
  32. Hao, X. P., Tomlinson, I. P., Ilyas, M., Palazzo, J. P., Talbot, I. C. (1997) Reciprocity between membranous and nuclear expression of ß-catenin in colorectal tumors. Virchows Arch. 431,167-172[CrossRef][Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
A. E. Moore, A. Greenhough, H. R. Roberts, D. J. Hicks, H. A. Patsos, A. C. Williams, and C. Paraskeva
HGF/Met signalling promotes PGE2 biogenesis via regulation of COX-2 and 15-PGDH expression in colorectal cancer cells
Carcinogenesis, October 1, 2009; 30(10): 1796 - 1804.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Kaur, B. Velmurugan, A. Tyagi, G. Deep, S. Katiyar, C. Agarwal, and R. Agarwal
Silibinin suppresses growth and induces apoptotic death of human colorectal carcinoma LoVo cells in culture and tumor xenograft
Mol. Cancer Ther., August 1, 2009; 8(8): 2366 - 2374.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Greenhough, H. J.M. Smartt, A. E. Moore, H. R. Roberts, A. C. Williams, C. Paraskeva, and A. Kaidi
The COX-2/PGE2 pathway: key roles in the hallmarks of cancer and adaptation to the tumour microenvironment
Carcinogenesis, March 1, 2009; 30(3): 377 - 386.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
L. J. Wirth, J. F. Krane, Y. Li, M. Othus, A. E. Moran, D. M. Dorfman, C. M. Norris Jr, L. Goguen, M. R. Posner, R. I. Haddad, et al.
A Pilot Surrogate Endpoint Biomarker Study of Celecoxib in Oral Premalignant Lesions
Cancer Prevention Research, October 1, 2008; 1(5): 339 - 348.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. B. Tuynman, L. Vermeulen, E. M. Boon, K. Kemper, A. H. Zwinderman, M. P. Peppelenbosch, and D. J. Richel
Cyclooxygenase-2 Inhibition Inhibits c-Met Kinase Activity and Wnt Activity in Colon Cancer
Cancer Res., February 15, 2008; 68(4): 1213 - 1220.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
V. Leone, A. di Palma, P. Ricchi, F. Acquaviva, M. Giannouli, A. M. Di Prisco, F. Iuliano, and A. M. Acquaviva
PGE2 inhibits apoptosis in human adenocarcinoma Caco-2 cell line through Ras-PI3K association and cAMP-dependent kinase A activation
Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G673 - G681.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. M. Siegfried, C. T. Gubish, M. E. Rothstein, P. E. Q. de Oliveira, and L. P. Stabile
Signaling Pathways Involved in Cyclooxygenase-2 Induction by Hepatocyte Growth Factor in Non Small-Cell Lung Cancer
Mol. Pharmacol., September 1, 2007; 72(3): 769 - 779.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Donnini, F. Finetti, R. Solito, E. Terzuoli, A. Sacchetti, L. Morbidelli, P. Patrignani, and M. Ziche
EP2 prostanoid receptor promotes squamous cell carcinoma growth through epidermal growth factor receptor transactivation and iNOS and ERK1/2 pathways
FASEB J, August 1, 2007; 21(10): 2418 - 2430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. F. McCole, A. Truong, M. Bunz, and K. E. Barrett
Consequences of Direct Versus Indirect Activation of Epidermal Growth Factor Receptor in Intestinal Epithelial Cells Are Dictated by Protein-tyrosine Phosphatase 1B
J. Biol. Chem., May 4, 2007; 282(18): 13303 - 13315.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Shao and H. Sheng
Prostaglandin E2 Induces the Expression of IL-1{alpha} in Colon Cancer Cells
J. Immunol., April 1, 2007; 178(7): 4097 - 4103.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-W. E. Chang, J. W. Marlin, T. W. Chance, and R. Jakobi
RhoA Mediates Cyclooxygenase-2 Signaling to Disrupt the Formation of Adherens Junctions and Increase Cell Motility
Cancer Res., December 15, 2006; 66(24): 11700 - 11708.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Muller, K. J. Sales, A. A. Katz, and H. N. Jabbour
Seminal Plasma Promotes the Expression of Tumorigenic and Angiogenic Genes in Cervical Adenocarcinoma Cells via the E-Series Prostanoid 4 Receptor
Endocrinology, July 1, 2006; 147(7): 3356 - 3365.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. M. Carothers, A. E. Moran, N. L. Cho, M. Redston, and M. M. Bertagnolli
Changes in Antitumor Response in C57BL/6J-Min/+ Mice during Long-term Administration of a Selective Cyclooxygenase-2 Inhibitor.
Cancer Res., June 15, 2006; 66(12): 6432 - 6438.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. P. Milling Smith, S. Battersby, K. J. Sales, H. O. D. Critchley, and H. N. Jabbour
Prostacyclin Receptor Up-Regulates the Expression of Angiogenic Genes in Human Endometrium via Cross Talk with Epidermal Growth Factor Receptor and the Extracellular Signaling Receptor Kinase 1/2 Pathway
Endocrinology, April 1, 2006; 147(4): 1697 - 1705.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. S. Choe, X. Zhang, H. J. C. Shin, D. M. Shin, and Z. Chen
Interaction between epidermal growth factor receptor- and cyclooxygenase 2-mediated pathways and its implications for the chemoprevention of head and neck cancer
Mol. Cancer Ther., September 1, 2005; 4(9): 1448 - 1455.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
X. Zhang, Z. Chen, M. S. Choe, Y. Lin, S.-Y. Sun, H. S. Wieand, H. J. C. Shin, A. Chen, F. R. Khuri, and D. M. Shin
Tumor Growth Inhibition by Simultaneously Blocking Epidermal Growth Factor Receptor and Cyclooxygenase-2 in a Xenograft Model
Clin. Cancer Res., September 1, 2005; 11(17): 6261 - 6269.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
P. M. Weinberger, Z. Yu, D. Kowalski, J. Joe, P. Manger, A. Psyrri, and C. T. Sasaki
Differential Expression of Epidermal Growth Factor Receptor, c-Met, and HER2/neu in Chordoma Compared With 17 Other Malignancies
Arch Otolaryngol Head Neck Surg, August 1, 2005; 131(8): 707 - 711.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Mendez and M. C. LaPointe
PGE2-induced hypertrophy of cardiac myocytes involves EP4 receptor-dependent activation of p42/44 MAPK and EGFR transactivation
Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2111 - H2117.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Mayoral, A. Fernandez-Martinez, L. Bosca, and P. Martin-Sanz
Prostaglandin E2 promotes migration and adhesion in hepatocellular carcinoma cells
Carcinogenesis, April 1, 2005; 26(4): 753 - 761.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. W. Yim, H.-S. Jong, T. Y. Kim, H. H. Choi, S. G. Kim, S. H. Song, J. Kim, S.-G. Ko, J. W. Lee, T.-Y. Kim, et al.
Cyclooxygenase-2 Inhibits Novel Ginseng Metabolite-Mediated Apoptosis
Cancer Res., March 1, 2005; 65(5): 1952 - 1960.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Sato, N. Maehara, and M. Goggins
Gene Expression Profiling of Tumor-Stromal Interactions between Pancreatic Cancer Cells and Stromal Fibroblasts
Cancer Res., October 1, 2004; 64(19): 6950 - 6956.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
I. Tegeder and G. Geisslinger
Opioids As Modulators of Cell Death and Survival--Unraveling Mechanisms and Revealing New Indications
Pharmacol. Rev., September 1, 2004; 56(3): 351 - 369.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. M. Fischer, S. Giordano, P. M. Comoglio, and A. Ullrich
Reactive Oxygen Species Mediate Met Receptor Transactivation by G Protein-coupled Receptors and the Epidermal Growth Factor Receptor in Human Carcinoma Cells
J. Biol. Chem., July 9, 2004; 279(28): 28970 - 28978.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. J. Sales, S. Maudsley, and H. N. Jabbour
Elevated Prostaglandin EP2 Receptor in Endometrial Adenocarcinoma Cells Promotes Vascular Endothelial Growth Factor Expression via Cyclic 3',5'-Adenosine Monophosphate-Mediated Transactivation of the Epidermal Growth Factor Receptor and Extracellular Signal-Regulated Kinase 1/2 Signaling Pathways
Mol. Endocrinol., June 1, 2004; 18(6): 1533 - 1545.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Pai, A. S. Tarnawski, and T. Tran
Deoxycholic Acid Activates {beta}-Catenin Signaling Pathway and Increases Colon Cell Cancer Growth and Invasiveness
Mol. Biol. Cell, May 1, 2004; 15(5): 2156 - 2163.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Shao, B. M. Evers, and H. Sheng
Prostaglandin E2 Synergistically Enhances Receptor Tyrosine Kinase-dependent Signaling System in Colon Cancer Cells
J. Biol. Chem., April 2, 2004; 279(14): 14287 - 14293.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by PAI, R.
Right arrow Articles by TARNAWSKI, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by PAI, R.
Right arrow Articles by TARNAWSKI, A. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS