|
|
||||||||
Medical Service, Department of Veterans Affairs Medical Center, Long Beach, California, USA; Department of Medicine, University of California, Irvine, California, USA; and
* Osaka University Graduate School of Medicine, Osaka, Japan
1Correspondence: Gastroenterology Section (111G), DVA Medical Center, Long Beach (CA), 5901 East Seventh St., Long Beach, CA 90822, USA. E-mail: rpai{at}uci.edu.com
| ABSTRACT |
|---|
|
|
|---|
Key Words: EGFR Met-R ß-catenin uPAR PGE2
| INTRODUCTION |
|---|
|
|
|---|
An early event in cancer progression is the loss of cellcell adhesion within the primary tumor, development of an invasive phenotype and subsequent migration and tumor cell invasion into the matrix and adjacent tissues. Cell adhesion and polarity, which determine epithelial phenotype, are mediated by cell surface expression of E-cadherin. E-Cadherin, a 120 kDa protein, is expressed in the adherens junctions of epithelial cells and interacts with the cytoskeleton via associated cytoplasmic proteins, the catenins (13)
. While ß-catenin associated with E-cadherin and
-catenin at the plasma membrane regulates cell adhesion, cytoplasmic ß-catenin is involved in signal transduction and activation of genes (c-myc, gastrin, Cox-2, MMP-7, cyclin D1, uPAR, CD44, and P-glycoprotein), which play important roles in the development and progression of colorectal carcinoma (14)
. It has been suggested that ß-catenin activity is crucial for cancer invasion and metastases through its role in cell adhesion and that different mechanisms, including mutations in the adenomatous polyposis coli gene, inside or outside the regulatory domain ß-catenin can alter its signaling properties (14)
. Tyrosine phosphorylation of ß-catenin is suggested to promote metastatic potential and tumor invasiveness by stabilizing ß-catenin and binding of TCF/Lef1 DNA transcription factors, which in turn stimulate cell proliferation in normal and cancer cells (14)
. Overexpression of ß-catenin and down-regulation of E-cadherin in highly invasive and poorly differentiated cancers (12)
, implicate E-cadherin and ß-catenin in the development and progression of cancer invasiveness. HGF promotes tyrosine phosphorylation of ß-catenin and impairs association of ß-catenin with E-cadherin in human colorectal cancer cells (15)
. These changes are accompanied by the loss of intercellular adhesions and acquisition of invasive phenotype reflected by increased cell motility and invasiveness (15)
. Whether PGE2 affects tyrosine phosphorylation of ß-catenin and association with c-Met-R in colon cancer cells remains unknown.
The urokinase-type plasminogen activator (uPA) is a serine protease that induces conversion of the inactive zymogen plasminogen into plasmin. Plasmin is a proteolytic enzyme capable of degrading both extracellular matrix and components of basement membrane and activating latent matrix metalloproteinases. Binding of pro-uPA to its specific receptor (uPAR) increases the conversion of plasminogen to plasmin (16)
. uPA and uPAR are implicated to stimulate cell migration and invasiveness in a paracrine and/or autocrine manner (9
, 17)
. They play an important role in cancer invasiveness (9
, 17)
. Colon cancers display overexpression of uPAR at the invasive front (18)
, and this overexpression correlates with a reduced 5 year survival in colon cancer patients (19)
. ß-Catenin induces uPAR expression, but the mechanism of this action is unclear although a possible involvement of oncoproteins whose promoters bear TCF binding sites (c-jun and fra-1) has been suggested (14)
.
Because activation of c-Met-R has been shown to stimulate invasive growth in almost every tissue and prostaglandin concentration in colon cancers is significantly increased, we hypothesized that PGE2 increases colon cancer cell invasiveness by transactivating c-Met-R and increases tyrosine phosphorylation of ß-catenin. Stabilized ß-catenin would subsequently translocate into the nucleus and trigger uPAR expression (target gene of ß-catenin) and increase colon cancer invasiveness. Our results demonstrate that PGE2 significantly increases colon cancer cell invasiveness and that this action involves activation of the EGFR-c-Met-R-ß-catenin-uPAR signaling pathway. We also demonstrate the clinical relevance of these findings by performing immunohistochemical studies of human colon cancer specimens. These showed that cancer cells forming the invasive front overexpress c-Met-R, ß-catenin and Cox-2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
chain of HGF. NK-4 binds to the c-Met-R and selectively inhibits c-Met-R phosphorylation (21).
Preparation of cytoplasmic and nuclear proteins
Colon cancer cells were lysed in buffer containing 0.5% NP-40, 20 mM Tris-HCl pH 7.4, 10 mM NaCl, and 2 mM MgCl2 for 2 min at 4°C. After centrifugation at 500 g for 5 min, supernatants were collected as cytoplasmic protein; 0.1% SDS, 25 µg/mL aprotinin, and 25 µg/mL leupeptin were added into the lysates. The nuclear pellets were washed in lysis buffer lacking NP-40, then repelleted. Nuclear pellets were resuspended by vortexing in 1 pellet volume of nuclear extraction buffer (20 mM Tris, pH 8.0, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 1 mM PMSF, and 2.3 µg/mL aprotinin, leupeptin, and pepstatin). All cytoplasmic and nuclear extracts were centrifuged and transferred to fresh tubes. Glycerol was added to cytoplasmic extracts to a final concentration of 20%. Protein concentrations were determined by using a BCA protein assay kit (Pierce, Rockford, IL, USA). Equal amounts of denatured nuclear and cytoplasmic protein (30 µg) were resolved on 7.5% SDS PAGE at 60 V and immunoblotted following the procedure detailed below.
Immunoprecipitation
Cells were lysed in ice-cold lysis buffer (20 mmol/L Tris-HCl pH 7.5, 50 mmol/L NaCl, 50 mmol/L sodium fluoride, 30 mmol/L sodium pyrophosphate, 5 mol/L EGTA, 10% glycerol, 1% Triton X-100, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L sodium orthovanadate, and 5 µg/mL aprotinin) and clarified by centrifugation at 14,000 rpm for 10 min. The protein concentration of the lysate was determined using a bicinchoninic acid protein assay kit (Pierce). Equal amounts of proteins (500 µg) were incubated with specific primary antibody immobilized onto protein A Sepharose for 2 h at 4°C under gentle rotation. Beads were washed extensively with lysis buffer; immunocomplexes were eluted by heating for 5 min at 95°C in Laemmli buffer and microcentrifuged. The supernatant was subjected to 7.5% SDS-PAGE at 60 V, then immunoblotted with specific antibodies following the procedure detailed below.
Western blot analysis
Western blot analysis was performed following the method described previously (22)
. Supernatants from immunoprecipitates, nuclear and cytoplasmic proteins (30 µg) were subjected to 7.5% SDS-PAGE at 60 volts and transferred onto a nitrocellulose membrane. Blots were stained with Ponceau red to ensure equal loading and complete transfer of proteins. The membrane containing the transferred proteins was incubated with blocking buffer, subsequently washed, and incubated with specific primary antibodies for 1 h at room temperature. Blots were washed in Tris-buffered saline containing 0.1% Tween 20 (TBST, pH 7.4) and incubated with specific peroxidase-conjugated secondary antibodies for 1 h at room temperature. The antibodies used for immunoprecipitation and immunoblotting were anti-c-Met-R and ß-catenin mAbs from BD Transduction (San Diego, CA, USA), and anti-phosphotyrosine (PY99) and anti-E-cadherin mAb from Santa Cruz Biotech (Santa Cruz, CA, USA). After extensive washing in TBST, immunoreactive proteins were visualized by the ECL detection system (Amersham, Arlington Heights, IL, USA). Where indicated, membranes were stripped (Reblot-Plus; Chemicon, Temecula, CA, USA) and reprobed with another antibody. The densities of specific protein bands were analyzed using ImageQuant analysis system (Storm, optical scanner, Molecular Dynamics, Sunnyvale, CA, USA). Quantitative analyses of EGFR, c-Met-R, and ß-catenin phosphorylation levels were performed by determining the ratio between total protein and the phosphorylation using data from three separate experiments performed in triplicate. All the immunoprecipitation and Western blot analysis studies were performed in triplicate and repeated on three different occasions.
Determination of uPAR mRNA expression
Total RNA was isolated using the RNAqueous commercial kit (Ambion Inc., Austin, TX, USA) following the manufacturers protocol. Reverse transcription and polymerase chain reaction (RT/PCR) were performed using a GeneAmp RNA PCR kit and a DNA thermal cycler (Applied Biosystems, Foster City, CA, USA). The 253 bp fragment of the uPAR cDNA was PCR amplified using a 25-mer upstream primer (5' CATGCAGTGTAAGACCCAACGGGGA 3') identical to position 121-145 and 24-mer down stream primer (5' AATAGGTGACAGCCCGGCCAGAGT 3'). The PCR amplification was performed for 28 cycles of 1 min at 94°C for denaturing, 1 min at 60°C for annealing, and 2 min at 72°C for extension. Human specific ß-actin primers (Clontech, Palo Alto, CA, USA) served as positive controls. Ten microliter aliquots of the products were subjected to electrophoresis on a 1.25% agarose gel and DNA was visualized by ethidium bromide staining. Location of the products and their sizes were determined by using a 100 bp ladder (GIBCO, Gaithersburg, MD, USA). The gel was photographed under ultraviolet illumination.
Cell invasion assay
Studies were carried out in Transwell chambers as described (6)
. Colon cancer cells (Caco-2, LoVo, SW 480) were serum starved for 24 h. Transwell chambers equipped with 8 µm Matrigel-coated filters (24-well format) (Becton Dickinson, Franklin Lakes, NJ, USA) were rehydrated, and 4 x 104 cells in 400 µL of serum-free medium in the presence or absence of AG 1478 (250 nM), NK-4 (1 µg/mL) were seeded in the upper chamber. Serum-free medium-containing vehicle or PGE2 was used in the lower chamber. After 24 h incubation at 37°C, cells on the upper surface of the filter were mechanically removed with a cotton swab. The filters were fixed and stained using a Diff-Quick staining kit (Dade Behring, Newark, DE, USA). Cells on the lower surface were counted under a microscope (magnification 100x). Five fields were counted per each filter and four wells were used for each treatment.
Colony formation assay
Colony formation or cell growth in Matrigel was determined following the protocol described previously (6)
. Colon cancer (Caco-2, LoVo, SW 480) cells (1x104) were suspended in 0.5 mL of 1:1 diluted Matrigel (Collaborative Biomed, Bedford, MA, USA). The cell/Matrigel mixture was plated into 24-well polystyrene plates and incubated at 37°C. The vehicle, AG 1478 (250 nM), NK-4 (1 µg/mL) with or without PGE2 (10 µM), EGF (10 ng/mL), or HGF (10 ng/mL) was then added in fresh medium every 2 days. After incubating for 10 days, images were captured using a camera attached to an inverted Nikon (TE300) microscope.
Immunohistochemistry
This study was approved by the subcommittee for human studies of the Long Beach Department of Veterans Affairs Medical Center (Long Beach, CA, USA). Paraffin-embedded tissue sections of human colon cancers were double stained using the EnvisionTM Doublestain system (DAKO, Carpinteria, CA, USA). Staining was performed using anti-Cox-2, anti-c-Met-R (both 1:100 dilution; Santa Cruz Biotech) and anti-ß-catenin antibodies (1:100; BD Transduction) according to the manufacturers instructions (DAKO, CA, USA). 3,3'-Diaminobenzidine tetrachloride and 5-bromo-4-chloro-3-indoxylphosphate/nitro blue tetrazolium chloride (BCIP/NBT) was used as substrate for c-Met-R, Cox-2 (brown) and ß-catenin (black), respectively. The sections were counterstained with Mayers hematoxylin. Images were captured using a Nikon digital camera (DXL 1200) attached to a Nikon Optiphot microscope. Specificity of staining was confirmed by omitting the primary antibody.
Statistical analysis
Students t test was used to compare data between two groups. One-way ANOVA and Bonferroni correction were used to compare data between three or more groups. Values are expressed as mean ± standard error of the mean (SE). P values less than 0.05 were considered statistically significant.
| RESULTS |
|---|
|
|
|---|
|
PGE2 transactivates c-Met-R in a manner dependent on functional EGFR in colon cancer cells
Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 5 min) significantly increased c-Met-R phosphorylation (P<0.03 and P<0.001) (Fig. 2
A, B). To determine whether EGFR activation is required for PGE2-induced c-Met-R phosphorylation in colon cancer cells, we inactivated EGFR with the specific inhibitor tyrphostin AG 1478. Inactivation of EGFR with AG 1478 (250 nM, 30 min) almost completely inhibited PGE2-induced c-Met-R phosphorylation, indicating that functional EGFR is required for PGE2-induced c-Met-R activation (Fig. 2A, B
).
|
PGE2 alters ß-catenin activity and increases its nuclear accumulation in colon cancer cells
Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 5 min) significantly increased c-Met-R association with ß-catenin in LoVo and Caco-2 cells and reciprocally reduced E-cadherin association with ß-catenin (Fig. 3
A) compared with vehicle-treated control cells. Increased association of c-Met-R with ß-catenin was accompanied by a marked increase in tyrosine phosphorylation of ß-catenin (Fig. 3A
). Similar results showing increased c-Met-R association with ß-catenin and tyrosine phosphorylation of ß-catenin in response to PGE2 were obtained with another invasive colon cancer line, SW 480 (data not shown). One hour after PGE2 treatment, a marked increase in nuclear accumulation of ß-catenin occurred and pretreatment with EGFR inhibitor (AG 1478, 250 nM, 30 min) suppressed this effect (Fig. 3B
). To determine whether PGE2-mediated increase in nuclear ß-catenin levels was due to a decrease in GSK-3ß phosphorylation (negative regulator of ß-catenin), we treated LoVo and Caco-2 cells with PGE2 and assessed GSK-3ß phosphorylation levels. Treatment of colon cancer cells with PGE2 (10 µM, 5 min) did not cause any significant change in GSK-3ß phosphorylation levels (data not shown).
|
PGE2 induces uPAR mRNA expression in colon cancer cells
Since uPAR is overexpressed in colon cancers and is a target gene for ß-catenin, we investigated the effect of PGE2 on uPAR mRNA expression (14
, 17
, 18)
. RT-PCR analysis demonstrated that PGE2 treatment markedly increases uPAR mRNA expression in an invasive type of cell (LoVo) and only slightly increases it in poorly invasive Caco-2 cells (Fig. 4
A). Pretreatment of LoVo and Caco-2 cells with EGFR inhibitor AG 1478 (250 nM, 30 min) suppressed PGE2-mediated uPAR expression less than c-Met-R inhibitor (NK-4, 1 µg/mL, 16 h) (Fig. 4A
).
|
PGE2 increases colon cancer cell invasiveness
To determine whether PGE2-mediated transactivation of c-Met-R results in increased invasiveness of colon cancer cells, we performed in vitro cell invasion and colony formation assays. PGE2 treatment (10 µM, 24 h) significantly increased LoVo and SW 480 cell invasiveness but not Caco-2 cells, as reflected by a significant increase in the number of cells that migrated through the Matrigel and the porous polycarbonate filters (Fig. 4B
). This difference in responses could be attributed to the phenotypic characteristics of cells, since Caco-2 originated from a primary adenocarcinoma whereas LoVo was derived from lymph node metastasis. SW480 are regarded as cells in progression to metastasize because the patient eventually developed metastasis. EGFR inhibitor (AG 1478, 250 nM) and c-Met-R inhibitor (NK-4, 1 µg/mL) both significantly suppressed PGE2-induced colon cancer cell invasiveness (Fig. 4B
). c-Met-R inhibitor (NK-4) caused a greater reduction in PGE2-induced colon cancer invasiveness than EGFR inhibitor (AG 1478).
Next, we evaluated the ability of colon cancer cells to spread and grow in Matrigel by performing colony formation assay. Treatment of colon cancer cells (Caco-2, LoVo) with PGE2 (10 µM, 10 days) caused widespread growth, with a significant lateral invasion into the matrix resulting in formation of larger, asymmetrical colonies (Fig. 5
). PGE2 treatment of colon cancer cells pretreated with c-Met-R inhibitor NK-4 (1 µg/mL) resulted in smaller and less spread, rounded colonies. Pretreatment with EGFR inhibitor AG 1478 (250 nM) had a weaker effect on PGE2-induced colon cancer cell invasion (Fig. 5)
and colony formation than c-Met-R inhibition (Fig. 5)
. The colon cancer cell colonies formed in the presence of PGE2 closely resembled those formed in the presence of HGF (Fig. 5)
. Similar results were obtained with SW 480 cells subjected to colony formation in Matrigel under identical conditions. The SW 480 cells in Matrigel formed large asymmetrical colonies in response to PGE2 and pretreatment with EGFR and c-Met-R inhibitors significantly suppressed this growth (data not shown).
|
Cancer cells forming the invasive front overexpress c-Met-R, ß-catenin, and Cox-2 in human colon cancers
To determine the clinical relevance of the above findings, we examined the expression of c-Met-R, ß-catenin, and Cox-2 in surgical specimens of human colon cancers (Fig. 6
A, B). Immunostaining of human colon cancer tissue sections displayed overexpression of c-Met-R, ß-catenin (Fig. 6A
) and Cox-2 (Fig. 6B
) in cancer cells forming the invasive front. While increased c-Met-R staining was localized to the membrane and cytoplasm of cancer cells both in invasive and noninvasive areas with enhanced expression at the invasive front, ß-catenin was localized to the membrane in the noninvasive region and distinctly to the nucleus of cells in the invasive front (Fig. 6A
, right panel). The Cox-2 staining was predominantly localized to the cytoplasm of cells, forming the invasive front; some cells also exhibited membrane localization (Fig. 6B
, right panel).
|
| DISCUSSION |
|---|
|
|
|---|
Previous studies demonstrated that Cox-2 expression in human colon cancer cells increases metastatic potential, but the involvement of c-Met-R or EGFR in PGE2-mediated colon cancer cell invasiveness was not implicated (6
, 7
, 25)
. In the present study we demonstrated that PGE2 transactivates c-Met-R and the requirement of functional EGFR for this PGE2-induced c-Met-R activation in colon cancer cells. Our data are consistent with previous studies showing that activated EGFR can phosphorylate and activate c-Met-R in thyroid carcinoma cell lines and hepatocytes possibly by heterodimeric association between c-Met-R and EGFR (26
27
28)
. We further demonstrated that PGE2-activated c-Met-R associates with ß-catenin and increases its tyrosine phosphorylation. Both EGFR and c-Met-R are capable of associating with ß-catenin and phosphorylating ß-catenin; however, activation of EGFR has been shown to stimulate invasiveness only transiently whereas c-Met-R activation causes prolonged stimulation of invasiveness (9
, 29
, 30)
. Our study indicates that PGE2-induced colon cancer cell invasiveness could involve both EGFR and c-Met-R.
Although a recent study using human embryonic kidney cells suggested that PGE2 increases nuclear ß-catenin levels by decreasing GSK-3ß phosphorylation (negative regulator of ß-catenin), our present study demonstrated that PGE2 does not alter GSK-3ß phosphorylation levels (data not shown), implicating that in colon cancer cells, PGE2-induced ß-catenin stabilization and subsequent translocation into the nucleus are induced mostly by its tyrosine phosphorylation (31)
.
In highly invasive and poorly differentiated cancers, overexpression ß-catenin and down-regulation of E-cadherin have been reported (12)
. It has also been demonstrated that in human colorectal cancer cells, HGF-mediated tyrosine phosphorylation of ß-catenin and impaired association of ß-catenin with E-cadherin are accompanied by the loss of intercellular adhesions and acquisition of invasive phenotype reflected by increased cell motility and invasiveness (15)
. Our datademonstrate that ligand-independent activation of c-Met-R could cause similar changes (significant loss of E-cadherin association with ß-catenin) and increase colon cancer cell invasiveness.
Degradation of the extracellular matrix by serine proteinases is an important step in tumor progression and invasion. Besides being a target gene for ß-catenin, uPAR expression has been shown to strongly correlate with the tumor cell invasiveness and aggressiveness (17)
. Our findings show that PGE2 increases uPAR expression substantially in more invasive LoVo cells than in less invasive Caco-2 cells. This effect was also apparent during invasion and colony formation assays. In response to PGE2, Caco-2 cells (unlike LoVo and SW 480) did not show any significant change in the number of migrating cells across Matrigel-coated porous filter (24 h). However, they formed significantly large colonies in Matrigel after prolonged incubation (10 days), suggesting their colony-forming ability could be due to prolonged activation of c-Met-R and/or EGFR. Inactivation of c-Met-R suppressed PGE2-mediated colony formation to a greater extent than EGFR inactivation, suggesting that PGE2 potentiates colon cancer cell invasiveness via c-Met-R. The degree of cell differentiation and invasiveness could alter their response to prostaglandins. Utilization of three different cell lines with different characteristics in this study further demonstrated that in addition to stimulating cancer cell invasiveness in highly metastatic (LoVo) cells, PGE2 could also initiate invasiveness in nonmetastatic (Caco-2) cells and in cells progressing to metastasize (SW 480).
We also demonstrated in human colon cancer sections that cancer cells forming the invasive front coexpress c-Met-R and ß-catenin. ß-Catenin was localized to the membrane in the noninvasive region and distinctly to the nucleus of cells in the invasive front supporting ß-catenin involvement in cancer invasiveness. This agrees with a study by Hao and co-workers demonstrating a reciprocal relationship between reduced membranous and increased nuclear ß-catenin expression during transition of colorectal adenoma to carcinoma (32)
. The same cancer tissue, but a different section, also displayed overexpression of Cox-2, implicating increased PG generation at the invasive front.
In summary, our present study provides evidence that PGE2 promotes colon cancer cell invasiveness and that this action involves activation of EGFR, c-Met-R, and ß-catenin and increased uPAR expression. These findings also explain a possible spatial and functional relationship between Cox-2 and generated prostaglandins, EGFR, and c-Met-R in colon cancer growth and invasion.
| ACKNOWLEDGMENTS |
|---|
Received for publication January 7, 2003. Accepted for publication May 22, 2003.
| REFERENCES |
|---|
|
|
|---|
, and EGF-R in human colon adenocarcinoma. Acta Oncol. 37,285-289[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. B. Tuynman, L. Vermeulen, E. M. Boon, K. Kemper, A. H. Zwinderman, M. P. Peppelenbosch, and D. J. Richel Cyclooxygenase-2 Inhibition Inhibits c-Met Kinase Activity and Wnt Activity in Colon Cancer Cancer Res., February 15, 2008; 68(4): 1213 - 1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Leone, A. di Palma, P. Ricchi, F. Acquaviva, M. Giannouli, A. M. Di Prisco, F. Iuliano, and A. M. Acquaviva PGE2 inhibits apoptosis in human adenocarcinoma Caco-2 cell line through Ras-PI3K association and cAMP-dependent kinase A activation Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G673 - G681. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Siegfried, C. T. Gubish, M. E. Rothstein, P. E. Q. de Oliveira, and L. P. Stabile Signaling Pathways Involved in Cyclooxygenase-2 Induction by Hepatocyte Growth Factor in Non Small-Cell Lung Cancer Mol. Pharmacol., September 1, 2007; 72(3): 769 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Donnini, F. Finetti, R. Solito, E. Terzuoli, A. Sacchetti, L. Morbidelli, P. Patrignani, and M. Ziche EP2 prostanoid receptor promotes squamous cell carcinoma growth through epidermal growth factor receptor transactivation and iNOS and ERK1/2 pathways FASEB J, August 1, 2007; 21(10): 2418 - 2430. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. McCole, A. Truong, M. Bunz, and K. E. Barrett Consequences of Direct Versus Indirect Activation of Epidermal Growth Factor Receptor in Intestinal Epithelial Cells Are Dictated by Protein-tyrosine Phosphatase 1B J. Biol. Chem., May 4, 2007; 282(18): 13303 - 13315. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shao and H. Sheng Prostaglandin E2 Induces the Expression of IL-1{alpha} in Colon Cancer Cells J. Immunol., April 1, 2007; 178(7): 4097 - 4103. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. E. Chang, J. W. Marlin, T. W. Chance, and R. Jakobi RhoA Mediates Cyclooxygenase-2 Signaling to Disrupt the Formation of Adherens Junctions and Increase Cell Motility Cancer Res., December 15, 2006; 66(24): 11700 - 11708. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Muller, K. J. Sales, A. A. Katz, and H. N. Jabbour Seminal Plasma Promotes the Expression of Tumorigenic and Angiogenic Genes in Cervical Adenocarcinoma Cells via the E-Series Prostanoid 4 Receptor Endocrinology, July 1, 2006; 147(7): 3356 - 3365. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Carothers, A. E. Moran, N. L. Cho, M. Redston, and M. M. Bertagnolli Changes in Antitumor Response in C57BL/6J-Min/+ Mice during Long-term Administration of a Selective Cyclooxygenase-2 Inhibitor. Cancer Res., June 15, 2006; 66(12): 6432 - 6438. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. P. Milling Smith, S. Battersby, K. J. Sales, H. O. D. Critchley, and H. N. Jabbour Prostacyclin Receptor Up-Regulates the Expression of Angiogenic Genes in Human Endometrium via Cross Talk with Epidermal Growth Factor Receptor and the Extracellular Signaling Receptor Kinase 1/2 Pathway Endocrinology, April 1, 2006; 147(4): 1697 - 1705. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Choe, X. Zhang, H. J. C. Shin, D. M. Shin, and Z. Chen Interaction between epidermal growth factor receptor- and cyclooxygenase 2-mediated pathways and its implications for the chemoprevention of head and neck cancer Mol. Cancer Ther., September 1, 2005; 4(9): 1448 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, Z. Chen, M. S. Choe, Y. Lin, S.-Y. Sun, H. S. Wieand, H. J. C. Shin, A. Chen, F. R. Khuri, and D. M. Shin Tumor Growth Inhibition by Simultaneously Blocking Epidermal Growth Factor Receptor and Cyclooxygenase-2 in a Xenograft Model Clin. Cancer Res., September 1, 2005; 11(17): 6261 - 6269. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Weinberger, Z. Yu, D. Kowalski, J. Joe, P. Manger, A. Psyrri, and C. T. Sasaki Differential Expression of Epidermal Growth Factor Receptor, c-Met, and HER2/neu in Chordoma Compared With 17 Other Malignancies Arch Otolaryngol Head Neck Surg, August 1, 2005; 131(8): 707 - 711. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mendez and M. C. LaPointe PGE2-induced hypertrophy of cardiac myocytes involves EP4 receptor-dependent activation of p42/44 MAPK and EGFR transactivation Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2111 - H2117. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mayoral, A. Fernandez-Martinez, L. Bosca, and P. Martin-Sanz Prostaglandin E2 promotes migration and adhesion in hepatocellular carcinoma cells Carcinogenesis, April 1, 2005; 26(4): 753 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. Yim, H.-S. Jong, T. Y. Kim, H. H. Choi, S. G. Kim, S. H. Song, J. Kim, S.-G. Ko, J. W. Lee, T.-Y. Kim, et al. Cyclooxygenase-2 Inhibits Novel Ginseng Metabolite-Mediated Apoptosis Cancer Res., March 1, 2005; 65(5): 1952 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sato, N. Maehara, and M. Goggins Gene Expression Profiling of Tumor-Stromal Interactions between Pancreatic Cancer Cells and Stromal Fibroblasts Cancer Res., October 1, 2004; 64(19): 6950 - 6956. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tegeder and G. Geisslinger Opioids As Modulators of Cell Death and Survival--Unraveling Mechanisms and Revealing New Indications Pharmacol. Rev., September 1, 2004; 56(3): 351 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
|