FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GRATZINGER, D.
Right arrow Articles by MADRI, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GRATZINGER, D.
Right arrow Articles by MADRI, J. A.
(The FASEB Journal. 2003;17:1458-1469.)
© 2003 FASEB

Platelet endothelial cell adhesion molecule-1 modulates endothelial cell motility through the small G-protein Rho

DITA GRATZINGER, SANDRA CANOSA, BRITTA ENGELHARDT* and JOSEPH A. MADRI1

Department of Pathology, Yale University School of Medicine, New Haven Connecticut, USA; and
* Max-Planck Institute for Vascular Biology, Muenster, Germany

1Correspondence: Department of Pathology, Lauder Hall 115, Yale University School of Medicine, New Haven, CT 06510, USA. E-mail: joseph.madri{at}yale.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Platelet endothelial cell adhesion molecule-1 (PECAM-1), an immunoglobulin family vascular adhesion molecule, is involved in endothelial cell migration and angiogenesis (1 , 2) . We found that endothelial cells lacking PECAM-1 exhibit increased single cell motility and extension formation but poor wound healing migration, reminiscent of cells in which Rho activity has been suppressed by overexpressing a GTPase-activating protein (3) . The ability of PECAM-1 to restore wound healing migration to PECAM-1-deficient cells was independent of its extracellular domain or signaling via its immunoreceptor tyrosine-based inhibitory motif. PECAM-1-deficient endothelial cells had a selective defect in RhoGTP loading, and inhibition of Rho activity mimicked the PECAM-1-deficient phenotype of increased chemokinetic single cell motility at the expense of coordinated wound healing migration. The wound healing advantage of PECAM-1-positive endothelial cells was not only Rho mediated but pertussis toxin inhibitable, characteristic of migration mediated by heterotrimeric G-protein-linked seven-transmembrane receptor signaling such as signaling in response to the serum sphingolipid sphingosine-1-phosphate (S1P) (4 , 5) . Indeed, we found that the wound healing defect of PECAM-1 null endothelial cells is minimized in sphingolipid-depleted media; moreover, PECAM-1 null endothelial cells fail to increase their migration in response to S1P. We have also found that PECAM-1 localizes to rafts and that in its absence heterotrimeric G-protein components are differentially recruited to rafts, providing a potential mechanism for PECAM-1-mediated coordination of S1P signaling. PECAM-1 may thus support the effective S1P/RhoGTP signaling required for wound healing endothelial migration by allowing for the spatially directed, coordinated activation of Galpha signaling pathways.—Gratzinger, D., Canosa, S., Engelhardt, B., Madri, J. A. Platelet endothelial cell adhesion molecule-1 modulates endothelial cell motility through the small G-protein Rho.


Key Words: CD31 • vascular endothelium • cell movement • small G-protein • sphingosine-1-phosphate


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
PECAM-1 is a 130 kDa type I transmembrane adhesion protein expressed on endothelial cells, platelets, and most leukocytes (6 , 7) . The cytoplasmic domain of PECAM-1 contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) that binds and activates SH2 domain-containing proteins when phosphorylated (8 , 9) . PECAM-1 modulates endothelial cell migration in vitro and angiogenesis both in vitro and in vivo (1 , 2) . The PECAM-1 knockout mouse is viable and fertile, with no overt vascular abnormalities (10) . However, defects in angiogenesis into a polyvinyl acetate sponge are seen in a model of foreign body inflammation in the PECAM-1 knockout mouse (11) . At the same time, some aspects of endothelial cell motility are enhanced in the absence of PECAM-1: in a model of cardiac cushion development (12) , migration of individual endocardial cells onto a type I collagen gel is preserved in the presence of high glucose in explants derived from the PECAM-1 knockout mouse despite decreased VEGF-mediated signaling (13) .

Rho family GTPases play prominent roles in vascular physiology, including the rearrangement and migration of confluent endothelial cells and angiogenesis in vitro and in vivo (14 15 16 17) . Rho family GTPases including Rac, Rho, and Cdc42 act in a coordinated manner to regulate cell extension formation, motility, and directionality by modulating actin cytoskeletal and focal contact dynamics (18 , 19) . S1P is a platelet-released lipid mediator of endothelial chemotaxis, wound healing endothelial migration, VEGF- and bFGF-induced angiogenesis, and vascular maturation that represents the majority of the endothelial chemotactic activity present in serum (4 , 20 , 21) . S1P engages Endothelial differentiation gene (EDG) or S1P seven-transmembrane receptors to mediate endothelial cell migration and angiogenesis through heterotrimeric G-protein signaling. Coordinated S1P signaling via EDG1/SIP1 activates Galphai2, localizing and activating focal contact components (22) as EDG3/S1P3 activates Galpha13 to appropriately remodel the actin cytoskeleton via Rho signaling (23 , 24) .

Lipid rafts are cholesterol-rich, liquid-ordered subdomains within the liquid-disordered plasma membrane (25) . Such lipid raft domains have been found to help segregate associated proteins to the leading edge vs. the rear of certain polarized migrating cells (26) . Some signaling proteins including heterotrimeric G-proteins, src, and H-ras localize to these endothelial subdomains (27 , 28) , providing spatially localized signaling information that could potentially contribute to polarized cellular behaviors, including migration. Caveolin-positive, low density lipid raft domains have been found to interact with various cell–cell junctional proteins including components of adherens junctions (29) , tight junctions (30) , and even gap junctions (31) , and as such could play a role in the loosening of cell–cell adhesions that permits coordinated migration of cells into a wound to occur.

We have examined the role of PECAM-1 in promoting coordinated wound healing migration vs. the chemokinetic motility of individual endothelial cells in the absence of a signaling gradient via modulation of RhoGTP. Single cell motility is prominently involved in developmental and physiologic processes such as angioblast migration during neural tube vasculogenesis (32) and migration of endothelial cells through areas of local basement membrane degradation during sprouting angiogenesis (33) . We have further examined the contribution of S1P and heterotrimeric G-protein-mediated signaling to the PECAM-1-mediated promotion of coordinated wound healing migration. Coordinated wound healing migration necessarily involves response to multiple directional signals, as wounding induces release of chemotactic factors at the leading edge and uncovers haptotactic factors previously laid down by the endothelial monolayer. For example, injury induces endothelial release of fibroblast growth factor-2 (FGF-2), which contributes to the endothelial wound healing response in vitro (34 , 35) . In vivo, denuded basement membrane promotes platelet aggregation and release of multiple chemotactic factors, including S1P, which also promotes endothelial wound healing migration (4) . Finally, exposed extracellular matrix components such as fibronectin themselves provide strong haptotactic cues to endothelial wound healing and angiogenesis (36) . Wound healing migration models physiologically relevant in vivo cell behaviors such as the reendothelialization of denuded vasculature following balloon angioplasty or the remodeling of vascular endothelium under variant flow conditions.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Reagents and constructs
Rabbit polyclonal antibody (pAb) to murine (37) and human (2) PECAM-1 were generated in our lab. mAb to ERK2 and caveolin and pAb to paxillin PY118 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). mAbs to Rac1, Rho, and FAK were purchased from BD Biosciences, Transduction Laboratories (San Diego, CA, USA). mAbs to RhoGAP p190 and pAbs to FAK PY397 and RasGAP p120 were purchased from Upstate (Lake Placid, NY). mAb to ß actin was purchased from Sigma-Aldrich (St. Louis, MO, USA). Anti-phosphoERK pAb was purchased from Cell Signaling Technology (Beverly, MA, USA). pAbs to heterotrimeric G-protein subunits Galphai2 and Galpha13 were purchased from Transduction Laboratories. Rhodamine-phalloidin and methyl ß cyclodextrin was purchased from Sigma-Aldrich. Botulinum exoenzyme C3, pertussis toxin, S1P, and Y27632 were purchased from Calbiochem-Novabiochem (San Diego, CA, USA). Complete Protease InhibitorTM (CPI) was purchased from Roche Diagnostics (Mannheim, Germany). Cell culture and transfection reagents were from Life Technologies (Grand Island, NY, USA).

Full-length human PECAM-1 (see Fig. 4 c) in the mammalian expression vector APEX-1 (Alexion, New Haven, CT) and its Y663F mutant have been described (2) . An additional mutation at Y686F was made using the QuikChangeTM Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions to produce an ITIM-defective construct. A myc-tagged truncated construct in APEX-1 lacks most of the ectodomain (38) . The Rho binding domain of Rhotekin in a GST fusion protein expression construct (pGEX2T, Pharmacia, Piscataway, NJ, USA) was a gift from X. D. Ren and M. A. Schwartz (39) . A GST fusion protein expression construct of the Rac binding region of PAK, pGEX4T-1 {alpha}PAK70-106, was a gift from F. Giancotti (40) . pIRES-EGFP was from BD Biosciences, Clontech (Palo Alto, CA, USA). pCDNA3-VCAM mammalian expression construct was made by subcloning the full-length cDNA purchased from Biogen (Cambridge, MA, USA). Antisense oligonucleotide 5' TCCTTCCAGGGATGTGATC 3' for human PECAM-1 and control scrambled oligonucleotide 5' TTCTACCTCGCGCGATTTAC 3' were the gift of F. Bennett and T. Condon at IsisTM Pharmaceuticals (Carlsbad, CA, USA).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. PECAM-1 expression controls migratory characteristics of endothelial cells. a) Antisense oligonucleotides decrease PECAM-1 expression in HUVEC compared with the scrambled oligonucleotide control. b) Antisense-treated HUVEC have significantly increased single cell motility, decreased wound healing migration (*P<0.005). c) The constructs used in transient transfections of PecamKO endothelial cells include full-length PECAM-1 (FL), PECAM-1 mutated in its ITIM domain (2F), and PECAM-1 lacking the ectodomain (Tr). d) Transient transfection of PecamKO with FL, 2F, and Tr PECAM-1 constructs but not with GFP or VCAM restores wound healing migration to PecamKO cells (*P<0.0005 vs. GFP; n=8).

Cell culture, immunostaining, and transfections
Endothelioma cell line luEnd.PECAM-1.1 (PecamKO) was established by retroviral transduction of primary lung endothelial cells derived from the PECAM-1 knockout mouse with the polyoma virus middle T oncogene (41) . PecamKO cells were retrovirally transduced with full-length murine PECAM-1 cDNA to generate a PecamRC (reconstituted) cell line (41 , 42) . Cells were cultured in luEnd media [Dulbecco’s modified Eagle medium (DMEM), 10% fetal bovine serum (FBS), 10 mM HEPES, 2 mM L-glutamine, 1% nonessential amino acids, pyruvate, 10-5 M 2-mercaptoethanol, and antibiotics]. Selection of PECAM-1 expression was maintained with 1 µg/mL puromycin. Human umbilical vein endothelial cells (HUVEC) were purchased from the BCMM cell culture core (Yale Medical School) and cultured on gelatin in HUVEC media [M199 medium, 20% FBS, 50 mg/mL endothelial cell growth supplement (ECGS), 50 mg/mL heparin, 10 mM HEPES, 2 mM L-glutamine, and antibiotics]. For immunostaining, PecamRC and PecamKO cells were incubated overnight in luEnd media on 8-chamber fibronectin-coated glass culture slides (Falcon, Becton Dickinson, Franklin Lakes, NJ, USA). Cells were fixed in Streck’s Tissue Fixative (STF, Streck Laboratories, La Vista, NE, USA), permeabilized with 0.5% Triton X-100 in TBS, and stained with rhodamine-phalloidin (Sigma) 1:200 or anti-phosphopaxillin (Santa Cruz) 1:5000, followed by donkey anti-rabbit Cy3 (Jackson Immunoresearch Labs, West Grove, PA, USA) at 1:200. After coverslipping with Antifade Mounting Media (Molecular Probes, Eugene, OR, USA) cells were photographed using a Carl Zeiss Research microscope (Göttingen, Germany) and SPOT digital camera (Diagnostic Instruments Inc., Sterling Heights, MI, USA). For transient transfections, subconfluent PecamKO cells were transfected using LipofectAMINE2000 according to the manufacturer’s instructions. For antisense oligonucleotide transfections, passage 3 HUVEC at 70–80% confluence was transfected using Lipofectin according to the manufacturer’s instructions.

Migration assays
Single cell chemokinetic assay
To measure chemokinesis or single cell motility in the absence of a directional signal, the motility of cells to the bottom surface of a porous filter was quantitated in the absence of chemotactic or haptotactic stimuli. TranswellsTM (8 µm pore size; Corning Inc., Corning, NY, USA) were coated on both sides overnight with 12.5 µg/mL fibronectin and blocked with 5% BSA as described (43) . Endothelial media (100 µL) was added to the top well and 500 µL to the bottom well. Endothelial cells were briefly trypsinized, washed twice in endothelial media, and 100 µL of a 106 cell/mL single cell suspension was added to the top well. Lung endothelial cell transmigrations were performed in luEnd media that contained 10% FBS. HUVEC transmigrations were performed in HUVEC media lacking ECGS and with FBS decreased to 2%, because transmigration in the presence of ECGS and higher concentrations of FBS were so high that transmigrated cells were difficult to count. After 2.5 h of incubation at 37°C, the cells were fixed in STF and stained with crystal violet. Cells on top of the filter were removed with a cotton swab and cells on the bottom surface were quantitated.

Wound healing assay
Falcon® Petri dishes (60 mm; Becton Dickinson) were coated with fibronectin as above. Butanol-extracted fibronectin and butanol-extracted BSA were used for coating in experiments involving S1P. Confluent PecamKO and PecamRC monolayers grown on fibronectin-coated plates in luEnd media and confluent HUVEC grown on gelatin-coated plates in HUVEC media were scraped with a 15-well minigel comb leaving concentric rings of cells, washed with PBS, and incubated 24 h. Distance migrated was quantitated by taking pictures at 0 and 24 h with a Nikon Coolpix995 Digital Camera (Nikon Corp., Tokyo, Japan) on an Olympus IM light microscope (Melville, NY, USA) and measuring distance of wound edge from a mark on the bottom of the plate.

luEnd and HUVEC media contained FBS (10% and 20%, respectively) and thus contained sphingolipids, including S1P (44) ; for S1P experiments, therefore, FBS was depleted of sphingolipids through charcoal stripping (CS-FBS). For S1P experiments, CS-FBS was prepared by incubating 50 mL FBS with 5 g activated charcoal (Sigma) overnight at 4°C (45) . The CS-FBS was centrifuged (10 min at 1000 g) and filtered through a 0.22 µm sterile Nalgene® filter (Sybron Corp., Rochester, NY, USA).

To quantitate extension formation, 104 PecamRC or PecamKO cells/well in luEnd media were plated in a fibronectin-coated 24-well plate. Cells were fixed in STF and stained with crystal violet, photographed as above, and quantitated using the public domain NIH Image program (National Institutes of Health, Bethesda, MD, USA). The theoretical radius (r) had the cell been a perfect circle was determined according the formula rperimeter = perimeter/2{pi} and rarea = {surd}(area/{pi}), and the ratio rperimeter to rarea was used to determine deviation from circularity.

Western blot and immunoprecipitation
Confluent monolayers of PecamRC and PecamKO cells cultured in luEnd media on fibronectin-coated plates were washed twice in ice-cold PBS containing 1 mM orthovanadate and scraped into lysis buffer (20 mM Tris pH 7.5, 100 mM NaCl, 10 mM EDTA, 1% Nonidet P-40, 1% deoxycholate, 0.1% SDS, 50 mM sodium fluoride, 1 mM sodium orthovanadate, and CPI). Lysates were centrifuged at 14,000 g at 4°C for 10 min and supernatant protein concentration was determined using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA) as directed. For Western blots, 20 µg protein was boiled with 4x sample buffer (240 mM Tris pH 6.8, 40% glycerol, 8% SDS, 0.002% bromophenol blue, 0.002% ß-mercaptoethanol). For immunoprecipitation, 200 µg protein was precleared with protein A/G-Sepharose (Santa Cruz); the cleared supernatant was incubated with the appropriate antibody for 1 to 2 h turning end-over-end at 4°C, then precipitated with A/G-Sepharose. Beads were washed three times in lysis buffer and boiled in 4x sample buffer.

Samples were separated by SDS PAGE, transferred to an Immobilon P membrane (Millipore, Bedford, MA, USA), probed with anti-ERK 1:10,000, anti-phosphoERK 1:1000, anti-FAK 1:10,000 and anti-FAK PY397 1:2000, anti-p190 RhoGAP 1:5000, anti-p120 RasGAP 1:5000, or anti-phosphotyrosine 1:10,000 followed by horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit IgG (Promega, Madison, WI, USA), and developed using Chemiluminescent Reagent Plus (PerkinElmer Life Sciences, Boston, MA, USA). Blots were scanned on an Arcus II scanner (Agfa, Mortsel, Belgium) and quantitated using BioMax 1D software (Kodak).

RhoGTP and RacGTP pulldown assays
GST-Rho binding domain (BD) was expressed and purified using glutathione-agarose beads (Sigma-Aldrich) as described (39) . GST-p21 activated kinase (PAK) Rac BD was expressed and purified as described (46) . Freshly confluent PecamRC or PecamKO cells grown in luEnd media on fibronectin-coated 100 mm plates were lysed, 20 µL lysate set aside for normalization, and RhoGTP or RacGTP pulled down using glutathione/agarose-bound GST-Rho BD or GST-PAK Rac BD (39 , 46) . Samples were separated by SDS PAGE, transferred to an Immobilon P membrane, probed with anti-Rho 1:100 or anti-Rac 1:100, and developed and quantitated as above.

Raft fractionation
Sucrose density gradient lipid raft fractionation was carried out in a detergent-free sodium bicarbonate buffer essentially as described in ref 47 . Confluent endothelial cells were scraped into lysis buffer (500 mM sodium bicarbonate) and sonicated. 85% sucrose in MBB (25 mM MES, pH 6.5, 150 mM NaCl, and 25 mM sodium bicarbonate) was added to bring the sample to 42.5% sucrose. The 2 mL sample was placed in an ultracentrifuge tube on ice for 4 h, layered with 8 mL of 30% sucrose in MBB, followed by 2 mL 5% sucrose in MBB layered to make a discontinuous gradient. The sample was centrifuged at 39,000 rpm for 18 h at 4°C in an SW41 rotor (Beckman Instruments, Palo Alto, CA, USA), at which time an opalescent band representing the caveolin-positive raft fraction was visible at the 30%/5% sucrose interface. Fractions of 1 mL were carefully pipetted; 20 µL samples were boiled in 4x sample buffer for analysis, separated by SDS-PAGE, and transferred to an Immobilon P filter. Blots were probed with anti-PECAM-1, anti-caveolin, or anti-ß actin at 1:10,000 or anti-Galphai2 or anti-Galpha13 at 1:250, developed, then quantitated as above.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
PECAM-1 promotes endothelial cell wound healing migration over single cell motility
An immortalized endothelial cell line derived from the PECAM-1 knockout mouse (PecamKO) and the same line reconstituted with full-length PECAM-1 (PecamRC) both retain surface expression of VE cadherin by fluorescence-activated cell sorting and show contact inhibition upon confluence (41 , 42) . Lung endothelial cell culture media (luEnd media) contains 10% FBS, and all results presented were acquired in cells cultured in the presence of serum containing multiple growth factors and sphingolipids. PecamRC cells form cobblestone-like monolayers; PecamKO cells form similar tightly compact monolayers, but the cells are more spindle-shaped. Figure 1 a demonstrates this morphology at the migrating front of a wound healing endothelial monolayer. Phalloidin staining for filamentous actin (F-actin) revealed stress fibers throughout the cytoplasm of PecamRC cells compared with sparser cortical actin bands in PecamKO cells (Fig. 1b ). Immunostaining for phosphopaxillin (48) , a component of focal contacts and adhesions, revealed typical elongated focal adhesions in PecamRC cells; in PecamKO cells, phosphopaxillin staining prominently highlighted the leading edges of lamellipodial extensions. Individually plated PecamKO cells form multiple extensions whereas PecamRC spread more evenly (Fig. 2 a). As a surrogate measure of extension formation or deviation from circularity, I derived theoretical radii (r) from the measured perimeter and the measured area, respectively, as if they had been perfect circles. For a perfect circle the ratio of rperimeter to rarea will be 1.0; any deviation from circularity will produce higher ratios. This number is dimensionless and therefore independent of any variation in size distribution between cell populations. The ratio of rperimeter to rarea is in fact significantly increased in PecamKO cells, confirming the apparent increase in extension formation seen when cells are individually plated (Fig. 2b ).



View larger version (61K):
[in this window]
[in a new window]
 
Figure 1. Morphology of PECAM-1 knockout (PecamKO) and PECAM-1-reconstituted (PecamRC) lung endothelial cells. a) PecamRC cells make cobblestone-like monolayers whereas PecamKO cells are more spindle-shaped. b) Immunofluorescence demonstrate rounded cell shape and increased stress fibers in PecamRC cells (upper left panel, phalloidin stain) and distinct dash-like focal adhesion contacts (lower left panel, anti-phosphopaxillin stain-labeled PaxPY118). In contrast, PecamKO cells exhibit sparse cortical actin staining (upper right panel) and extensions whose leading edges are highlighted with the focal contact component phosphopaxillin (lower right panel).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. Extension formation is increased in PecamKO endothelial cells. a) Cells were allowed to spread for 4 h, fixed, and stained with crystal violet. b) Quantitation of ratios of r derived from perimeter vs. r derived from area as a measure of the deviation from circularity confirms significantly higher extension formation by PecamKO cells (*P<0.00005 vs. RC, n=6 with 89 cells quantitated; error bars represent SE).

Two aspects of endothelial cell migration were assessed. Single cell motility in the absence of a chemotactic or haptotactic gradient (chemokinesis) was assessed by quantitating cells reaching the underside of a fibronectin-coated 8 micron pore TranswellTM membrane in 2.5 h. Coordinated migration of endothelial cells was assessed using a wound healing assay, measuring the distance migrated into a scraped wound over 24 h. Previous studies have reached conflicting conclusions about the role of PECAM-1 in endothelial migration. Antibody blocking studies have demonstrated decreases in wound healing migration and single cell motility in anti-PECAM-1-treated human umbilical vein endothelial cells (49) . The direct effect of PECAM-1 expression on migration has been tested in nonendothelial cell lines with varying results, including decreased wound healing migration in epithelial cells (50) and increases in both wound healing and single cell motility in mesothelial cells (49) . In endothelial cells the role of PECAM-1 in the two types of migration are discordant: PecamKO cells were found to have significantly enhanced single cell motility (Fig. 3 a) but decreased wound healing migration (Fig. 3b ) with respect to PecamRC cells. To rule out the possibility that decreased wound healing in PecamKO cells is secondary to a proliferation rather than a migration defect, the wound healing assay was also carried out in the presence of mitomycin C to block proliferation (Fig. 3b ). Proliferation does contribute to wound healing migration, and overall distance migrated during mitomycin C treatment dropped by ~50% for both PecamRC and PecamKO endothelial cells. However, the differential in migration between the two cell types remained, implying that a proliferation defect does not account for the retardation of wound healing migration in PECAM-1-deficient endothelial cells.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Migration characteristics of PecamKO cells. a) PecamKO cells display enhanced single cell motility through 8 µm fibronectin-coated membranes but b) poor wound healing migration on fibronectin in the 24 h scrape assay compared with PecamRC cells. The wound migration defect was not eliminated by blocking proliferation with mitomycin C (mito C). *P < 0.0005 vs. PecamRC; n = 8 for wound healing; n = 9 for transmigration.

The role of PECAM-1 in endothelial cell motility was confirmed in primary HUVEC using an antisense approach. Western blot analysis confirmed stable depletion of PECAM-1 expression over 48 h in HUVEC treated with antisense oligonucleotide compared with scrambled oligonucleotide control (Fig. 4 a). Single cell motility was significantly increased and wound healing migration decreased with antisense treatment (Fig. 4b ), confirming the findings in PecamKO and PecamRC endothelial cells. The effect of PECAM-1 on wound healing could require the ectodomain, which mediates homophilic cell–cell interactions and whose engagement modulates integrin activation (51 , 52) and/or the cytoplasmic domain. The ITIM domain is dephosphorylated during wound healing migration (2) but phosphorylated during flow-induced rearrangement (53) , modulating binding and activation of SH2-containing proteins. PecamKO cells were therefore transiently transfected with control vectors expressing GFP or vascular cell adhesion molecule (VCAM); full-length PECAM-1; PECAM-1 lacking its ectodomain; or PECAM-1 mutated in its ITIM domain to eliminate phosphorylation (Fig. 4c ). Unlike GFP or VCAM, full-length PECAM-1 restored wound healing migration to PecamKO cells (Fig. 4d ). Neither the ectodomain nor the intact ITIM domain was required to confer the PECAM-mediated wound healing advantage, however, implying that PECAM-1 cytoplasmic domain signals to modulate migration independent of phosphorylation-mediated recruitment of SH2 domain-containing proteins.

PECAM-1 null endothelial cells are deficient in RhoGTP, and this deficiency accounts for their migratory phenotype
PecamKO cells show pronounced extension-formation and enhanced single cell motility but blunted wound healing migration. Lamellipodia are RacGTP-driven membrane extensions (18) involved in cell motility; endothelial wound healing in contrast is RhoGTP mediated (15) . The bivalent migratory phenotype of PECAM-1 null endothelial cells may thus reflect an imbalance of Rho and Rac activation. To assess levels of activated Rho and Rac, the G-proteins were pulled down with recombinantly expressed proteins that have a high affinity for their respective GTP-bound forms (Fig. 5 a, b). GTP-bound protein was quantitated and normalized to total expression to reveal a significant defect in RhoGTP loading in PecamKO compared with Pecam RC endothelial cells (Fig. 5 c); there was by comparison no significant difference in RacGTP loading. Thus, overall Rac activation is normal in PecamKO cells but RhoGTP levels are depressed, potentially lowering the threshold for Rac-mediated extension formation and motility while interfering with wound healing migration.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. PecamKO cells have a selective defect in RhoGTP loading. a) Pulldowns with the recombinant RhoGTP binding domain of Rhotekin reveal significantly decreased levels of RhoGTP in PecamKO cells (shown in quadruplicate). b) Pulldowns with the recombinant RacGTP binding domain of PAK reveal no significant differences in RacGTP loading in PecamRC vs. PecamKO cells (shown in duplicate). c) Quantitation of RhoGTP and RacGTP pulldowns. d) Immunoprecipitation (IP) of p120RasGAP reveals higher association with and tyrosine phosphorylation (PY) of p190RhoGAP in PecamKO cells (shown in duplicate). e) Quantitation of p120RasGAP IPs: relative p190RhoGAP coprecipitating with p120RasGAP (p190:p120) and relative PY of coprecipitated p190RhoGAP (PY:p190) (*P<0.05 vs. PecRC; n=4 for RhoGTP; n=2 for RacGTP; n=2 for IP). f) Pulldowns with the recombinant RhoGTP binding domain of Rhotekin reveal significantly decreased levels of RhoGTP in HUVEC treated with Pecam-1 antisense oligonucleotide compared with a scrambled oligonucleotide control. g) Quantitation of HUVEC RhoGTP pulldowns (*P<0.003 antisense vs. control; n=3 for RhoGTP).

The GTPase-activating protein (GAP) p190RhoGAP inhibits Rho signaling upon integrin engagement in a src-dependent manner (3) , allowing for extension formation and cell motility. Tyrosine phosphorylation of p190RhoGAP mediates p120RasGAP association, which is necessary for GAP activation (54) . p120RasGAP was immunoprecipitated to determine levels and tyrosine phosphorylation of associated p190RhoGAP (Fig. 5d ). Quantitation revealed significantly increased association and tyrosine phosphorylation of p190RhoGAP with p120RasGAP (Fig. 5e ), consistent with p190RhoGAP activation and the decrease observed in RhoGTP in PecamKO cells. In the converse experiment, immunoprecipitation of p190RhoGAP also revealed increased p190 tyrosine phosphorylation and p120RasGAP association (data not shown).

Depletion of RhoGTP was noted in HUVEC treated with PECAM-1 antisense oligonucleotide compared with a scrambled oligonucleotide control (Fig. 5f, g ), confirming the applicability of the findings to primary as well as immortalized endothelial cells.

To determine whether in fact decreased Rho activity accounts for the migration characteristics of PecamKO endothelial cells, migrating cells were treated with both a direct inhibitor of Rho, the C3 exoenzyme (exoC3) of C. botulinum, and an inhibitor of the Rho effector p160ROCK, Y27632 (16) . ExoC3 abrogated the wound healing advantage of PecamRC endothelial cells and significantly increased their single cell motility (Fig. 6 a, b). Y27632 had effects similar to those of ExoC3 in PecamKO and PecamRC cells (Fig. 69c, d). Extension formation was significantly increased, further mimicking the effect of PECAM-1 deficiency in endothelial cells (Fig. 6 e). Y27632 also significantly increased single cell motility and extension formation in bovine aortic endothelial cells, confirming the applicability of the findings to primary as well as immortalized endothelial cells (Fig. 6f, g ).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Rho inhibition mimics the PecamKO migratory phenotype. Cells were treated with exoC3 (a, b) to directly inactivate Rho or with Y27632 (c, d) to inhibit the Rho effector p160ROCK. Wound migration was significantly inhibited (a, c) and single cell motility significantly promoted (b, d) by inhibition of Rho or its effector p160ROCK. e) Quantitation of ratios of r derived from perimeter vs. r derived from area as a measure of the deviation from circularity confirms that extension formation was significantly increased in Y27632-treated cells (*P<0.005 vs. PecamRC control; n=8 for wound healing; n=9 for single cell motility; n=6 with 98 cells quantitated for extensions). BAECs respond to inhibition of Rho signaling by Y27632 with increased extension formations (f) and single cell motility (g) (*P<0.005 vs. BAE-C control; n=9 for single cell motility; n=9 with 1143 cells quantitated for extensions).

PECAM-1 is required for effective signaling and wound healing migration in response to sphingosine-1-phosphate
S1P, a serum sphingolipid, signals through heterotrimeric G-proteins associated with its seven-transmembrane EDG/S1P family receptors. S1P-mediated endothelial wound healing and chemotaxis is Rho dependent and pertussis toxin (PTX) inhibitable (Fig. 6) ; (4 , 5) . PTX treatment abrogated the wound healing advantage of PecamRC cells; no significant difference in distance migrated remained between PTX-treated PecamRC and PecamKO endothelial cells (Fig. 7 a). PTX inhibits Galphai2-mediated activation of extracellular signal-regulated kinase (ERK), FAK, and src downstream of the EDG1/S1P receptor. Western blot with phosphospecific antibodies revealed increased activation of ERK and phosphorylation of FAK at tyrosine 397 (FAK PY397) in confluent PecamKO endothelial cells compared with PecamRC cells (Fig. 7b ).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 7. PecamKO cells are defective in sphingolipid-mediated signaling. a) PTX abrogates the wound healing advantage of PecamRC (*P<0.005 vs. control, n=8). b) Confluent endothelial cells were evaluated for activated ERK (PERK) vs. total ERK and FAK phosphorylated at Y397 (PFAK) vs. total FAK. Quantitation of PERK normalized to total ERK and PFAK normalized to FAK reveal significantly higher activation of both FAK and ERK in PecamKO vs. PecamRC cells (*P<0.05 vs. PecamRC; n=4). c) Wound healing migration was assessed in sphingolipid-depleted media (CS-FBS), in CS-FBS supplemented with 100 nM sphingosine-1-phosphate (S1P), and in nondepleted media (FBS). PecamRC cells had significantly increased migration from baseline in response to S1P or sphingolipid-replete media, whereas PecamKO cells had no such increase (*P<0.005 vs. CS-FBS, n=8). Two-way ANOVA reveals a statistically significant cell type by treatment effect (F=16.86, P<0.000005).

ERK activation normally occurs only at the leading edge of migrating endothelial monolayers, where it mediates migration in response to wounding (35) . Indeed, ERK phosphorylation increases as expected in wounded, migrating PecamRC monolayers (data not shown), whereas no further increase was observed in the already high levels of ERK activation in migrating PecamKO monolayers. Inappropriate activation of FAK and ERK in confluent PecamKO cells indicates dysfunctional signaling in the absence of an appropriate migratory stimulus, and this signaling proves ineffective in coordinating migration of PecamKO monolayers when that wounding stimulus is provided.

To assess S1P-mediated migration, sphingolipid-depleted media was prepared using FBS that had been charcoal-stripped to deplete it of sphingolipids (CS-FBS) without significantly effecting levels of nonlipid growth factors such as VEGF and FGF (21) . Wound healing migration in CS-FBS was compared with migration in media supplemented with 100 nM S1P, about half the concentration of S1P in normal human plasma (44) , and in sphingolipid-replete media (Fig. 7c ). PecamRC cells responded to S1P supplementation and to sphingolipid-replete media with significantly increased migration whereas PecamKO cells had no such increase; two-way ANOVA revealed a statistically significant cell type by treatment effect. There was a nonsignificant decrease in migration of PecamKO cells with S1P supplementation and a significant decrease in wound healing in sphingolipid-replete media. Thus, S1P-mediated signaling and migratory responses are severely dysregulated in PECAM-1-deficient endothelial cells.

PECAM-1 localizes to caveolin-positive lipid rafts
We used sucrose density gradient fractionation to isolate the low density, caveolin-positive lipid raft fraction of PecamRC and PecamKO endothelial cell monolayers (Fig. 8 a). Methyl ß-cyclodextrin (mßcd) disperses low density lipid rafts by depleting them of cholesterol. Treatment with mßcd eliminated the low density, caveolin-positive fraction, confirming that it consists of lipid rafts, including caveolae. PECAM-1 was found to colocalize with caveolin-1 to the lipid raft fraction (Fig. 8b ); mßcd treatment also disrupted the low density fractionation of PECAM-1.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. PECAM-1 localizes to a low density raft fraction. a) Low density, caveolin-positive lipid rafts separate from most other proteins by sucrose gradient fractionation. Methyl ß-cyclodextrin (mßcd) disrupts lipid rafts and disperses the low density, caveolin-positive fraction. b) PECAM-1 cofractionates with lipid rafts in PecamRC cells, and disappears from the low density fraction upon raft disruption.

PECAM-1 modulates the relative recruitment of Galphai2 and Galpha13 to rafts: PECAM-1 cofractionates with low density, caveolin-positive lipid rafts, and PECAM-1 expression is needed for an effective coordinated migration response to S1P. Galpha subunits localize to low density lipid rafts and move in and out of caveolae (55) . Caveolin-1 interactions may modulate heterotrimeric G-protein signaling, directly by binding the inactive, GDP-bound version of Galpha heterotrimeric protein subunits and inhibiting GDP/GTP exchange (56) or indirectly by transiently sequestering dissociated Galpha subunits, desensitizing signaling via heterologous seven-transmembrane receptors that share the same G-protein (57) . Therefore, the relative recruitment of Galpha subunits to caveolin-positive rafts and their accessibility to either EDG family receptors or to inhibitory associations with caveolin-1 may have a direct bearing on Galpha subunit localization and degree of activation.

S1P-mediated migration has a pertussis-inhibitable, EDG-1/Galphai2-mediated component that results in activation of ERK signaling and FAK phosphorylation and an EDG-3-mediated component that couples to Galpha13, contributing to Rho activation. The ERK, FAK, and Rho signaling characteristics of PecamKO compared with those of PecamRC endothelial cells suggest a model in which the Galphai2-mediated signal is promiscuously activated, and the Galpha13 component is defective in the absence of PECAM-1. Given the potential role of raft localization in modulating heterotrimeric G-protein-mediated signaling, we assessed the relative targeting of Galphai2 vs. Galpha13 to rafts in PecamRC vs. PecamKO endothelial cells (Fig. 9 a). The results of these experiments were consistent with a role for PECAM-1 in supporting the targeting of Galpha subunits to lipid rafts: the ratio of Galphai2 to Galpha13 in the low density, caveolin-positive fraction was decreased by more than half in PecamKO compared with PecamRC endothelial cells (Fig. 9b ).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 9. PECAM-1 modulates raft recruitment of Galpha subunits. a) Western blots demonstrate raft localization of Galphai2 and Galpha13 subunits. b) Quantitation reveals higher ratio of Galphai2:Galpha13 in the presence of PECAM-1 (n=4, *P<0.05).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We have uncovered a significant new role for PECAM-1 in balancing coordinated wound healing migration and single cell motility of endothelial cells. The PECAM-1 knockout mouse is overtly developmentally normal, but abnormalities of endothelial function become apparent in response to appropriate insult. During the chronic phase of foreign body inflammation, for example, angiogenesis is severely compromised in the PECAM-1 knockout mouse (11) . An in vitro model of angiogenesis reveals a prominent defect in tube formation in immortalized lung endothelial cells derived from the PECAM-1 knockout mouse (PecamKO) compared with cells reconstituted with full-length PECAM-1 cDNA (PecamRC cells) (11) . Embryonic endocardial cells derived from the cardiac cushion of the PECAM-1 knockout mouse are aberrantly resistant to glucose-mediated inhibition of VEGF-induced scattering motility (13) . PECAM-1-deficient endothelial cells are defective in forming a stable new vasculature and, conversely, are resistant to inhibition of endocardial cell motility. Consistent with the dichotomous migratory behavior in vivo, we have found that PecamKO endothelial cells exhibit enhanced single cell single cell motility and lamellipodial extension formation at the expense of wound healing migration (Figs. 2 , 3) . The contribution of PECAM-1 to this migratory phenotype was confirmed by depleting PECAM-1 in primary endothelial cells using antisense technology (Fig. 4a, b ). The PECAM-1 cytoplasmic domain was sufficient to restore wound healing migration independent of a functional ITIM domain (Fig. 4c, d ). The migratory differences are accounted for by a selective deficiency of activated Rho (RhoGTP) as opposed to RacGTP in PecamKO cells (Fig. 5a-c ), since inhibition of either Rho itself or the Rho effector p160ROCK reproduced the PECAM-1-deficient migratory phenotype (Fig. 6) .

The decrease in RhoGTP loading could be at least partially attributed to increased activation of p190RhoGAP, a GTPase-activating protein, as marked by tyrosine phosphorylation and association of p190RhoGAP with p120RasGAP (Fig. 5c, d ). Figure 10 a delineates growth factor and integrin engagement-mediated lamellipodial extension and initiation of motility: some growth factors such as VEGF (58) activate Rac, which itself inhibits Rho (59) ; other growth factors (54) and integrins (3) activate src family kinases that phosphorylate and activate p190RhoGAP, inhibiting Rho indirectly. In fact, overexpression of p190RhoGAP alone promotes Rac-mediated lamellipodial extension formation and enhances motility (3) . The insensitivity of PECAM-1-deficient cardiac cushion endocardial cells to glucose-mediated suppression of VEGF-induced motility may thus be attributable to baseline low RhoGTP. Like primary PECAM-1-deficient cardiac cushion endocardial cells, PecamKO endothelial cells are resistant to glucose-mediated inhibition of single cell motility; pretreatment with an inhibitor of the Rho effector p160ROCK abrogates the inhibitory effect of glucose on PecamRC endothelial cell motility (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 10. Model for PECAM-1-mediated change in endothelial cell motility. a) Growth factor receptor activation and integrin engagement coordinately activates Rac and inhibits Rho via src-mediated phosphorylation of p190RhoGAP, allowing lamellipodial extensions and motility. b) In PECAM-positive cells S1P signals through EDG1/S1P1 and EDG3/S1P3 in a coordinated manner to produce directed extension formation and directed wound healing migration rather than single cell motility. c) In PECAM-negative cells EDG1/G{alpha}i2 are activated in a noncoordinated manner, leading to baseline activation of ERK, FAK, and src. Phosphorylation activates p190RhoGAP and suppresses RhoGTP; EDG3/S1P3-mediated signaling to G{alpha}13 is insufficient to activate Rho, favoring extension formation and single cell motility over directed wound healing.

S1P is a major endothelial chemotactic component of serum that engages EDG1/S1P1 and EDG3/S1P3 seven-transmembrane receptors to mediate endothelial migration and VEGF and bFGF-induced angiogenesis (20 , 45) via downstream signaling through Galphai2 to FAK, ERK, and src (22 , 60) and through Galpha13 to Rho (Fig. 10b ) (23 , 24) . In addition to direct EDG/S1P-receptor-mediated signaling, S1P likely signals via transactivation of other known angiogenic growth factor receptors such as the VEGF receptor (61) . The wound healing advantage of PecamRC cells is not only Rho dependent but PTX inhibitable (Fig. 7a ), a pattern characteristic of S1P-mediated endothelial migration. Although physiologic levels of S1P increase wound healing migration of PecamRC endothelial cells, as expected, PecamKO endothelial cells are not responsive to S1P; indeed, the wound healing advantage of PecamRC cells is much decreased in the presence of sphingolipid-depleted serum (Fig. 7 c). Elevated threonine/tyrosine phosphorylation of ERK and tyrosine phosphorylation of FAK in confluent PecamRC cells (Fig. 6b, c ) is consistent with dysregulated and ineffective Galphai2 signaling downstream of EDG1/S1P1 receptor. Src activity is likely increased in PecamKO cells: increased FAK at PY397 indicates that more src is likely bound and activated at focal contacts (62) , and tyrosine phosphorylation of p190RhoGAP, which is also increased, is mediated by src (3) .

Global activation of these pathways is insufficient to permit directed migration and wound healing; EDG1/S1P1 null fibroblasts, like PecamKO endothelial cells, display aberrant FAK and src activation but a decreased wound healing response to S1P, whereas local FAK and src activation at the leading edge promotes directed extension formation and migration of wild-type fibroblasts (22) . The timing and localization of signaling are crucial to promoting coordinated, directional migration. Local suppression of RhoGTP signaling (63) and activation of FAK, src, and ERK kinase activity (22 , 35) promotes directed extension formation as a component of a coordinated endothelial migratory response to mechanical wounding. In PecamKO endothelial cells, it appears that global suppression of Rho signaling and activation of Galphai2-mediated signaling pathways promote the formation of multiple lamellipodial extensions and single cell motility at the expense of coordinated migration. Another immunoglobulin family molecule containing ITIM sequences in its cytoplasmic domains, SHPS-1, may play a role similar to that of PECAM-1 in fibroblasts: expression of SHPS-1 lacking its cytoplasmic domain in fibroblasts blocks RhoGTP activation and wound healing migration, increases extension formation, and increases ERK and FAK phosphorylation (64) .

We propose a model of defective sphingosine-1-phosphate-mediated signaling and Rho activation in PECAM-1-deficient endothelial cells (Fig. 10b, c ). In PECAM-1-positive endothelial cells, S1P signals through Galphai2 and Galpha13 in a coordinated manner to produce directed extension formation and directed wound healing migration rather than single cell motility (Fig. 10b ). PECAM-1 modulates the selective recruitment of Galphai2 vs. Galpha13 to caveolin-positive, low density lipid raft fractions, where their activity might be modulated via association with EDG receptors and caveolin-1 (Fig. 9) . In PECAM-1-deficient endothelial cells, EDG1/S1P1 and Galphai2 are activated in a noncoordinated manner, leading to baseline activation of ERK, FAK, and src (Fig. 10c ). Phosphorylation activates p190RhoGAP and suppresses RhoGTP; EDG3/S1P3-mediated signaling to Galpha13 is insufficient to activate Rho, favoring extension formation and single cell motility over directed wound healing migration. This lack of coordinated responsiveness to serum sphingolipid chemotactic signals may account for the poor angiogenesis into polyvinyl acetate sponge implants in the PECAM-1 knockout mouse in a model of the chronic phase of foreign body inflammation (11) .

Indeed, S1P is far from alone in regulating endothelial migration through seven-transmembrane-linked heterotrimeric G-protein signaling. For example, CXCRs, seven-transmembrane receptors for cysteine-X-cysteine motif containing chemokines, including SDF-1 (CXCR4) (65) and interleukin-8-related cytokines (CXCR1/2) (66) , play an important role in angiogenesis in the settings of injury, inflammation, and neoplasia. The role of PECAM-1 in modulating S1P-mediated wound healing migration may extend to modulation of signaling via Galpha subunits downstream of multiple seven-transmembrane receptors. Preliminary studies indicate that both thrombin and histamine activate Rho to a significantly lower extent in PECAM-1 null as opposed to PECAM-1 reconstituted endothelial cells (data not shown).

Histamine receptor subtype H1, which promotes vascular permeability, is a seven-transmembrane receptor, although unlike the thrombin receptor it is ligand activated and signals primarily through Galphaq/11 (67) . Histamine promotes a p160ROCK-mediated increase in endothelial permeability (68) . The thrombin receptor belongs to the seven-transmembrane heterotrimeric G-protein linked family of protease activated receptors (PARs) and promotes endothelial cell migration and angiogenesis through pathways involving Rho signaling downstream of Galpha13 (69 , 70) . Thrombin mediates endothelial cell contraction through RhoGTP-mediated activation of p160ROCK, myosin light chain kinase, and consequently actin/myosin-mediated contractility (71) .

This may prove to be of significance in explaining the prolonged bleeding time phenotype of PECAM-1 null mice. Reciprocal bone marrow engraftment experiments between PECAM-1 null and wild-type mice have shown that the bleeding time is attributable to some deficiency of the PECAM-1 null vasculature rather than to a defect of bone marrow derived components such as platelets (72) . To stimulate platelet plug formation, endothelial cells must contract to reveal the underlying thrombogenic collagen surface in response to platelet-released factors such as thrombin (73) . Thus, one model to explain a prolonged bleeding time in PECAM-1 null mice despite the ability of PECAM-1 null platelets promote adequate hemostasis in the presence of a wild-type vasculature may be that PECAM-1 null endothelium fails to properly recruit platelet thrombi thanks to an impaired ability to contract in response to heterotrimeric G-protein-mediated signaling.


   ACKNOWLEDGMENTS
 
We thank M. A. Schwartz and X. D. Ren for the kind gift of the Rhotekin construct and detailed instructions, F. G. Giancotti for the PAK construct, F. Bennett and T. Condon at ISISTM Pharmaceuticals for the PECAM-1 antisense oligonucleotides, and L. Acevedo for technical help with raft preparations. This work was supported by grants to D.G. from the Medical Scientist Training Program and the Anna Fuller MD/PhD Predoctoral Fellowship in Oncology and by USPHS R37-HL-28373 to J.A.M.

Received for publication November 13, 2002. Accepted for publication April 13, 2003.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. DeLisser, H. M., Christofidou-Solomidou, M., Strieter, R. M., Burdick, M. D., Robinson, C. S., Wexler, R. S., Kerr, J. S., Garlanda, C., Merwin, J. R., Madri, J. A., et al (1997) Involvement of endothelial PECAM-1/CD31 in angiogenesis. Am. J. Pathol. 151,671-677[Abstract]
  2. Lu, T. T., Yan, L. G., Madri, J. A. (1996) Integrin engagement mediates tyrosine dephosphorylation on platelet-endothelial cell adhesion molecule 1. Proc. Natl. Acad. Sci. USA 93,11808-11813[Abstract/Free Full Text]
  3. Arthur, W. T., Petch, L. A., Burridge, K. (2000) Integrin engagement suppresses RhoA activity via a c-Src-dependent mechanism. Curr. Biol. 10,719-722[CrossRef][Medline]
  4. Lee, H., Goetzl, E. J., An, S. (2000) Lysophosphatidic acid and sphingosine 1-phosphate stimulate endothelial cell wound healing. Am. J. Physiol. 278,C612-C618
  5. Paik, J. H., Chae, S., Lee, M. J., Thangada, S., Hla, T. (2001) Sphingosine 1-phosphate-induced endothelial cell migration requires the expression of EDG-1 and EDG-3 receptors and Rho-dependent activation of alpha vbeta3- and beta1-containing integrins. J. Biol. Chem. 276,11830-11837[Abstract/Free Full Text]
  6. Albelda, S. M., Oliver, P. D., Romer, L. H., Buck, C. A. (1990) EndoCAM: a novel endothelial cell–cell adhesion molecule. J. Cell Biol. 110,1227-1237[Abstract/Free Full Text]
  7. Newman, P. J., Berndt, M. C., Gorski, J., White, G. C., II, Lyman, S., Paddock, C., Muller, W. A. (1990) PECAM-1 (CD31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily. Science 247,1219-1222[Abstract/Free Full Text]
  8. Lu, T. T., Barreuther, M., Davis, S., Madri, J. A. (1997) Platelet endothelial cell adhesion molecule-1 is phosphorylatable by c-Src, binds Src-Src homology 2 domain, and exhibits immunoreceptor tyrosine-based activation motif-like properties. J. Biol. Chem. 272,14442-14446[Abstract/Free Full Text]
  9. Jackson, D. E., Ward, C. M., Wang, R., Newman, P. J. (1997) The protein-tyrosine phosphatase SHP-2 binds platelet/endothelial cell adhesion molecule-1 (PECAM-1) and forms a distinct signaling complex during platelet aggregation. Evidence for a mechanistic link between PECAM-1- and integrin-mediated cellular signaling. J. Biol. Chem. 272,6986-6993[Abstract/Free Full Text]
  10. Duncan, G. S., Andrew, D. P., Takimoto, H., Kaufman, S. A., Yoshida, H., Spellberg, J., Luis de la Pompa, J., Elia, A., Wakeham, A., Karan-Tamir, B., Muller, W. A., Senaldi, G., Zukowski, M. M., Mak, T. W. (1999) Genetic evidence for functional redundancy of platelet/endothelial cell adhesion molecule-1 (PECAM-1): CD31-deficient mice reveal PECAM-1-dependent and PECAM-1-independent functions. J. Immunol. 162,3022-3030[Abstract/Free Full Text]
  11. Solowiej, A., Biswas, P., Graesser, D., Madri, J. A. (2003) Lack of PECAM-1 attenuates foreign body inflammation due to decreased angiogenesis. Am. J. Pathol. 162,953-962[Abstract/Free Full Text]
  12. Bernanke, D. H., Markwald, R. R. (1982) Migratory behavior of cardiac cushion tissue cells in a collagen-lattice culture system. Dev. Biol. 91,235-245[CrossRef][Medline]
  13. Enciso, J. M., Gratzinger, D., Camenisch, T. D., Davis, S., Pinter, E., Madri, J. A. (2003) Elevated glucose inhibits VEGF-A-mediated endocardial cushion formation: modulation by PECAM-1 and MMP-2. J. Cell Biol. 160,605-615[Abstract/Free Full Text]
  14. Yano, Y., Saito, Y., Narumiya, S., Sumpio, B. E. (1996) Involvement of rho p21 in cyclic strain-induced tyrosine phosphorylation of focal adhesion kinase (pp125FAK), morphological changes and migration of endothelial cells. Biochem. Biophys. Res. Commun. 224,508-515[CrossRef][Medline]
  15. Aepfelbacher, M., Essler, M., Huber, E., Sugai, M., Weber, P. C. (1997) Bacterial toxins block endothelial wound repair. Evidence that Rho GTPases control cytoskeletal rearrangements in migrating endothelial cells. Arterioscler. Thromb. Vasc. Biol. 17,1623-1629[Abstract/Free Full Text]
  16. Uchida, S., Watanabe, G., Shimada, Y., Maeda, M., Kawabe, A., Mori, A., Arii, S., Uehata, M., Kishimoto, T., Oikawa, T., et al (2000) The suppression of small GTPase rho signal transduction pathway inhibits angiogenesis in vitro and in vivo. Biochem. Biophys. Res. Commun. 269,633-640[CrossRef][Medline]
  17. van Nieuw Amerongen, G. P., van Hinsbergh, V. W. (2001) Cytoskeletal effects of rho-like small guanine nucleotide-binding proteins in the vascular system. Arterioscler. Thromb. Vasc. Biol. 21,300-311[Abstract/Free Full Text]
  18. Nobes, C. D., Hall, A. (1999) Rho GTPases control polarity, protrusion, and adhesion during cell movement. J. Cell Biol. 144,1235-1244[Abstract/Free Full Text]
  19. Rottner, K., Hall, A., Small, J. V. (1999) Interplay between Rac and Rho in the control of substrate contact dynamics. Curr. Biol. 9,640-648[CrossRef][Medline]
  20. Lee, M. J., Thangada, S., Claffey, K. P., Ancellin, N., Liu, C. H., Kluk, M., Volpi, M., Sha'afi, R. I., Hla, T. (1999) Vascular endothelial cell adherens junction assembly and morphogenesis induced by sphingosine-1-phosphate. Cell 99,301-312[CrossRef][Medline]
  21. English, D., Welch, Z., Kovala, A. T., Harvey, K., Volpert, O. V., Brindley, D. N., Garcia, J. G. (2000) Sphingosine 1-phosphate released from platelets during clotting accounts for the potent endothelial cell chemotactic activity of blood serum and provides a novel link between hemostasis and angiogenesis. FASEB J 14,2255-2265[Abstract/Free Full Text]
  22. Rosenfeldt, H. M., Hobson, J. P., Maceyka, M., Olivera, A., Nava, V. E., Milstien, S., Spiegel, S. (2001) EDG-1 links the PDGF receptor to Src and focal adhesion kinase activation leading to lamellipodia formation and cell migration. FASEB J 15,2649-2659[Abstract/Free Full Text]
  23. Buhl, A. M., Johnson, N. L., Dhanasekaran, N., Johnson, G. L. (1995) G alpha 12 and G alpha 13 stimulate Rho-dependent stress fiber formation and focal adhesion assembly. J. Biol. Chem. 270,24631-24634[Abstract/Free Full Text]
  24. Offermanns, S., Mancino, V., Revel, J. P., Simon, M. I. (1997) Vascular system defects and impaired cell chemokinesis as a result of Galpha13 deficiency. Science 275,533-536[Abstract/Free Full Text]
  25. Galbiati, F., Razani, B., Lisanti, M. P. (2001) Emerging themes in lipid rafts and caveolae. Cell 106,403-411[CrossRef][Medline]
  26. Gomez-Mouton, C., Abad, J. L., Mira, E., Lacalle, R. A., Gallardo, E., Jimenez-Baranda, S., Illa, I., Bernad, A., Manes, S., Martinez, A. C. (2001) Segregation of leading-edge and uropod components into specific lipid rafts during T cell polarization. Proc. Natl. Acad. Sci. USA 98,9642-9647[Abstract/Free Full Text]
  27. Lisanti, M. P., Scherer, P. E., Vidugiriene, J., Tang, Z., Hermanowski-Vosatka, A., Tu, Y. H., Cook, R. F., Sargiacomo, M. (1994) Characterization of caveolin-rich membrane domains isolated from an endothelial-rich source: implications for human disease. J. Cell Biol. 126,111-126[Abstract/Free Full Text]
  28. Bar-Sagi, D. (2001) A Ras by any other name. Mol. Cell. Biol. 21,1441-1443[Free Full Text]
  29. Galbiati, F., Volonte, D., Brown, A. M., Weinstein, D. E., Ben-Ze'ev, A., Pestell, R. G., Lisanti, M. P. (2000) Caveolin-1 expression inhibits Wnt/beta-catenin/Lef-1 signaling by recruiting beta-catenin to caveolae membrane domains. J. Biol. Chem. 275,23368-23377[Abstract/Free Full Text]
  30. Nusrat, A., Parkos, C. A., Verkade, P., Foley, C. S., Liang, T. W., Innis-Whitehouse, W., Eastburn, K. K., Madera, J. L. (2000) Tight junctions are membrane microdomains. J. Cell Sci. 113,1771-1781[Abstract]
  31. Schubert, A. L., Schubert, W., Spray, D. C., Lisanti, M. P. (2002) Connexin family members target to lipid raft domains and interact with caveolin-1. Biochemistry 41,5754-5764[CrossRef][Medline]
  32. Kurz, H., Gartner, T., Eggli, P. S., Christ, B. (1996) First blood vessels in the avian neural tube are formed by a combination of dorsal angioblast immigration and ventral sprouting of endothelial cells. Dev. Biol. 173,133-147[CrossRef][Medline]
  33. Ausprunk, D. H., Folkman, J. (1977) Migration and proliferation of endothelial cells in preformed and newly formed blood vessels during tumor angiogenesis. Microvasc. Res. 14,53-65[CrossRef][Medline]
  34. Santiago, E. S., Lowe, H. C., Day, F. L., Chesterman, C. N., Khachigian, L. M. (1999) Early growth response factor-1 induction by injury is triggered by release and paracrine activation by fibroblast growth factor-2. Am. J. Pathol. 154,937-944[Abstract/Free Full Text]
  35. Pintucci, G., Moscatelli, D., Saponara, F., Biernacki, P. R., Baumann, F. G., Bizekis, C., Galloway, A. C., Basilico, C., Mignatti, P. (2002) Lack of ERK activation and cell migration in FGF-2-deficient endothelial cells. FASEB J 16,598-600[Free Full Text]
  36. Kim, S., Bell, K., Mousa, S. A., Varner, J. A. (2000) Regulation of angiogenesis in vivo by ligation of integrin alpha5beta1 with the central cell-binding domain of fibronectin. Am. J. Pathol. 156,1345-1362[Abstract/Free Full Text]
  37. Pinter, E., Barreuther, M., Lu, T., Imhof, B. A., Madri, J. A. (1997) Platelet-endothelial cell adhesion molecule-1 (PECAM-1/CD31) tyrosine phosphorylation state changes during vasculogenesis in the murine conceptus. Am. J. Pathol. 150,1523-1530[Abstract]
  38. Kim, C. S., Wang, T., Madri, J. A. (1998) Platelet endothelial cell adhesion molecule-1 expression modulates endothelial cell migration in vitro. Lab. Invest. 78,583-590[Medline]
  39. Ren, X. D., Schwartz, M. A. (2000) Determination of GTP loading on Rho. Methods Enzymol 325,264-272[Medline]
  40. Mettouchi, A., Klein, S., Guo, W., Lopez-Lago, M., Lemichez, E., Westwick, J. K., Giancotti, F. G. (2001) Integrin-specific activation of Rac controls progression through the G(1) phase of the cell cycle. Mol. Cell 8,115-127[CrossRef][Medline]
  41. Wong, C. W., Wiedle, G., Ballestrem, C., Wehrle-Haller, B., Etteldorf, S., Bruckner, M., Engelhardt, B., Gisler, R. H., Imhof, B. A. (2000) PECAM-1/CD31 trans-homophilic binding at the intercellular junctions is independent of its cytoplasmic domain; evidence for heterophilic interaction with integrin alphavbeta3 in Cis. Mol. Biol. Cell 11,3109-3121[Abstract/Free Full Text]
  42. Graesser, D., Solowiej, A., Bruckner, M., Osterweil, E., Juedes, A., Davis, S., Ruddle, N. H., Engelhardt, B., Madri, J. A. (2002) Altered vascular permeability and early onset of experimental autoimmune encephalomyelitis in PECAM-1-deficient mice. J. Clin. Invest. 109,383-392[CrossRef][Medline]
  43. Madri, J. A., Pratt, B. M., Yannariello-Brown, J. (1988) Matrix-driven cell size change modulates aortic endothelial cell proliferation and sheet migration. Am. J. Pathol. 132,18-27[Abstract]
  44. Yatomi, Y., Igarashi, Y., Yang, L., Hisano, N., Qi, R., Asazuma, N., Satoh, K., Ozaki, Y., Kume, S. (1997) Sphingosine 1-phosphate, a bioactive sphingolipid abundantly stored in platelets, is a normal constituent of human plasma and serum. J. Biochem. (Tokyo) 121,969-973[Abstract/Free Full Text]
  45. Lee, M. J., Van Brocklyn, J. R., Thangada, S., Liu, C. H., Hand, A. R., Menzeleev, R., Spiegel, S., Hla, T. (1998) Sphingosine-1-phosphate as a ligand for the G protein-coupled receptor EDG-1. Science 279,1552-1555[Abstract/Free Full Text]
  46. Royal, I., Lamarche-Vane, N., Lamorte, L., Kaibuchi, K., Park, M. (2000) Activation of cdc42, rac, PAK, and rho-kinase in response to hepatocyte growth factor differentially regulates epithelial cell colony spreading and dissociation. Mol. Biol. Cell 11,1709-1725[Abstract/Free Full Text]
  47. Song, K. S., Li, S., Okamoto, T., Quilliam, L. A., Sargiacomo, M., Lisanti, M. P. (1996) Co-purification and direct interaction of Ras with caveolin, an integral membrane protein of caveolae microdomains. Detergent-free purification of caveolae microdomains. J. Biol. Chem. 271,9690-9697[Abstract/Free Full Text]
  48. Nakamura, K., Yano, H., Uchida, H., Hashimoto, S., Schaefer, E., Sabe, H. (2000) Tyrosine phosphorylation of paxillin alpha is involved in temporospatial regulation of paxillin-containing focal adhesion formation and F-actin organization in motile cells. J. Biol. Chem. 275,27155-27164[Abstract/Free Full Text]
  49. Cao, G., O'Brien, C. D., Zhou, Z., Sanders, S. M., Greenbaum, J. N., Makrigiannakis, A., DeLisser, H. M. (2002) Involvement of human PECAM-1 in angiogenesis and in vitro endothelial cell migration. Am. J. Physiol. 282,C1181-C1190
  50. Schimmenti, L. A., Yan, H. C., Madri, J. A., Albelda, S. M. (1992) Platelet endothelial cell adhesion molecule, PECAM-1, modulates cell migration. J. Cell. Physiol. 153,417-428[CrossRef][Medline]
  51. Sun, J., Williams, J., Yan, H. C., Amin, K. M., Albelda, S. M., DeLisser, H. M. (1996) Platelet endothelial cell adhesion molecule-1 (PECAM-1) homophilic adhesion is mediated by immunoglobulin-like domains 1 and 2 and depends on the cytoplasmic domain and the level of surface expression. J. Biol. Chem. 271,18561-18570[Abstract/Free Full Text]
  52. Chiba, R., Nakagawa, N., Kurasawa, K., Tanaka, Y., Saito, Y., Iwamoto, I. (1999) Ligation of CD31 (PECAM-1) on endothelial cells increases adhesive function of alphavbeta3 integrin and enhances beta1 integrin-mediated adhesion of eosinophils to endothelial cells. Blood 94,1319-1329[Abstract/Free Full Text]
  53. Osawa, M., Masuda, M., Harada, N., Lopes, R. B., Fujiwara, K. (1997) Tyrosine phosphorylation of platelet endothelial cell adhesion molecule-1 (PECAM-1, CD31) in mechanically stimulated vascular endothelial cells. Eur. J. Cell Biol. 72,229-237[Medline]
  54. Haskell, M. D., Nickles, A. L., Agati, J. M., Su, L., Dukes, B. D., Parsons, S. J. (2001) Phosphorylation of p190 on Tyr1105 by c-Src is necessary but not sufficient for EGF-induced actin disassembly in C3H10T1/2 fibroblasts. J. Cell Sci. 114,1699-1708[Abstract]
  55. Oh, P., Schnitzer, J. E. (2001) Segregation of heterotrimeric G proteins in cell surface microdomains. G(q) binds caveolin to concentrate in caveolae, whereas G(i) and G(s) target lipid rafts by default. Mol. Biol. Cell 12,685-698[Abstract/Free Full Text]
  56. Li, S., Okamoto, T., Chun, M., Sargiacomo, M., Casanova, J. E., Hansen, S. H., Nishimoto, I., Lisanti, M. P. (1995) Evidence for a regulated interaction between heterotrimeric G proteins and caveolin. J. Biol. Chem. 270,15693-15701[Abstract/Free Full Text]
  57. Murthy, K. S., Makhlouf, G. M. (2000) Heterologous desensitization mediated by G-protein-specific binding to caveolin. J. Biol. Chem. 275,30211-30219[Abstract/Free Full Text]
  58. Soga, N., Namba, N., McAllister, S., Cornelius, L., Teitelbaum, S. L., Dowdy, S. F., Kawamura, J., Hruska, K. A. (2001) Rho family GTPases regulate VEGF-stimulated endothelial cell motility. Exp. Cell Res. 269,73-87[CrossRef][Medline]
  59. Sander, E. E., ten Klooster, J. P., van Delft, S., van der Kammen, R. A., Collard, J. G. (1999) Rac downregulates Rho activity: reciprocal balance between both GTPases determines cellular morphology and migratory behavior. J. Cell Biol. 147,1009-1022[Abstract/Free Full Text]
  60. Lee, O. H., Kim, Y. M., Lee, Y. M., Moon, E. J., Lee, D. J., Kim, J. H., Kim, K. W., Kwon, Y. G. (1999) Sphingosine 1-phosphate induces angiogenesis: its angiogenic action and signaling mechanism in human umbilical vein endothelial cells. Biochem. Biophys. Res. Commun. 264,743-750[CrossRef][Medline]
  61. Endo, A., Nagashima, K., Kurose, H., Mochizuki, S., Matsuda, M., Mochizuki, N. (2002) Sphingosine 1-phosphate induces membrane ruffling and increases motility of human umbilical vein endothelial cells via vascular endothelial growth factor receptor and CrkII. J. Biol. Chem. 277,23747-23754[Abstract/Free Full Text]
  62. Eide, B. L., Turck, C. W., Escobedo, J. A. (1995) Identification of Tyr-397 as the primary site of tyrosine phosphorylation and pp60src association in the focal adhesion kinase, pp125FAK. Mol. Cell. Biol. 15,2819-2827[Abstract/Free Full Text]
  63. Arthur, W. T., Burridge, K. (2001) RhoA inactivation by p190RhoGAP regulates cell spreading and migration by promoting membrane protrusion and polarity. Mol. Biol. Cell 12,2711-2720[Abstract/Free Full Text]
  64. Inagaki, K., Yamao, T., Noguchi, T., Matozaki, T., Fukunaga, K., Takada, T., Hosooka, T., Akira, S., Kasuga, M. (2000) SHPS-1 regulates integrin-mediated cytoskeletal reorganization and cell motility. EMBO J 19,6721-6731[CrossRef][Medline]
  65. Salvucci, O., Yao, L., Villalba, S., Sajewicz, A., Pittaluga, S., Tosato, G. (2002) Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-‘. Blood 99,2703-2711[Abstract/Free Full Text]
  66. Belperio, J., Keane, M., Arenberg, D., Addison, C., Ehlert, J., Burdick, M., Strieter, R. (2000) CXC chemokines in angiogenesis. J. Leukoc. Biol. 68,1-8[Abstract/Free Full Text]
  67. Leurs, R., Smit, M. J., Timmerman, H. (1995) Molecular pharmacological aspects of histamine receptors. Pharmacol. Ther. 66,413-463[CrossRef][Medline]
  68. Wojciak-Stothard, B., Potempa, S., Eichholtz, T., Ridley, A. J. (2001) Rho and Rac but not Cdc42 regulate endothelial cell permeability. J. Cell Sci. 114,1343-1355[Abstract]
  69. Richard, D., Vouret-Craviari, V., Pouyssegur, J. (2001) Angiogenesis and G-protein-coupled receptors: signals that bridge the gap. Oncogene 20,1556-1562[CrossRef][Medline]
  70. Maragoudakis, M., Tsopanoglou, N., Andriopoulou, P. (2002) Mechanism of thrombin-induced angiogenesis. Biochem. Soc. Trans. 30,173-177[CrossRef][Medline]
  71. Essler, M., Amano, M., Kruse, H. J., Kaibuchi, K., Weber, P. C., Aepfelbacher, M. (1998) Thrombin inactivates myosin light chain phosphatase via Rho and its target Rho kinase in human endothelial cells. J. Biol. Chem. 273,21867-21874[Abstract/Free Full Text]
  72. Mahooti, S., Graesser, D., Patil, S., Newman, P., Duncan, G., Mak, T., Madri, J. A. (2000) PECAM-1 (CD31) expression modulates bleeding time in vivo. Am. J. Pathol. 157,75-81[Abstract/Free Full Text]
  73. Cotran, R. S., Kumar, V., Robbins, S. L. (1994) Pathologic Basis of Disease W. B. Saunders Philadelphia.



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
G. Cao, M. L. Fehrenbach, J. T. Williams, J. M. Finklestein, J.-X. Zhu, and H. M. DeLisser
Angiogenesis in Platelet Endothelial Cell Adhesion Molecule-1-Null Mice
Am. J. Pathol., August 1, 2009; 175(2): 903 - 915.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Wu, K. Tworkoski, M. Michaud, and J. A. Madri
Bone Marrow Monocyte PECAM-1 Deficiency Elicits Increased Osteoclastogenesis Resulting in Trabecular Bone Loss
J. Immunol., March 1, 2009; 182(5): 2672 - 2679.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Garnacho, V. Shuvaev, A. Thomas, L. McKenna, J. Sun, M. Koval, S. Albelda, V. Muzykantov, and S. Muro
RhoA activation and actin reorganization involved in endothelial CAM-mediated endocytosis of anti-PECAM carriers: critical role for tyrosine 686 in the cytoplasmic tail of PECAM-1
Blood, March 15, 2008; 111(6): 3024 - 3033.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. F. Vernon-Wilson, F. Aurade, L. Tian, I. C. M. Rowe, M. J. Shipston, J. Savill, and S. B. Brown
CD31 delays phagocyte membrane repolarization to promote efficient binding of apoptotic cells
J. Leukoc. Biol., November 1, 2007; 82(5): 1278 - 1288.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Kaneko-Tarui, L. Zhang, K. J Austin, L. E Henkes, J. Johnson, T. R Hansen, and J. K Pru
Maternal and Embryonic Control of Uterine Sphingolipid-Metabolizing Enzymes During Murine Embryo Implantation
Biol Reprod, October 1, 2007; 77(4): 658 - 665.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Wu, T. Welte, M. Michaud, and J. A. Madri
PECAM-1: a multifaceted regulator of megakaryocytopoiesis
Blood, August 1, 2007; 110(3): 851 - 859.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Kondo, E. A. Scheef, N. Sheibani, and C. M. Sorenson
PECAM-1 isoform-specific regulation of kidney endothelial cell migration and capillary morphogenesis
Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2070 - C2083.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. J. Newman
PECAMigration
Blood, May 15, 2007; 109(10): 4113 - 4114.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Viegas, N. Chaverot, H. Enslen, N. Perriere, P.-O. Couraud, and S. Cazaubon
Junctional expression of the prion protein PrPC by brain endothelial cells: a role in trans-endothelial migration of human monocytes
J. Cell Sci., November 15, 2006; 119(22): 4634 - 4643.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Mansouri, J. Douglas, P. P. Rose, K. Gouveia, G. Thomas, R. E. Means, A. V. Moses, and K. Fruh
Kaposi sarcoma herpesvirus K5 removes CD31/PECAM from endothelial cells
Blood, September 15, 2006; 108(6): 1932 - 1940.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Wang, Y. Gao, E. Scully, C. T. Davis, J. F. Anderson, T. Welte, M. Ledizet, R. Koski, J. A. Madri, A. Barrett, et al.
{gamma}{delta} T Cells Facilitate Adaptive Immunity against West Nile Virus Infection in Mice
J. Immunol., August 1, 2006; 177(3): 1825 - 1832.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Y. Kim, G. H. Liang, J. A. Kim, Y. J. Kim, S. Oh, and S. H. Suh
Sphingosine-1-phosphate activates BKCa channels independently of G protein-coupled receptor in human endothelial cells
Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1000 - C1008.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. M. DeLisser, B. P. Helmke, G. Cao, P. M. Egan, D. Taichman, M. Fehrenbach, A. Zaman, Z. Cui, G. S. Mohan, H. S. Baldwin, et al.
Loss of PECAM-1 Function Impairs Alveolarization
J. Biol. Chem., March 31, 2006; 281(13): 8724 - 8731.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Cernuda-Morollon and A. J. Ridley
Rho GTPases and Leukocyte Adhesion Receptor Expression and Function in Endothelial Cells
Circ. Res., March 31, 2006; 98(6): 757 - 767.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. C. Ford, J. P. Bertram, S. R. Hynes, M. Michaud, Q. Li, M. Young, S. S. Segal, J. A. Madri, and E. B. Lavik
Tissue Engineering Special Feature: A macroporous hydrogel for the coculture of neural progenitor and endothelial cells to form functional vascular networks in vivo
PNAS, February 21, 2006; 103(8): 2512 - 2517.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Fleming, B. Fisslthaler, M. Dixit, and R. Busse
Role of PECAM-1 in the shear-stress-induced activation of Akt and the endothelial nitric oxide synthase (eNOS) in endothelial cells
J. Cell Sci., September 15, 2005; 118(18): 4103 - 4111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Papanikolaou, A. Papafotika, C. Murphy, T. Papamarcaki, O. Tsolas, M. Drab, T. V. Kurzchalia, M. Kasper, and S. Christoforidis
Cholesterol-dependent Lipid Assemblies Regulate the Activity of the Ecto-nucleotidase CD39
J. Biol. Chem., July 15, 2005; 280(28): 26406 - 26414.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
V. Krump-Konvalinkova, S. Yasuda, T. Rubic, N. Makarova, J. Mages, W. Erl, C. Vosseler, C. J. Kirkpatrick, G. Tigyi, and W. Siess
Stable Knock-Down of the Sphingosine 1-Phosphate Receptor S1P1 Influences Multiple Functions of Human Endothelial Cells
Arterioscler Thromb Vasc Biol, March 1, 2005; 25(3): 546 - 552.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Carrithers, S. Tandon, S. Canosa, M. Michaud, D. Graesser, and J. A. Madri
Enhanced Susceptibility to Endotoxic Shock and Impaired STAT3 Signaling in CD31-Deficient Mice
Am. J. Pathol., January 1, 2005; 166(1): 185 - 196.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. D. O'Brien, G. Cao, A. Makrigiannakis, and H. M. DeLisser
Role of immunoreceptor tyrosine-based inhibitory motifs of PECAM-1 in PECAM-1-dependent cell migration
Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1103 - C1113.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GRATZINGER, D.
Right arrow Articles by MADRI, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GRATZINGER, D.
Right arrow Articles by MADRI, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS