FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by ERMAK, G.
Right arrow Articles by DAVIES, K. J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by ERMAK, G.
Right arrow Articles by DAVIES, K. J. A.
(The FASEB Journal. 2002;16:814-824.)
© 2002 FASEB

The DSCR1 (Adapt78) isoform 1 protein calcipressin 1 inhibits calcineurin and protects against acute calcium-mediated stress damage, including transient oxidative stress

GENNADY ERMAK, CATHRYN D. HARRIS and KELVIN J. A. DAVIES1

Ethel Percy Andrus Gerontology Center, and Division of Molecular and Computational Biology, University of Southern California, Los Angeles, California, USA

1Correspondence: Ethel Percy Andrus Gerontology Center, University of Southern California, 3715 McClintock Ave., Room 306, Los Angeles, CA 90089-0191, USA. E-mail: kelvin{at}usc.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although DSCR1 (Adapt78) has been associated with successful adaptation to oxidative stress and calcium stress and with devastating diseases such as Alzheimer’s and Down syndrome, no rationale for these apparently contradictory findings has been tested. In fact, DSCR1 (Adapt78) has not yet been proved to provide protection against acute oxidative stress or calcium stress. We have addressed this question using cross-adaptation to H2O2 and the calcium ionophore A23187, stable DSCR1 (Adapt78) transfection and overexpression in hamster HA-1 cells, ‘tet-off’ regulated DSCR1 (Adapt78) isoform 1 transgene expression in human PC-12 cells, and DSCR1 (Adapt78) antisense oligonucleotides to test the ability of the DSCR1 (Adapt78) protein product calcipressin 1 (a calcineurin inhibitor) to protect against oxidative stress and calcium stress. Under all conditions, resistance to oxidative stress and calcium stress increased as a function of DSCR1 (Adapt78)/calcipressin 1 expression and decreased as gene/protein expression diminished. We conclude that cells may transiently use increased expression of the DSCR1 (Adapt78) gene product calcipressin 1 to provide short-term protection against acute oxidative stress and other calcium-mediated stresses, whereas chronic overexpression may be associated with Alzheimer disease progression.—Ermak, G., Harris, C. D., Davies, K. J. A. The DSCR1 (Adapt78) isoform 1 protein calcipressin 1 inhibits calcineurin and protects against acute calcium-mediated stress damage, including transient oxidative stress.


Key Words: calcium signaling • apoptosis • stress proteins and genes


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ADAPT78WAS ISOLATEDin our laboratory from the hamster genome as a gene induced during transient adaptation to oxidative stress (1 , 2) . DSCR1 (Down syndrome candidate region 1) was isolated independently from the candidate region of human chromosome 21, trisomy of which causes Down syndrome, by Fuentes et al. (3 , 4) . It soon became clear that Adapt78 and DSCR1 are the same gene, hence our use of the combined name DSCR1 (Adapt78). We recently showed that chronic overexpression of DSCR1 (Adapt78) is associated with Alzheimer disease (5) . It has now been demonstrated that DSCR1 (Adapt78) belongs to a new family of genes that bind and inhibit calcineurin (6 , 7) . The name calcipressin 1 has been suggested for the calcineurin inhibitory DSCR1 (Adapt78) protein product (6) .

Calcineurin is a calcium/calmodulin-activated serine/threonine phosphatase (PP2B) that is an important enzyme in Ca2+-dependent eukaryotic signal transduction pathways (8) . DSCR1 induction during adaptation to oxidative stress is also a calcium-dependent process (1 , 2) . Calcineurin plays important roles in immune stimulation, and calcineurin-dependent signal transduction pathways have been extensively characterized during T cell activation (9) . Calcineurin transduction pathways are well characterized in yeast, where the protein promotes growth in high calcium environments by dephosphorylation of the Tcn1p transcription factor (10 11 12) . Calcineurin plays a critical role in cellular responses to various extracellular signals and environmental stresses and is important in the regulation of apoptosis (13 14 15 16 17) , memory processes (18 19 20) , and skeletal and cardiac muscle growth and differentiation (21 , 22) . In plants, calcineurin mediates salt adaptation (23) . Since the DSCR1 (Adapt78) protein calcipressin 1 can regulate calcineurin activity, it is likely to be involved in many of the above processes. For example, excessive activity of calcineurin causes cardiac hypertrophy, which can be prevented by addition of exogenous calcineurin inhibitors (24 , 25) or overexpression of DSCR1 (Adapt78) (26) .

The DSCR1 (Adapt78) gene consist of seven exons, four of which (exons 1–4) can be alternatively spliced to produce number of different mRNA isoforms; Fig. 1 A. Since exons 5–7 are likely to be common in each mRNA isoform, for nomenclature simplification we propose to assign them numbers as shown in Fig. 1B . These isoforms may have different expression patterns, functions, and regulation mechanisms. For example, expression of exon 2 was detected in fetal, but not adult, human brain (4) and calcineurin can induce expression of DSCR1 (Adapt78) isoform 4 mRNA, but does not induce the other isoforms (27) .



View larger version (28K):
[in this window]
[in a new window]
  		Figure 1. The human DSCR1 (Adapt78) gene and suggested nomenclature for mRNA isoforms. A) Schematic diagram of genomic DNA. Exons 1 through 4 can be included in the mRNA transcript in various combinations (alternative splicing). UTR: predicted untranslated region; aataaa: Possible polyadenylation signal. Positions of the primers used in PCRs are marked by arrows. B) Suggested nomenclature for the 13 (theoretically) possible DSCR1 (Adapt78) isoforms. C) Sequence of exon 1 of the DSCR1 (Adapt78) gene. Corrected DNA sequence (GenBank accession number AF303449) corresponding to DSCR1 (Adapt78) 42–43 bp is underlined.

Although we originally discovered DSCR1 (Adapt78) as a gene associated with transient adaptation to oxidative stress and calcium stress and we hypothesized that its overexpression might help protect cells against such stress (1 , 2) , no one has actually tested whether DSCR1 (Adapt78) can provide stress protection. Indeed, much of the work on this gene has associated its expression with Down syndrome (3 , 4 , 6) and Alzheimer disease (5) . We hypothesized that although chronic overexpression of DSCR1 (Adapt78) is associated with these serious diseases, acute overexpression may transiently protect against calcium-mediated stresses. To directly test this hypothesis, we constructed permanent DSCR1 (Adapt78) overexpressing cells and cells in which DSCR1 (Adapt78) transcription was regulated by a ‘tet off’ expression system. We further regulated DSCR1 (Adapt78) levels with antisense oligonucleotides and tested oxidative stress resistance and calcium stress resistance under all conditions.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials
All chemicals and supplies were obtained from Sigma (St. Louis, MO) unless otherwise stated.

Stable transfection of DSCR1 (Adapt78) in HA-1 cells
Hamster HA-1 cells were cultivated as described previously (2 , 28 , 29) . The pcDNA3.1 expression vector (Invitrogen, San Diego, CA) was used to stably transfect HA-1 cells with full-length hamster Adapt78 cDNA (and vector-only controls) (30) .

Doxycycline-regulated DSCR1 (Adapt78) expression system
DSCR1 isoform 1 fragment, produced by long and accurate (LA) RT-PCR as described below, was inserted into a pTRE vector (Clontech Laboratories, Palo Alto, CA). PC-12 tet-off cells from Clontech stably transfected with ‘regulator plasmid’ were next transfected with the pTRE carrying DSCR1 (Adapt78) fragment to produce a double-stable cell line in which the DSCR1 (Adapt78) transgene could be turned off by doxycycline. All procedures were performed as described in the tet-off gene expression user manual from Clontech.

PC-12 cell culture
PC-12 cells were cultivated in media containing 85% DMEM, 10% horse serum, 5% antibiotic free fetal bovine serum (Clontech), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. PC-12 tet-off cells stably transfected with regulator plasmid were maintained in media containing 50 µg/ml G418. The double-stable cell line carrying the regulator plasmid and the DSCR1 (Adapt78) transgene was maintained in media containing 50 µg/ml G418 and 50 µg/ml hygromycin. Cells were cultivated in a humidified 10% CO2 atmosphere at 37°C. The DSCR1 (Adapt78) transgene was turned off by application of 0.1 µg/ml doxycycline to the media.

Oligonucleotides and their delivery
To further down-regulate DSCR1 (Adapt78), we used an antisense morpholino oligonucleotide against DSCR1 (Adapt78) synthesized for us by GeneTools, LLC. This oligonucleotide (CATCTCGCAGTCAATGAAGCTCCAG) was complementary to bases 3–21 of DSCR1 (Adapt78) exon 1, including the AUG translation start site. Standard oligonucleotides designed and tested by GeneTools, LLC were used as a negative control. A standard (control) oligonucleotide was specifically designed to overcome nonspecific effects that can occur using sense, mismatch or scrambled oligonucleotides as controls. This 25-mer standard oligonucleotide has the following sequence: 5'-CCTCTTACCTCAGTTACAATTTATA-3';it has been demonstrated to have no target or significant biological activity (see www.gene-tools.com). Delivery of the oligonucleotides into the cells was performed by scraping, following the GeneTools, LLC protocol.

Library screening
Human brain, substantia nigra 5' stretch + cDNA library was purchased from Clontech. This library represents 0.6–4.5 kb cDNA fragments cloned into a {lambda}gt11 phage. The cDNA library was titrated and diluted, plaques were grown, transferred onto membranes, and fixed following the manufacturer’s protocol. To detect plaques carrying DNA fragments homologous to the human DSCR1 (Adapt78) gene, the membranes were hybridized using a hamster Adapt78 fragment (1) . Recombinant phage DNA was isolated from the positive plaques and human cDNA inserts were amplified using LA PCR (Tamara Shuzo Co., Ltd., Otsu, Japan). About 80 ng of recombinant phage DNA was amplified for 30 cycles at 68°C for 20 s, followed by 98°C for 3 min. The sequence of the forward primer was 5'-GAAGGCACATGGCTGAATATCGACGGTTTC-3'; that of the reverse primer was 5'-GACACCAGACCAACTGGTAATGGTAGCGAC-3'. Both fragments were verified by sequencing.

RNA isolation
Total RNA was extracted using the TRIzol reagent (Life Technologies, Gaithersburg, MD). RNA concentration was quantified spectrophotometrically and relative content was further confirmed on ethidium bromide-stained gels. Integrity of the RNA was estimated by agarose gel electrophoresis; only RNA samples displaying discrete 28S and 18S RNA bands were used in experiments.

LA RT-PCR
The synthesis of first-strand cDNA was performed using the SuperScript preamplification system from Life Technologies. 1–3 µg of total RNA per reaction was reverse transcribed using oligo(dT) as the primer. About 2 µl of 20 µl of the total volume of the cDNA was used per each PCR reaction. LA RT-PCR was performed using kit from Tamara Shuzo. Primers were the following: 1) human DSCR1 (Adapt78) mRNA isoform 1 consisting of exons 1, 5, 6, and 7 (see Fig. 1 for suggested isoform nomenclature); the forward primer was 5'-GACTGGAGCTTCATTGACTGCGAGA-3', corresponding to bases 1–25 of exon 1; and the reverse primer was 5'-ACCACGCTGGGAGTGGTGTCAGTCG-3', corresponding to bases 1–25 of exon 7; 2) human DSCR1 (Adapt78) mRNA isoform 4, consisting of exons 4- 7; the forward primer was 5'-AAGGAACCTACAGCCTCTTGGAAAG-3', corresponding to bases 1–25 of exon 4; and the reverse primer was the same one used to amplify isoform 1; 3) human glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers and conditions were as described previously (31) .

All DNA fragments produced by LA RT-PCR were verified by sequencing, using an ABI Prism 377 DNA sequencer (Perkin-Elmer) in our core facility.

Northern hybridization
Samples containing 10 µg of total RNA were subjected to electrophoresis through 1% agarose formaldehyde gels, blotted to nylon membranes (Oncor) with HETS (CINNA/BIOTECX), and cross-linked by ultraviolet radiation. The membranes were prehybridized for 4 h and hybridized for 15 h in Hybrizol I (Oncor) at 42°C. They were washed with 2xSSC + 0.1% SDS at room temperature for 1 and 10 min, then with 0.1xSSC + 0.1% SDS at 60°C for 10 and 30 min. The membranes were exposed, developed, and scanned using the PhosphorImager system (Molecular Dynamics, Sunnyvale, CA). To rehybridize RNA blots, probes were removed by washing the membranes in a solution of 0.1xSSC, 0.1% SDS, and 10 mM Tris-HCl (pH 7.0) at 90°C for 10 min. To quantify levels of DSCR1 mRNA, the membranes were scanned and the hybridization signal measured using ImageQuant software (Molecular Dynamics). Each signal was recalculated according to the amount of RNA actually loaded on the gels. The amount of the loaded RNA was controlled using hybridization with a GAPDH probe. Probes containing [{alpha}-32P]dCTP labeled DNA were prepared using the High Prime system (Boehringer Mannheim, Mannheim, Germany). A PCR fragment corresponding to DSCR1 (Adapt78) isoform 1 was used to prepare the DSCR1 (Adapt78) probe and a PCR fragment consisting of GAPDH exons 7 and 8 was used to prepare GAPDH probes (see above).

DSCR1 (Adapt78) antibody and Western blot analysis
Using the predicted open reading frame sequence of DSCR1 (Adapt78), we designed a carboxyl-terminal 16 amino acid peptide that was used as an antigen to immunize rabbits. We added a cysteine to the NH2 terminus of this peptide (KIIQTRRPEYTPIHLS) and conjugated the peptide to keyhole limpet hemocyanin. Polyclonal antibodies were raised commercially (ProSci) by injection of this complex into rabbits. Serum from one of the immunized rabbits was affinity purified on a column with the covalently attached DSCR1 (Adapt78) peptide that was used for immunization. Western blot analysis was performed, following the protocol from ProSci, using an ECL detection system from Amersham (Arlington Heights, IL). Final dilution of the purified peptide in Western blot analysis was 1:500.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
At least two distinct DSCR1 (Adapt78) mRNA isoforms are expressed in human brain
The DSCR1 (Adapt78) gene consist of 7 exons, four of which (exons 1–4) undergo alternative splicing (Fig. 1A ). We previously found significant DSCR1 (Adapt78) expression in several brain areas, particularly in neurons (5) , and showed that DSCR1 is overexpressed in Alzheimer’s disease and Down syndrome (5) . It was therefore of great interest to determine the expression of different DSCR1 isoforms in human brain.

We analyzed the expression of various DSCR1 (Adapt78) mRNA isoforms using RT-PCR. Total RNA isolated from different regions of the adult human brain (cerebral cortex, hippocampus, cerebellum, substantia nigra) was analyzed. cDNA was amplified using Ex Tag formulation (Tamara Shuzo Co.) following the manufacturer’s protocol. No amplification products spanning exons 2–7 or exons 3–7 were detected in any tissues studied, but fragments spanning exons 1–7 and exons 4–7 were found in all samples (Fig. 2 ). The amplified fragments were directly sequenced using an ABI automated sequencing system. Sequence analysis revealed that fragments amplified with primers to exons 1 and 7 consisted of exon 1 joined to exons 5–7 (isoform 1), and the fragments amplified with primers to exons 4 and 7 consisted of exons 4–7 (isoform 4).



View larger version (32K):
[in this window]
[in a new window]
  		Figure 2. Expression of DSCR1 (Adapt78) mRNA isoforms 1 and 4 in various regions of normal adult human brain. A) Example of an LA RT-PCR agarose gel analyzing the levels of DSCR1 (Adapt78) isoforms 1 and 4 in various regions of human brain postmortem tissue. A10, Cerebral cortex area;A22, cerebral cortex area; Cb, cerebellum; Hc, hippocampus. RNA was amplified using LA RT-PCR for 30 cycles: 98°C for 20 s followed by 68°C for 3 min. Equal amounts of cDNA from each sample were used to amplify both isoforms. The amount of input cDNA in each sample was equalized by amplification of the GAPDH gene (not shown). We previously analyzed multiple brain samples and found that GAPDH displays equal signals when RNA samples are evenly loaded in gel electrophoresis (5) , showing that GAPDH can be used as a loading control. To ensure that GAPDH amplification was quantitative, we ran serially diluted cDNA samples for different numbers of cycles. It typically took ~25 cycles to achieve a linear dependency between the amount of input DNA and the resulting PCR products. Equal amounts of the cDNA (according to amplification of control GAPDH fragment) were used to estimate the amount of adapt78 mRNA isoforms 1 and 4. Similar to GAPDH amplification, serially diluted cDNA samples were run for different numbers of cycles to find conditions in which the amount of amplified fragments was proportional to the amount of the input cDNA in the reactions. B) Summarized comparison of isoforms 1 and 4 production in 8 different human brain samples, analyzed by LA RT-PCR as in panel A. Postmortem human brain samples were obtained (with permission) from patients who died from causes other than neurological diseases or brain trauma. Material was combined from the following brain areas: A10 cerebral cortex area, A22 cerebral cortex area, cerebellum, and hippocampus. Agarose gel pictures were scanned and the signals were quantified using IPLab software. Results are means and SE of three independent determinations, expressed as arbitrary absorbance units (A.U.). The average level of isoform 1 production was ~2.3-fold higher than that of isoform 4 (P<0.005).

Expression of isoform 1 was confirmed by screening a cDNA library from the substantia nigra of human brain (Clontech). The library was screened following the manufacturer’s protocols using the hamster DSCR1 (Adapt78) sequence as a probe. Of >150,000 plaques, we isolated 5 that had strong hybridization signals. Recombinant phage DNA was isolated from these plaques and analyzed. Restriction and hybridization analysis revealed that the phages all carried human DNA inserts of ~1800 bp. These inserts were directly sequenced using an ABI automated sequencing system. The inserts were computer analyzed using the Omiga 1.0.1 program (Oxford Molecular Group, Campbell, CA) and all appeared to contain identical sequences. Sequencing of all five inserts and several PCR fragments (described above) produced the same results but revealed two substitutions at bases 42–43 of the published (4) sequence of human DSCR1 (Adapt78) exon 1 (Fig. 1C ).

Taking these data together, we conclude that at least two distinct DSCR1 (Adapt78) mRNA isoforms are produced in human brain: isoforms 1 and 4. Our studies indicate that DSCR1 (Adapt78) mRNA isoform 1 is the predominant form expressed in most brain areas (Fig. 2) . As estimated using the semiquantitative RT-PCR technique, the level of isoform 1 in brain is about double that of isoform 4.

Stress-adapted hamster HA-1 cells and cells stably transfected with hamster Adapt78 (DSCR1) resist oxidant stress and calcium stress
We next wanted to resolve an important apparent contradiction. We originally discovered hamster Adapt78 as one of several genes induced in HA-1 cells during transient adaptation to oxidative stress (1 , 2) . It immediately became clear, however, that hamster Adapt78 and human DSCR1 were the same gene and that human DSCR1 was associated with Down syndrome (3 , 4) . Our own recent work now associates DSCR1 (Adapt78) with Alzheimer’s disease (5) . Thus, it is not clear whether DSCR1 (Adapt78) is a helpful gene during stress adaptation or a damaging one that leads to neurological disorders. Since we had only shown that DSCR1 (Adapt78) is associated with transient adaptation to hydrogen peroxide and is directly inducible by calcium ionophores (1 , 2) , we wanted to test whether the gene could actually provide resistance to these stresses. It seemed sensible to begin such work in hamster HA-1 cells where we originally found Adapt78.

As a first step, we transiently adapted HA-1 cells to hydrogen peroxide, as described previously (1 , 28) , or to the calcium ionophore A23187 and tested for Adapt78 (DSCR1) induction and for induced resistance to both stresses (Fig. 3 A). Hydrogen peroxide and A23187 adaptation both caused 8- to 12-fold increases in the steady-state levels of Adapt78 mRNA (not shown); each treatment provided strong protection against subsequent challenge with the same agent and significant cross-protection (Fig. 3A ).



View larger version (49K):
[in this window]
[in a new window]
  		Figure 3. Stress-adapted hamster HA-1 cells and cells stably transfected with hamster Adapt78 (DSCR1) resist oxidant stress and calcium stress. A) Stress resistance in stress-adapted cells. HA-1 cells were used without pretreatment or adapted to an 18 h pretreatment of either H2O2 at 4.15 µmol/107 cells [exactly as per Wiese et al. (28) ] or A23187 at 1.5 µg/ml. After transient adaptation, all cells were grown to 75% confluence and exposed to challenge concentrations of H2O2 (9.69 µmol/107 cells) or A23187 (4.5 µg/ml). Colony-forming ability was measured in a 7 day fix and stain technique (1 , 2 , 28) and is expressed as % of colonies formed by control cells never treated with H2O2 or A23187; values are means and SE of five independent determinations. B) Stress resistance after stable transfection with DSCR1 (Adapt78), HA-1 cells were either wild-type or stably transfected with full-length hamster Adapt78 cDNA or with the pcDNA3.1 expression vector (Invitrogen) alone, as described in Materials and Methods. The plating efficiencies and doubling times of the parent HA-1 cells and of HA-1 cells stably transfected with the Adapt78(DSCR1) gene or the expression vector alone were not significantly different. All cells were grown to 75% confluence and exposed to mild challenge concentrations of H2O2 of 6.5 µmol/107 cells (in contrast to 9.69 µmol H2O2/107 cells used in panel A) or mild challenge concentrations of A23187 of 2.7 µg/ml (in contrast with 4.5 µg/ml A23187 used in Fig. 3A ). Colony-forming ability was measured in a 7 day fix and stain technique, as above, and is expressed as % of colonies formed by control cells never treated with H2O2 or A23187; values are means and SE of four independent determinations.

We then stably transfected HA-1 cells with full-length Adapt78 (DSCR1) cDNA and tested transcription, translation, and protection against oxidative stress and calcium stress. Some eight successfully transfected HA-1 clones were obtained, which expressed Adapt78 (DSCR1) mRNA at levels between three- and fivefold higher than parent cells. The overexpressing clones synthesized an ~25 kDa protein (calcipressin 1) at significantly higher levels than did the parent cells. We tested three of the Adapt78 (DSCR1) stably transfected clones for calcipressin 1 expression, hydrogen peroxide resistance, and A23187 (calcium ionophore) resistance and obtained essentially identical results; clone 6 results are shown in Fig. 3B . Levels of the 25 kDa protein (calcipressin1) were 3.7 ± 0.3-fold higher in the Adapt78(DSCR1) transfected clone 6 cells than in controls. This difference was statistically significant at the P 0.05 level by the 1-tailed Student’s t test.

The stress levels used in Fig. 3B were lower than those used in Fig. 3A . In Fig. 3A , we adapted cells to H2O2 or calcium ionophore A23187 and tested cross-resistance using strong stress challenge levels. The adaptation was performed as described in ref 28 , in which we observed overexpression of >35 proteins. Subsequent studies with this same model have confirmed the induction of many previously known genes as well as several novel stress genes (1 , 2 , 29 , 35 36 37 38 39 40) . With this in mind, it seemed unlikely that stable overexpression of only the Adapt78(DSCR1) gene could provide as much protection as the 35 or more gene products expressed in a full adaptive response. We therefore lowered the amount of hydrogen peroxide and A23187 used to stress the cells in the experiments of Fig. 3B . When parent HA-1 cells or cells transfected only with the pcDNA3.1 vector were exposed to mild hydrogen peroxide or A23187 challenge, colony-forming ability was reduced to 10–22% of control untreated (100%) values. In contrast, the stably Adapt78 (DSCR1) transfected clone 6 HA-1 cells exhibited colony-forming abilities that were ~60% of control values (Fig. 3B ), suggesting that Adapt78 (DSCR1) may indeed be able to partially protect against an acute stress.

We measured catalase activity in the stably Adapt78 (DSCR1) transfected clone 6 HA-1 cells and found it unchanged from parental HA-1 cell levels. We have also shown that adaptation to oxidative stress involving significant Adapt78 (DSCR1) overexpression does not elevate either catalase, glutathione peroxidase, glutathione transferase, or glutathione levels, nor does it increase overall cellular peroxide consuming capacity (28 , 35 36 37 38 39 40) . We recently tested the effects of transient overexpression of Adapt78(DSCR1) using the tet-off system (Fig. 4 through Fig. 7 ) and found no induction of catalase, glutathione peroxidase, glutathione transferase, or glutathione whatsoever (G. Ermak and K. J. A. Davies, unpublished observations).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 4. Regulated expression of DSCR1 (Adapt78) mRNA isoform 1 and of the DSCR1 (Adapt78) protein calcipressin 1 by the tet-off gene expression system and antisense oligonucleotides in PC-12 cells. A) Northern blot showing induction of DSCR1 (Adapt78) mRNA by doxycycline withdrawal. Tet-off PC-12 cells carrying the DSCR1 (Adapt78) transgene were continuously grown in media containing doxycycline and inducible DSCR1 (Adapt78) expression was achieved by doxycycline withdrawal from the media for 0, 48, 96, or 144 h. RNA loading was controlled by hybridization to a GAPDH probe. B) Northern blot showing repression of the DSCR1 (Adapt78) mRNA by doxycycline. Cells were grown in medium without doxycycline for 144 h to overexpress DSCR1 (Adapt78). To repress DSCR1 (Adapt78), doxycycline was next applied for 0, 6, 24, or 48 h. RNA loading was controlled as, above, by hybridization to a GAPDH probe. C) Representative Western blot showing regulated expression of the DSCR1 (Adapt78) protein calcipressin 1 in DSCR1 (Adapt78) transgenic PC-12 cells and wild-type cells. Cells were grown in media without doxycycline for 144 h to overexpress DSCR1 (Adapt78). The cells were split, subjected to various treatments, and grown for another 48 h. The treatments used were as follows: Dox- cells were grown in media without doxycycline so that DSCR1 (Adapt78) was overexpressed; Dox+cells were grown in media with doxycycline so that the DSCR1 (Adapt78) transgene was down-regulated); Dox+ and antisense cells were grown in media with doxycycline and DSCR1 (Adapt78) was down-regulated by antisense oligonucleotides; Dox+ and standard oligonucleotides additional control sample in which cells were grown in media with doxycycline and treated with standard (control) oligonucleotides. Protein loading and transfer was monitored by staining the membranes with Ponceau S Red before staining with antibodies. D) Summary of regulated calcipressin 1 expression in transgenic cells. X-ray films were quantified using IPLab software (Scanalytics) in comparison with standards. Calcipressin 1 levels are expressed in arbitrary units (A.U.). All conditions and axis labels were as described in panel C, but results represent the means and SE of three independent determinations.



View larger version (77K):
[in this window]
[in a new window]
  		Figure 7. Protective effect of DSCR1 (Adapt78) overexpression against cytotoxicity due to elevated calcium levels in PC-12 cells. A) Untreated control cells. Cells were grown in regular media (see Materials and Methods). Using trypan blue staining, we estimated cell survival at 97.2% ± 0.5%. B) Calcium-stressed control cells. Cells in which the DSCR1 (Adapt78) transgene was down-regulated by doxycycline (see Fig. 5 ) were exposed to 1.25 µg/ml calcium ionophore A23187 for 48 h. No live cells were observed in these samples. C) Calcium-stressed DSCR1 (Adapt78) overexpressing cells. Cells in which the DSCR1 transgene was overexpressed by doxycycline withdrawal for 144 h (see Fig. 5 ) were exposed to 1.25 µg/ml calcium ionophore A23187 for 48 h. Trypan blue staining revealed a survival of ~4.67 ± 0.3%. Examples of live cell cells are marked by white arrows and examples of dead cells are marked by black arrows.

Regulated transgenic expression of DSCR1 (Adapt78) isoform 1 in human PC-12 cells
Although the results of Fig. 3 are consistent with our hypothesis that DSCR1 (Adapt78) expression may protect against transient stress, it is clear that a stably transfected cell line cannot answer all relevant questions and that HA-1 cells are not a human line. Since DSCR1 is significantly expressed in brain and, predominantly in neurons (5) , we used the neuron-like PC-12 cell line as a model to study the effects of regulated DSCR1 (Adapt78) overexpression. Originally established from rat adrenal pheochromocytoma, this cell line is now is one of the most popular model systems in neurobiology research. The tet-off gene expression system (Clontech), using doxycycline-regulated transgene expression, was used in these experiments for overexpression of the DSCR1 (Adapt78) cDNA fragment corresponding to isoform 1, expressed predominantly neurons (5) . This fragment, containing exons 1, 5, 6, 7, and the full untranslated region (Fig. 1A ), was created by RT-PCR and verified by DNA sequencing as described in Materials and Methods. The system was developed following the tet-off protocol from Clontech. Transfected cells were continuously grown in the presence of doxycycline to keep the transgene ‘silent’, and inducible DSCR1 transgene expression was achieved by doxycycline withdrawal from the cell media. When doxycycline was withdrawn from the media for 144 h, we achieved more than a 10-fold increase in DSCR1 expression (Fig. 4A ).

We next studied repression of DSCR1 (Adapt78) expression by doxycycline addition. For repression experiments, DSCR1 (Adapt78) was overexpressed by culturing cells for 144 h in media without doxycycline, then doxycycline was added (to inhibit the transgene) for 0, 6, 24, or 48 h. We observed significant DSCR1 (Adapt78) inhibition as early as 6 h after doxycycline was applied (Fig. 4B ). The time interval required to overexpress the DSCR1 (Adapt78) transgene in Fig. 4A was significantly longer than the time required for repression in Fig. 4B . This is because the cells are initially saturated with doxycycline and it takes a long time before doxycycline is degraded and/or becomes diluted by cell division.

Except for those presented in Fig. 5 A, experiments were designed as follows. First, the DSCR1 (Adapt78) isoform 1 transgene was overexpressed for at least 144 h (as shown in Fig. 4A ) and down-regulated by doxycycline for 48 h, as shown in Fig. 4B . DSCR1 (Adapt78) mRNA down-regulation led to decreased production of the protein (Fig. 4) . Since the DSCR1 (Adapt78) protein has been shown to bind to and inhibit calcineurin (6 , 7 , 32) , the name calcipressin 1 has been suggested by Fuentes et al. (6) . As we can see in Fig. 4A and B , DSCR1 (Adapt78) mRNA transcription was not completely inhibited by doxycycline. Furthermore, cells grown in the presence of doxycycline (Dox+) still synthesized low levels of calcipressin 1 protein (Fig. 4C, D ). These results can be explained partially by transgene leaking and partially due to endogenous DSCR1 (Adapt78) expression. We were able to further down-regulate DSCR1 (Adapt78) by additional treatment of the cells with antisense oligonucleotides (Fig. 4C, D ). Using this combination of techniques, we were able to grow cells expressing DSCR1 (Adapt78) at three different levels: cells significantly overexpressing DSCR1 [cells grown without doxycycline], cells underexpressing DSCR1 (Adapt78) [cells grown with doxycycline and treated with antisense oligonucleotides], and cells expressing DSCR1 (Adapt78) at an intermediate level [cells grown with doxycycline].



View larger version (23K):
[in this window]
[in a new window]
  		Figure 5. Positive effect of DSCR1 (Adapt78) on PC-12 cell number. DSCR1 (Adapt78) expression was modulated as shown in Fig. 4 . Dox- cells were grown in media without doxycycline so that DSCR1 (Adapt78) was overexpressed; Dox+ cells were grown in media with doxycycline so that the DSCR1 (Adapt78) transgene was down-regulated); Dox+ and antisense cells were grown in media with doxycycline and DSCR1 (Adapt78) was down-regulated by antisense oligonucleotides; Dox+ and standard oligonucleotides additional control sample in which cells were grown in media with doxycycline and treated with standard (control) oligonucleotides. In both panels, cell number was measured using a Coulter counter after plating 10,000 cells per 30 mm dish. All results are the means and SE of three independent determinations. The doubling time of PC-12 cells carrying but not overexpressing the DSCR1(Adapt78) transgene (Dox+, control) was 56 ± 5 h; the doubling time of PC-12 cells overexpressing the DSCR1(Adapt78) transgene (Dox-) for 144 h before the start of Fig. 5 B was 39 ± 2 h. A) There were no dramatic cell number differences between samples in which DSCR1(Adapt78) was not regulated before the start of the experiment, and doubling times of all cells were essentially identical to that of controls (56±5 h). A) DSCR1 (Adapt78) was overexpressed in the Dox- samples only at the start of the experiment shown (i.e., for a maximum of 144 h). B) DSCR1 (Adapt78) was overexpressed in the Dox- samples for 144 h before the start of the experiment shown and for up to a further 144 h during the actual experiment (i.e., for up to a maximum of 288 h).

Transgenic DSCR1 (Adapt78) increases cell number
To be certain our cell treatments were not toxic, we analyzed growth rate in cells expressing DSCR1 (Adapt78) at various levels (Fig. 5) . In the experiments of Fig. 5A , the DSCR1 (Adapt78) transgene was only overexpressed at the start of the experiment; all cells were grown in the presence of doxycycline until the experiment started. Under these conditions, cells in which DSCR1 (Adapt78) was overexpressed (Dox-) exhibited about a 20% increased growth compared with cells in which the transgene was repressed (Dox+) after 144 h (Fig. 5A ). The slowest growing cells in Fig. 5A were those in which the transgene was repressed by doxycycline and translation from the endogene was inhibited by antisense oligonucleotides (Dox- and antisense).

As shown in Fig. 4A , strong overexpression of the DSCR1 (Adapt78) transgene did not occur until 144 h after doxycycline withdrawal (due to slow doxycycline degradation/dilution). Therefore, if DSCR1 (Adapt78) has a positive effect on cell growth (as suggested by the results thus far), the experimental protocol used in Fig. 5A would actually minimize its effect, since we ended the experiment at 144 h. We grew new cultures, split the cells, and grew half for 144 h without doxycycline. Both sets of cells were replated and grown for another 144 h in the presence or absence of doxycycline. As shown in Fig. 4B , the Dox-samples in which DSCR1 (Adapt78) was overexpressed for 144 h before the start of the experiment had a dramatically higher cell number (about double) than the control (Dox+) cells. Cell number was therefore roughly proportional to the expression of DSCR1 (Adapt78).

Transgenic DSCR1 (Adapt78) protects cells against stress damage
We next tested whether up-regulated expression of the DSCR1 (Adapt78) transgene could protect against oxidative stress and calcium stress and whether antisense oligonucleotides could decrease resistance. Cells in which DSCR1 (Adapt78) was expressed at different levels as described (Fig. 4) were exposed to 24 µmol/107 cell (730 µM) hydrogen peroxide or 1.25 µg/ml calcium ionophore A23187 for 1 h. They were rinsed with PBS and plated (reseeded) in 100 mm dishes at a density of 2000 cells per plate. To ensure that all cells expressed DSCR1 (Adapt78) after treatments at the same level, all samples were incubated after the exposures in media containing doxycycline. Thus, differences in stress susceptibility can be ascribed to differences in DSCR1 (Adapt78) expression during the actual stress exposures rather than during stress recovery. Cytotoxicity was assessed by a colony-forming assay (31) .

Cells were maintained for 2 wk until visible colonies were formed (consisting of ~100 cells/colony), then fixed, stained, and counted as described (31) . Control cells, which were not exposed to H2O2, formed ~200 colonies in each experiment. Exposure to either hydrogen peroxide or calcium ionophore A23187 drastically decreased colony formation in Dox+ cells in which the DSCR1 (Adapt78) transgene was repressed (Fig. 6 ). Dox- cells, in which the DSCR1 (Adapt78) transgene was overexpressed, exhibited approximately double the growth of Dox+ cells when exposed to either H2O2 stress (Fig. 6A ) or calcium ionophore A23187 (Fig. 6B ). In the presence of doxycycline and DSCR1 (Adapt78) antisense oligonucleotides [which permitted the least DSCR1 (Adapt78) expression, as shown in Fig. 4 ], cells became maximally sensitive to H2O2 toxicity (Fig. 6A ) and A23187 toxicity (Fig. 6B ), whereas standard oligonucleotides had no effect on either DSCR1 (Adapt78) and calcipressin expression (Fig. 4) or H2O2/A23187 toxicity (Fig. 6A, B ). Thus, the extent of the acute protective effect of DSCR1 (Adapt78) roughly correlates with DSCR1 (Adapt78) expression level.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 6. Protective effect of (tet-off) regulated DSCR1 (Adapt78) overexpression against oxidative stress and calcium stress in PC-12 cells. Colony-forming ability was measured as described previously (28) . All results shown are the means and SE of at least three independent determinations. x Axis: Dox- cells were grown in media without doxycycline so that DSCR1 (Adapt78) was overexpressed; Dox+ cells were grown in media with doxycycline so that the DSCR1 (Adapt78) transgene was down-regulated; Dox+ and antisense cells were grown in media with doxycycline and DSCR1 (Adapt78) was further down-regulated by antisense oligonucleotides; Dox+ and standard oligonucleotides additional control sample in which cells were grown in media with doxycycline and treated with standard (control) oligonucleotides (see Materials and Methods). Calcipressin 1 levels (reported in arbitrary units as measured by quantitative densitometry of Western blots) were Dox+ cells 18 ± 1 Dox- cells 94 ± 7 Dox+ and standard oligo, cells 17 ± 1.5, and Dox+ and antisense cells 7.5 ± 0.7. A) Protection against oxidative stress. Cells were exposed to 24 µmol/107cells (730 µM) hydrogen peroxide for 1 h and colony-forming ability was measured. The results of these analyses revealed statistically significant increases in hydrogen peroxide resistance between the Dox- group and all other groups. The Dox+ and antisense-treated group had significantly lower protection against peroxide than any other group. These differences were tested by planned comparisons at the P < 0.05 level. B) Protection against calcium stress. Cells were exposed to 1.25 µg/ml calcium ionophore A23187 for 1 h and colony-forming ability was measured. Planned comparisons revealed statistically significant increases (P<0.05) in A23187 resistance between the Dox- group and all other groups. The Dox+ and antisense-treated group had significantly lower (P<0.05) protection against A23187 than did all other groups.

In related experiments, the protective effect of transient DSCR1 (Adapt78) overexpression on the survival of cells in which intracellular Ca2+ concentration was elevated by A23187 could be seen directly by microscopic examination (Fig. 7 ). To keep intracellular Ca2+ levels constantly elevated, we incubated PC-12 cells in media containing 1.25 µg/ml calcium ionophore A23187 without replacement. Control (Dox+) cells in which DSCR1 (Adapt78) was not overexpressed continuously shrank, detached, and were completely dead after 48 h of incubation, whereas many of the cells in which DSCR1 (Adapt78) was overexpressed survived (Fig. 7) . The differences in survival in Fig. 7 are extreme because we used a more severe stress treatment in this experiment that in Fig. 6 . In Fig. 7 , cells were treated with A23187 for 48 h before survival was measured, whereas only a 1 h treatment was used in Fig. 6 . Despite the severity of A23187 treatment, it is clear there were still living cells in Fig. 7C , where the DSCR1 (Adapt78) transgene was overexpressed by prior doxycycline withdrawal for 144 h, whereas there were no live cells whatsoever in Fig. 7B , in which the DSCR1 (Adapt78) transgene was down-regulated by doxycycline. With milder or shorter A23187 treatments we are able to obtain survival of ~20% in DSCR1 (Adapt78) down-regulated (Dox+) cells, whereas cells overexpressing the DSCR1 (Adapt78) transgene (Dox- cells) exhibit 40–50% survival. Although such results may appear more appropriate in some ways, they actually make the differences between Dox+ and Dox- cells more difficult to discern in photomicrographs.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our studies demonstrate that DSCR1 (Adapt78) can directly help protect cells against acute stresses such as oxidative stress and calcium stress. Adaptation of hamster HA-1 cells to either oxidative stress (H2O2) or the calcium ionophore A23187 increased DSCR1 (Adapt78) expression 8- to 12-fold and gave cross-protection against both stresses. Stable transfection of HA-1 cells with full-length hamster DSCR1 (Adapt78) cDNA resulted in three- to fivefold increases in steady-state mRNA levels, fourfold increases in calcipressin 1 protein, and significant protection against acute H2O2 stress and calcium stress. Regulated overexpression of a DSCR1 (Adapt78) isoform 1 transgene and the DSCR1 (Adapt78) protein product calcipressin 1 by the tet-off system in human PC-12 cells increased calcipressin 1 protein levels 5.2-fold and protected against H2O2 stress and calcium stress, whereas repression of the transgene decreased transcription and translation and sensitized the cells to stress. Lowest stress resistance was observed in PC-12 cells, in which expression of the DSCR1 (Adapt78) transgene was repressed and translation of calcipressin 1 from the native DSCR1 (Adapt78) gene was blocked by antisense oligonucleotides.

We also demonstrate that DSCR1 (Adapt78) mRNA isoform 1 and isoform 4 are both expressed in human brain. These findings contradict previously published results (4) in which exon 4 (of isoform 4) was not found in adult brain. This apparent discrepancy is probably explained by the lower sensitivity of the Northern hybridization technique used in the previous study by Fuentes et al. (4) compared with the LA RT-PCR technique used in this study. We did find that the level of expression of isoform 1 was significantly higher than that of isoform 4: approximately double. Since we have previously demonstrated that DSCR1 (Adapt78) is predominantly expressed in neuronal cells (5) rather than in astrocytes or microglia, it now seems probable that isoform 1 is the predominant isoform expressed in neurons. These findings provided the rationale for studying an isoform 1 transgene in our current stress protection experiments.

It is now possible to hypothesize about the mechanism by which the DSCR1 (Adapt78) protein calcipressin 1 may protect cells against transient oxidative stress or calcium stress. It is well documented that oxidant insults in PC-12 cells involve large increases in intracellular Ca2+ (33 , 34) , therefore the effects of oxidants or Ca2+ excess might be mediated through the same pathways. We earlier showed that several of the genes induced during adaptation to oxidative stress are actually calcium-inducible genes (29 , 35 36 37 38 39 40) and, of course DSCR1 (Adapt78) itself is a calcium-inducible gene (1 , 2) .

During oxidative stress the serine-threonine phosphatase calcineurin is stimulated by calmodulin binding in a process that is activated by calcium excess. Since high calcineurin activity can lead to apoptosis (15 , 41) , inhibition of calcineurin should be beneficial to cells, and we demonstrate here that overexpression of the DSCR1 (Adapt78) calcineurin inhibitory protein calcipressin 1 can actually rescue PC-12 cells from Ca2+-induced death. This agrees with previous findings that exogenous calcineurin inhibitors can protect astrocytes against Ca2+-induced apoptosis (41) . In the present study, we found that DSCR1 (Adapt78) overexpression can protect PC-12 cells from hydrogen peroxide damage. Thus, it is most likely that DSCR1 (Adapt78) can protect cells against multiple stresses mediated by calcium. Although the exact mechanism of DSCR1 (Adapt78)/calcipressin 1 protection against stress has not yet been proved, it is likely to involve signal transduction pathways that are activated by kinases. Many inducible, protective cellular stress responses are mediated by a variety of kinases whose activity is opposed by phosphatases (39 , 40) . Thus, in a very simplistic model, DSCR1 (Adapt78)/calcipressin 1 may protect against calcium-mediated stresses by antagonizing calcineurin and permitting kinases to activate the expression of various defensive genes.

We now report that DSCR1 (Adapt78) mRNA isoform 1 significantly stimulates growth of PC-12 cells. Although we have not tested the mechanism of this phenomenon, we can speculate that binding and regulation of calcineurin might be not the only function of DSCR1 (Adapt78)/calcipressin 1. It was recently demonstrated that a stretch of ~80 amino acids near the NH2 terminus of DSCR1 (Adapt78) protein family members shows similarity with an RNA recognition motif (42) . This motif is found in many RNA binding proteins and in a few single-stranded DNA binding proteins; it is possible that DSCR1 (Adapt78) mRNA may bind to RNA or DNA and regulate expression of genes involved in cell proliferation. The possibility that calcipressin 1 may function as an as RNA or DNA binding protein has not yet been properly tested.


   ACKNOWLEDGMENTS
 
This work was supported by grant # AG16256 from the National Institutes of Health/NIA to K.J.A.D.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Crawford, D. R., Leahy, K. P., Abramova, N., Lan, L., Wang, Y., Davies, K. J. A. (1997) Hamster adapt78 mRNA is a Down syndrome critical region homologue that is inducible by oxidative stress. Arch. Biochem. Biophys. 342,6-12[CrossRef][Medline]
  2. Leahy, K. P., Davies, K. J. A., Dull, M., Kort, J. J., Lawrence, K. W., Crawford, D. A. (1999) Adapt78, a stress-inducible mRNA, is related to the glucose-regulated family of genes. Arch. Biochem. Biophys. 368,67-74[CrossRef][Medline]
  3. Fuentes, J. J., Pritchard, M. A., Planas, A. M., Bosch, A., Ferrer, I., Estivill, X. (1995) A new human gene from the Down syndrome critical region encodes a proline-rich protein highly expressed in fetal brain and heart. Hum. Mol. Genet. 4,1935-1944[Abstract/Free Full Text]
  4. Fuentes, J. J., Pritchard, M. A., Estivill, X. (1997) Genomic organization, alternative splicing, and expression patterns of the DSCR1 (Down syndrome candidate region 1) gene. Genomics 44,358-361[CrossRef][Medline]
  5. Ermak, G., Morgan, T., Davies, K. J. A. (2001) Chronic overexpression of the calcineurin inhibitory gene DSCR1 (Adapt78) is associated with Alzheimer disease. J. Biol. Chem. 276,38787-38794[Abstract/Free Full Text]
  6. Fuentes, J. J., Genesca, L., Kingsbury, T. J., Cunningham, K. W., Perez-Riba, M., Estivill, X., De La Luna, S. (2000) DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin mediated signaling pathways. Hum. Mol. Genet. 9,1681-1690[Abstract/Free Full Text]
  7. Rothermel, B., Vega, R. B., Yang, J., Wu, H., Bassel Duby, R., Williams, R. S. (2000) A protein encoded within the Down syndrome critical region is enriched in striated muscles and inhibits calcineurin signaling. J. Biol. Chem. 275,8719-8725[Abstract/Free Full Text]
  8. Liu, J., Farmer, J. D., Lane, W. S., Friedman, J., Weissman, I., Schriber, S. L. (1991) Calcineurin is a common target of cyclosporin-cyclosporin A and FKBP-FK506 complexes. Cell 66,807-815[CrossRef][Medline]
  9. Clipstone, N. A., Crabtree, G. R. (1992) Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature (London) 357,695-697[CrossRef][Medline]
  10. Cunningham, K. W., Fink, G. R. (1994) Calcineurin dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases. J. Cell Biol. 124,351-363[Abstract/Free Full Text]
  11. Matheos, D. P., Kingsbury, T. J., Ahsan, U. S., Cunningham, K. W. (1997) Tcn1p/Crz1p, a calcineurin dependent transcription factor that differentially regulates gene expression in Saccharomyces cerevisiae. Genes Dev. 11,3445-3458[Abstract/Free Full Text]
  12. Stathopoulos-Gerontides, A., Guo, J. J., Cyert, M. S. (1999) Yeast calcineurin regulates nuclear localization of the Crz1p transcription factor through dephosphorylation. Genes Dev. 13,798-803[Abstract/Free Full Text]
  13. Shibasaki, F., McKeon, F. (1995) Calcineurin functions in Ca2+ activated cell death in mammalian cells. J. Cell Biol. 131,735-743[Abstract/Free Full Text]
  14. Krebs, J. (1998) The role of calcium in apoptosis. Biometals 11,375-382[CrossRef][Medline]
  15. Asai, A., Qui, J., Narita, Y., Chi, S., Saito, N., Shiinoura, N., Hamada, H., Kuchino, Y., Kirono, T. (1999) High level calcineurin activity predisposes neuronal cells to apoptosis. J. Biol. Chem. 274,34450-34458[Abstract/Free Full Text]
  16. Honig, L. S., Rosenberg, R. N. (2000) Apoptosis and neurological disease. Am. J. Neurol. 108,317-330
  17. Kayyali, U. S., Zhang, W., Yee, A. G., Seidman, J. G., Potter, H. (1997) Cytoskeletal changes in the brains of mice lacking calcineurin. Am. J. Neurochem. 68,1668-1678
  18. Zhuo, S., Zhang, W., Son, H., Mansuy, I., Sobel, R. A., Seidman, J., Kandel, E. R. (1999) A selective role of calcineurin Aa in synaptic depotentiation in hippocampus. Proc. Natl. Acad. Sci. USA 96,4650-4655[Abstract/Free Full Text]
  19. Mansuy, I. M., Mayford, M., Jacob, B., Kandel, E. R., Bach, M. E. (1998) Restricted and regulated overexpression reveals calcineurin as a key component in the transition from short term to long term memory. Cell 92,39-49[CrossRef][Medline]
  20. Winder, D. G., Mansuy, I. M., Osman, M., Moallem, T. M., Kandel, E. R. (1998) Genetic and pharmacological evidence for a novel, intermediate phase of long term potentiation suppressed by calcineurin. Cell 92,25-37[CrossRef][Medline]
  21. Chin, E. R., Olson, E. N., Richardson, J. A., Yang, Q., Humphries, C., Shelton, J. M., Wu, H., Zhu, W., Bassel-Duby, R., Williams, R. S. (1998) A calcineurin dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 12,2499-2509[Abstract/Free Full Text]
  22. Hughes, S. M. (1998) Muscle development: electrical control of gene expression. Curr. Biol. 8,892-894
  23. Pardo, J. M., Reddy, M. P., Yang, S., Maggio, A., Huh, G. H., Matsumoto, T., Coca, M. A., Paino-D’Urzo, M., Koiwa, H., Yun, D. J., et al (1998) Stress signaling through Ca2+/calmodulin dependent protein phosphatase calcineurin mediates salt adaptation in plants. Proc. Natl. Acad. Sci. USA ,9681-9686
  24. Molkentin, J. D., Lu, J. R., Antos, S. L., Markham, B., Richardson, J., Robbins, J., Grant, S. R., Olson, E. N. (1998) A calcineurin dependent transcriptional pathway for cardiac hypertrophy. Cell 93,215-228[CrossRef][Medline]
  25. Sussman, M. A., Lim, H. W., Gude, M., Taigen, T., Olson, E. N., Robbins, J., Colbert, M. C., Gualberto, A., Wieczorek, D. F., Molkentin, J. D. (1998) Prevention of cardiac hypertrophy in mice by calcineurin inhibition. Science 281,1690-1693[Abstract/Free Full Text]
  26. Rothermel, B. A., McKinsey, T. A., Vega, R. B., Nicol, R. L., Mammen, P., Yang, J., Antos, C. L., Shelton, J. M., Bassel-Duby, R., Olson, E. N., Williams, R. S. (2001) Myocyte-enriched calcineurin-interacting protein, MCIP1, inhibits cardiac hypertrophy in vivo. Proc. Natl. Acad. Sci. USA 98,3328-3333[Abstract/Free Full Text]
  27. Yang, J., Rothermel, B., Vega, R. B., Frey, N., McKinsey, T. A., Olson, E. N., Bassel-Duddy, R., Williams, S. (2000) Independent signals control expression of the calcineurin inhibitory proteins MCIP1 and MCIP2 in striated muscles. Circ. Res. 87,1071-1073[Free Full Text]
  28. Wiese, A. G., Pacifici, R. E., Davies, K. J. A. (1995) Transient adaptation to oxidative stress in mammalian cells. Arch. Biochem. Biophys. 318,231-240[CrossRef][Medline]
  29. Crawford, D. R., Davies, K. J. A. (1997) Modulation of a cardiogenic shock inducible RNA by chemical stress: adapt73/PigHep3. Surgery 121,581-587[CrossRef][Medline]
  30. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY.
  31. Ermak, G., Jennings, T., Robinson, L., Ross, J. S., Figge, J. (1996) Restricted patterns of CD44 variant exon expression in human papillary thyroid carcinoma. Cancer Res. 56,1037-1042[Abstract/Free Full Text]
  32. Rothermel, B. A., McKinsey, T. A., Vega, R. B., Nicol, R. L., Mammen, P., Yang, J., Antos, C. L., Shelton, J. M., Bassel-Duby, R., Olson, E. N., Williams, R. S. (2001) Myocyte enriched calcineurin interacting protein, MCIP1, inhibits cardiac hypertrophy in vivo. Proc. Natl. Acad. Sci. USA 98,3328-3333[Abstract/Free Full Text]
  33. Joseph, J. A., Strain, I. J., Jimenez, N. D., Fisher, D. (1997) Oxidant injury in PC12 cells a possible model of calcium dysregulation in aging:: I Selectivity of protection against oxidative stress. J. Neurochem. 69,1252-1258[Medline]
  34. Wang, H., Joseph, J. A. (2000) Mechanisms of hydrogen peroxide induced calcium dysregulation in PC12 cells. Free Radical Biol. Med. 28,1222-1231[CrossRef][Medline]
  35. Crawford, D. R., Leahy, K. P., Wang, Y., Schools, G. P., Kochheiser, J. C., Davies, K. J. A. (1996a) Oxidative stress induces the levels of a mafG homolog in Hamster HA-1 cells. Free Radical Biol. Med. 21,521-525[CrossRef][Medline]
  36. Crawford, D. R., Schools, G. P., Davies, K. J. A. (1996b) Oxidant-inducible adapt15 is associated with growth arrest and DNA damage-inducible gadd153 and gadd45. Arch. Biochem. Biophys. 329,137-144[CrossRef][Medline]
  37. Crawford, D. R., Schools, G. P., Salmon, S. L., Davies, K. J. A. (1996c) Hydrogen peroxide induces the expression of adapt15, a novel RNA associated with polysomes in hamster HA-1 cells. Arch. Biochem. Biophys. 325,256-264[CrossRef][Medline]
  38. Wang, Y., Crawford, D. R., Davies, K. J. A. (1996) Adapt33, a novel oxidant-inducible RNA from Hamster HA-1 cells. Arch. Biochem. Biophys. 332,255-260[CrossRef][Medline]
  39. Davies, K. J. A. (1999) The broad spectrum of responses to oxidants in proliferating cells: a new paradigm for oxidative stress. IUBMB Life 48,41-47[Medline]
  40. Davies, K. J. A. (2000) Oxidative stress, antioxidant defenses, and damage removal, repair, and replacement systems. IUBMB Life 50,35-41
  41. Matsuda, T., Takuma, K., Lee, F., Baba, A. (1998) Cell injury and its protection in astrocytes. Nippon Yakurigaku Zasshi-Folia Pharmacol. Japonica 112((Suppl. 1)),24P-27P
  42. Stripoli, P., Lenzi, L., Petrini, M., Carinci, P., Zannotti, M. (2000) A new gene family including DSCR1 and ZAKI-4: characterization from yeast to human and identification of DSCR1-like2, a novel human member (DSCR1L2). Genomics 64,252-263[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. J. Mahoney, A. Safdar, G. Parise, S. Melov, M. Fu, L. MacNeil, J. Kaczor, E. T. Payne, and M. A. Tarnopolsky
Gene expression profiling in human skeletal muscle during recovery from eccentric exercise
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1901 - R1910.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. Rev.Home page
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo
Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models
Physiol Rev, April 1, 2008; 88(2): 421 - 449.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
J. Stie and D. Fox
Calcineurin Regulation in Fungi and Beyond
Eukaryot. Cell, February 1, 2008; 7(2): 177 - 186.
[Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
T. Kishi, A. Ikeda, R. Nagao, and N. Koyama
The SCFCdc4 ubiquitin ligase regulates calcineurin signaling through degradation of phosphorylated Rcn1, an inhibitor of calcineurin
PNAS, October 30, 2007; 104(44): 17418 - 17423.
[Abstract] [Full Text]