|
|
||||||||
Ethel Percy Andrus Gerontology Center, and Division of Molecular and Computational Biology, University of Southern California, Los Angeles, California, USA
1Correspondence: Ethel Percy Andrus Gerontology Center, University of Southern California, 3715 McClintock Ave., Room 306, Los Angeles, CA 90089-0191, USA. E-mail: kelvin{at}usc.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: calcium signaling apoptosis stress proteins and genes
| INTRODUCTION |
|---|
|
|
|---|
Calcineurin is a calcium/calmodulin-activated serine/threonine phosphatase (PP2B) that is an important enzyme in Ca2+-dependent eukaryotic signal transduction pathways (8)
. DSCR1 induction during adaptation to oxidative stress is also a calcium-dependent process (1
, 2)
. Calcineurin plays important roles in immune stimulation, and calcineurin-dependent signal transduction pathways have been extensively characterized during T cell activation (9)
. Calcineurin transduction pathways are well characterized in yeast, where the protein promotes growth in high calcium environments by dephosphorylation of the Tcn1p transcription factor (10
11
12)
. Calcineurin plays a critical role in cellular responses to various extracellular signals and environmental stresses and is important in the regulation of apoptosis (13
14
15
16
17)
, memory processes (18
19
20)
, and skeletal and cardiac muscle growth and differentiation (21
, 22)
. In plants, calcineurin mediates salt adaptation (23)
. Since the DSCR1 (Adapt78) protein calcipressin 1 can regulate calcineurin activity, it is likely to be involved in many of the above processes. For example, excessive activity of calcineurin causes cardiac hypertrophy, which can be prevented by addition of exogenous calcineurin inhibitors (24
, 25)
or overexpression of DSCR1 (Adapt78) (26)
.
The DSCR1 (Adapt78) gene consist of seven exons, four of which (exons 14) can be alternatively spliced to produce number of different mRNA isoforms; Fig. 1
A. Since exons 57 are likely to be common in each mRNA isoform, for nomenclature simplification we propose to assign them numbers as shown in Fig. 1B
. These isoforms may have different expression patterns, functions, and regulation mechanisms. For example, expression of exon 2 was detected in fetal, but not adult, human brain (4)
and calcineurin can induce expression of DSCR1 (Adapt78) isoform 4 mRNA, but does not induce the other isoforms (27)
.
|
Although we originally discovered DSCR1 (Adapt78) as a gene associated with transient adaptation to oxidative stress and calcium stress and we hypothesized that its overexpression might help protect cells against such stress (1
, 2)
, no one has actually tested whether DSCR1 (Adapt78) can provide stress protection. Indeed, much of the work on this gene has associated its expression with Down syndrome (3
, 4
, 6)
and Alzheimer disease (5)
. We hypothesized that although chronic overexpression of DSCR1 (Adapt78) is associated with these serious diseases, acute overexpression may transiently protect against calcium-mediated stresses. To directly test this hypothesis, we constructed permanent DSCR1 (Adapt78) overexpressing cells and cells in which DSCR1 (Adapt78) transcription was regulated by a tet off expression system. We further regulated DSCR1 (Adapt78) levels with antisense oligonucleotides and tested oxidative stress resistance and calcium stress resistance under all conditions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Stable transfection of DSCR1 (Adapt78) in HA-1 cells
Hamster HA-1 cells were cultivated as described previously (2
, 28
, 29)
. The pcDNA3.1 expression vector (Invitrogen, San Diego, CA) was used to stably transfect HA-1 cells with full-length hamster Adapt78 cDNA (and vector-only controls) (30)
.
Doxycycline-regulated DSCR1 (Adapt78) expression system
DSCR1 isoform 1 fragment, produced by long and accurate (LA) RT-PCR as described below, was inserted into a pTRE vector (Clontech Laboratories, Palo Alto, CA). PC-12 tet-off cells from Clontech stably transfected with regulator plasmid were next transfected with the pTRE carrying DSCR1 (Adapt78) fragment to produce a double-stable cell line in which the DSCR1 (Adapt78) transgene could be turned off by doxycycline. All procedures were performed as described in the tet-off gene expression user manual from Clontech.
PC-12 cell culture
PC-12 cells were cultivated in media containing 85% DMEM, 10% horse serum, 5% antibiotic free fetal bovine serum (Clontech), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin sulfate. PC-12 tet-off cells stably transfected with regulator plasmid were maintained in media containing 50 µg/ml G418. The double-stable cell line carrying the regulator plasmid and the DSCR1 (Adapt78) transgene was maintained in media containing 50 µg/ml G418 and 50 µg/ml hygromycin. Cells were cultivated in a humidified 10% CO2 atmosphere at 37°C. The DSCR1 (Adapt78) transgene was turned off by application of 0.1 µg/ml doxycycline to the media.
Oligonucleotides and their delivery
To further down-regulate DSCR1 (Adapt78), we used an antisense morpholino oligonucleotide against DSCR1 (Adapt78) synthesized for us by GeneTools, LLC. This oligonucleotide (CATCTCGCAGTCAATGAAGCTCCAG) was complementary to bases 321 of DSCR1 (Adapt78) exon 1, including the AUG translation start site. Standard oligonucleotides designed and tested by GeneTools, LLC were used as a negative control. A standard (control) oligonucleotide was specifically designed to overcome nonspecific effects that can occur using sense, mismatch or scrambled oligonucleotides as controls. This 25-mer standard oligonucleotide has the following sequence: 5'-CCTCTTACCTCAGTTACAATTTATA-3';it has been demonstrated to have no target or significant biological activity (see www.gene-tools.com). Delivery of the oligonucleotides into the cells was performed by scraping, following the GeneTools, LLC protocol.
Library screening
Human brain, substantia nigra 5' stretch + cDNA library was purchased from Clontech. This library represents 0.64.5 kb cDNA fragments cloned into a
gt11 phage. The cDNA library was titrated and diluted, plaques were grown, transferred onto membranes, and fixed following the manufacturers protocol. To detect plaques carrying DNA fragments homologous to the human DSCR1 (Adapt78) gene, the membranes were hybridized using a hamster Adapt78 fragment (1)
. Recombinant phage DNA was isolated from the positive plaques and human cDNA inserts were amplified using LA PCR (Tamara Shuzo Co., Ltd., Otsu, Japan). About 80 ng of recombinant phage DNA was amplified for 30 cycles at 68°C for 20 s, followed by 98°C for 3 min. The sequence of the forward primer was 5'-GAAGGCACATGGCTGAATATCGACGGTTTC-3'; that of the reverse primer was 5'-GACACCAGACCAACTGGTAATGGTAGCGAC-3'. Both fragments were verified by sequencing.
RNA isolation
Total RNA was extracted using the TRIzol reagent (Life Technologies, Gaithersburg, MD). RNA concentration was quantified spectrophotometrically and relative content was further confirmed on ethidium bromide-stained gels. Integrity of the RNA was estimated by agarose gel electrophoresis; only RNA samples displaying discrete 28S and 18S RNA bands were used in experiments.
LA RT-PCR
The synthesis of first-strand cDNA was performed using the SuperScript preamplification system from Life Technologies. 13 µg of total RNA per reaction was reverse transcribed using oligo(dT) as the primer. About 2 µl of 20 µl of the total volume of the cDNA was used per each PCR reaction. LA RT-PCR was performed using kit from Tamara Shuzo. Primers were the following: 1) human DSCR1 (Adapt78) mRNA isoform 1 consisting of exons 1, 5, 6, and 7 (see Fig. 1
for suggested isoform nomenclature); the forward primer was 5'-GACTGGAGCTTCATTGACTGCGAGA-3', corresponding to bases 125 of exon 1; and the reverse primer was 5'-ACCACGCTGGGAGTGGTGTCAGTCG-3', corresponding to bases 125 of exon 7; 2) human DSCR1 (Adapt78) mRNA isoform 4, consisting of exons 4- 7; the forward primer was 5'-AAGGAACCTACAGCCTCTTGGAAAG-3', corresponding to bases 125 of exon 4; and the reverse primer was the same one used to amplify isoform 1; 3) human glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers and conditions were as described previously (31)
.
All DNA fragments produced by LA RT-PCR were verified by sequencing, using an ABI Prism 377 DNA sequencer (Perkin-Elmer) in our core facility.
Northern hybridization
Samples containing 10 µg of total RNA were subjected to electrophoresis through 1% agarose formaldehyde gels, blotted to nylon membranes (Oncor) with HETS (CINNA/BIOTECX), and cross-linked by ultraviolet radiation. The membranes were prehybridized for 4 h and hybridized for 15 h in Hybrizol I (Oncor) at 42°C. They were washed with 2xSSC + 0.1% SDS at room temperature for 1 and 10 min, then with 0.1xSSC + 0.1% SDS at 60°C for 10 and 30 min. The membranes were exposed, developed, and scanned using the PhosphorImager system (Molecular Dynamics, Sunnyvale, CA). To rehybridize RNA blots, probes were removed by washing the membranes in a solution of 0.1xSSC, 0.1% SDS, and 10 mM Tris-HCl (pH 7.0) at 90°C for 10 min. To quantify levels of DSCR1 mRNA, the membranes were scanned and the hybridization signal measured using ImageQuant software (Molecular Dynamics). Each signal was recalculated according to the amount of RNA actually loaded on the gels. The amount of the loaded RNA was controlled using hybridization with a GAPDH probe. Probes containing [
-32P]dCTP labeled DNA were prepared using the High Prime system (Boehringer Mannheim, Mannheim, Germany). A PCR fragment corresponding to DSCR1 (Adapt78) isoform 1 was used to prepare the DSCR1 (Adapt78) probe and a PCR fragment consisting of GAPDH exons 7 and 8 was used to prepare GAPDH probes (see above).
DSCR1 (Adapt78) antibody and Western blot analysis
Using the predicted open reading frame sequence of DSCR1 (Adapt78), we designed a carboxyl-terminal 16 amino acid peptide that was used as an antigen to immunize rabbits. We added a cysteine to the NH2 terminus of this peptide (KIIQTRRPEYTPIHLS) and conjugated the peptide to keyhole limpet hemocyanin. Polyclonal antibodies were raised commercially (ProSci) by injection of this complex into rabbits. Serum from one of the immunized rabbits was affinity purified on a column with the covalently attached DSCR1 (Adapt78) peptide that was used for immunization. Western blot analysis was performed, following the protocol from ProSci, using an ECL detection system from Amersham (Arlington Heights, IL). Final dilution of the purified peptide in Western blot analysis was 1:500.
| RESULTS |
|---|
|
|
|---|
We analyzed the expression of various DSCR1 (Adapt78) mRNA isoforms using RT-PCR. Total RNA isolated from different regions of the adult human brain (cerebral cortex, hippocampus, cerebellum, substantia nigra) was analyzed. cDNA was amplified using Ex Tag formulation (Tamara Shuzo Co.) following the manufacturers protocol. No amplification products spanning exons 27 or exons 37 were detected in any tissues studied, but fragments spanning exons 17 and exons 47 were found in all samples (Fig. 2
). The amplified fragments were directly sequenced using an ABI automated sequencing system. Sequence analysis revealed that fragments amplified with primers to exons 1 and 7 consisted of exon 1 joined to exons 57 (isoform 1), and the fragments amplified with primers to exons 4 and 7 consisted of exons 47 (isoform 4).
|
Expression of isoform 1 was confirmed by screening a cDNA library from the substantia nigra of human brain (Clontech). The library was screened following the manufacturers protocols using the hamster DSCR1 (Adapt78) sequence as a probe. Of >150,000 plaques, we isolated 5 that had strong hybridization signals. Recombinant phage DNA was isolated from these plaques and analyzed. Restriction and hybridization analysis revealed that the phages all carried human DNA inserts of
1800 bp. These inserts were directly sequenced using an ABI automated sequencing system. The inserts were computer analyzed using the Omiga 1.0.1 program (Oxford Molecular Group, Campbell, CA) and all appeared to contain identical sequences. Sequencing of all five inserts and several PCR fragments (described above) produced the same results but revealed two substitutions at bases 4243 of the published (4)
sequence of human DSCR1 (Adapt78) exon 1 (Fig. 1C
).
Taking these data together, we conclude that at least two distinct DSCR1 (Adapt78) mRNA isoforms are produced in human brain: isoforms 1 and 4. Our studies indicate that DSCR1 (Adapt78) mRNA isoform 1 is the predominant form expressed in most brain areas (Fig. 2)
. As estimated using the semiquantitative RT-PCR technique, the level of isoform 1 in brain is about double that of isoform 4.
Stress-adapted hamster HA-1 cells and cells stably transfected with hamster Adapt78 (DSCR1) resist oxidant stress and calcium stress
We next wanted to resolve an important apparent contradiction. We originally discovered hamster Adapt78 as one of several genes induced in HA-1 cells during transient adaptation to oxidative stress (1
, 2)
. It immediately became clear, however, that hamster Adapt78 and human DSCR1 were the same gene and that human DSCR1 was associated with Down syndrome (3
, 4)
. Our own recent work now associates DSCR1 (Adapt78) with Alzheimers disease (5)
. Thus, it is not clear whether DSCR1 (Adapt78) is a helpful gene during stress adaptation or a damaging one that leads to neurological disorders. Since we had only shown that DSCR1 (Adapt78) is associated with transient adaptation to hydrogen peroxide and is directly inducible by calcium ionophores (1
, 2)
, we wanted to test whether the gene could actually provide resistance to these stresses. It seemed sensible to begin such work in hamster HA-1 cells where we originally found Adapt78.
As a first step, we transiently adapted HA-1 cells to hydrogen peroxide, as described previously (1
, 28)
, or to the calcium ionophore A23187 and tested for Adapt78 (DSCR1) induction and for induced resistance to both stresses (Fig. 3
A). Hydrogen peroxide and A23187 adaptation both caused 8- to 12-fold increases in the steady-state levels of Adapt78 mRNA (not shown); each treatment provided strong protection against subsequent challenge with the same agent and significant cross-protection (Fig. 3A
).
|
We then stably transfected HA-1 cells with full-length Adapt78 (DSCR1) cDNA and tested transcription, translation, and protection against oxidative stress and calcium stress. Some eight successfully transfected HA-1 clones were obtained, which expressed Adapt78 (DSCR1) mRNA at levels between three- and fivefold higher than parent cells. The overexpressing clones synthesized an
25 kDa protein (calcipressin 1) at significantly higher levels than did the parent cells. We tested three of the Adapt78 (DSCR1) stably transfected clones for calcipressin 1 expression, hydrogen peroxide resistance, and A23187 (calcium ionophore) resistance and obtained essentially identical results; clone 6 results are shown in Fig. 3B
. Levels of the 25 kDa protein (calcipressin1) were 3.7 ± 0.3-fold higher in the Adapt78(DSCR1) transfected clone 6 cells than in controls. This difference was statistically significant at the P 0.05 level by the 1-tailed Students t test.
The stress levels used in Fig. 3B
were lower than those used in Fig. 3A
. In Fig. 3A
, we adapted cells to H2O2 or calcium ionophore A23187 and tested cross-resistance using strong stress challenge levels. The adaptation was performed as described in ref 28
, in which we observed overexpression of >35 proteins. Subsequent studies with this same model have confirmed the induction of many previously known genes as well as several novel stress genes (1
, 2
, 29
, 35
36
37
38
39
40)
. With this in mind, it seemed unlikely that stable overexpression of only the Adapt78(DSCR1) gene could provide as much protection as the 35 or more gene products expressed in a full adaptive response. We therefore lowered the amount of hydrogen peroxide and A23187 used to stress the cells in the experiments of Fig. 3B
. When parent HA-1 cells or cells transfected only with the pcDNA3.1 vector were exposed to mild hydrogen peroxide or A23187 challenge, colony-forming ability was reduced to 1022% of control untreated (100%) values. In contrast, the stably Adapt78 (DSCR1) transfected clone 6 HA-1 cells exhibited colony-forming abilities that were
60% of control values (Fig. 3B
), suggesting that Adapt78 (DSCR1) may indeed be able to partially protect against an acute stress.
We measured catalase activity in the stably Adapt78 (DSCR1) transfected clone 6 HA-1 cells and found it unchanged from parental HA-1 cell levels. We have also shown that adaptation to oxidative stress involving significant Adapt78 (DSCR1) overexpression does not elevate either catalase, glutathione peroxidase, glutathione transferase, or glutathione levels, nor does it increase overall cellular peroxide consuming capacity (28
, 35
36
37
38
39
40)
. We recently tested the effects of transient overexpression of Adapt78(DSCR1) using the tet-off system (Fig. 4
through Fig. 7
) and found no induction of catalase, glutathione peroxidase, glutathione transferase, or glutathione whatsoever (G. Ermak and K. J. A. Davies, unpublished observations).
|
|
Regulated transgenic expression of DSCR1 (Adapt78) isoform 1 in human PC-12 cells
Although the results of Fig. 3
are consistent with our hypothesis that DSCR1 (Adapt78) expression may protect against transient stress, it is clear that a stably transfected cell line cannot answer all relevant questions and that HA-1 cells are not a human line. Since DSCR1 is significantly expressed in brain and, predominantly in neurons (5)
, we used the neuron-like PC-12 cell line as a model to study the effects of regulated DSCR1 (Adapt78) overexpression. Originally established from rat adrenal pheochromocytoma, this cell line is now is one of the most popular model systems in neurobiology research. The tet-off gene expression system (Clontech), using doxycycline-regulated transgene expression, was used in these experiments for overexpression of the DSCR1 (Adapt78) cDNA fragment corresponding to isoform 1, expressed predominantly neurons (5)
. This fragment, containing exons 1, 5, 6, 7, and the full untranslated region (Fig. 1A
), was created by RT-PCR and verified by DNA sequencing as described in Materials and Methods. The system was developed following the tet-off protocol from Clontech. Transfected cells were continuously grown in the presence of doxycycline to keep the transgene silent, and inducible DSCR1 transgene expression was achieved by doxycycline withdrawal from the cell media. When doxycycline was withdrawn from the media for 144 h, we achieved more than a 10-fold increase in DSCR1 expression (Fig. 4A
).
We next studied repression of DSCR1 (Adapt78) expression by doxycycline addition. For repression experiments, DSCR1 (Adapt78) was overexpressed by culturing cells for 144 h in media without doxycycline, then doxycycline was added (to inhibit the transgene) for 0, 6, 24, or 48 h. We observed significant DSCR1 (Adapt78) inhibition as early as 6 h after doxycycline was applied (Fig. 4B
). The time interval required to overexpress the DSCR1 (Adapt78) transgene in Fig. 4A
was significantly longer than the time required for repression in Fig. 4B
. This is because the cells are initially saturated with doxycycline and it takes a long time before doxycycline is degraded and/or becomes diluted by cell division.
Except for those presented in Fig. 5
A, experiments were designed as follows. First, the DSCR1 (Adapt78) isoform 1 transgene was overexpressed for at least 144 h (as shown in Fig. 4A
) and down-regulated by doxycycline for 48 h, as shown in Fig. 4B
. DSCR1 (Adapt78) mRNA down-regulation led to decreased production of the protein (Fig. 4)
. Since the DSCR1 (Adapt78) protein has been shown to bind to and inhibit calcineurin (6
, 7
, 32)
, the name calcipressin 1 has been suggested by Fuentes et al. (6)
. As we can see in Fig. 4A and B
, DSCR1 (Adapt78) mRNA transcription was not completely inhibited by doxycycline. Furthermore, cells grown in the presence of doxycycline (Dox+) still synthesized low levels of calcipressin 1 protein (Fig. 4C, D
). These results can be explained partially by transgene leaking and partially due to endogenous DSCR1 (Adapt78) expression. We were able to further down-regulate DSCR1 (Adapt78) by additional treatment of the cells with antisense oligonucleotides (Fig. 4C, D
). Using this combination of techniques, we were able to grow cells expressing DSCR1 (Adapt78) at three different levels: cells significantly overexpressing DSCR1 [cells grown without doxycycline], cells underexpressing DSCR1 (Adapt78) [cells grown with doxycycline and treated with antisense oligonucleotides], and cells expressing DSCR1 (Adapt78) at an intermediate level [cells grown with doxycycline].
|
Transgenic DSCR1 (Adapt78) increases cell number
To be certain our cell treatments were not toxic, we analyzed growth rate in cells expressing DSCR1 (Adapt78) at various levels (Fig. 5)
. In the experiments of Fig. 5A
, the DSCR1 (Adapt78) transgene was only overexpressed at the start of the experiment; all cells were grown in the presence of doxycycline until the experiment started. Under these conditions, cells in which DSCR1 (Adapt78) was overexpressed (Dox-) exhibited about a 20% increased growth compared with cells in which the transgene was repressed (Dox+) after 144 h (Fig. 5A
). The slowest growing cells in Fig. 5A
were those in which the transgene was repressed by doxycycline and translation from the endogene was inhibited by antisense oligonucleotides (Dox- and antisense).
As shown in Fig. 4A
, strong overexpression of the DSCR1 (Adapt78) transgene did not occur until 144 h after doxycycline withdrawal (due to slow doxycycline degradation/dilution). Therefore, if DSCR1 (Adapt78) has a positive effect on cell growth (as suggested by the results thus far), the experimental protocol used in Fig. 5A
would actually minimize its effect, since we ended the experiment at 144 h. We grew new cultures, split the cells, and grew half for 144 h without doxycycline. Both sets of cells were replated and grown for another 144 h in the presence or absence of doxycycline. As shown in Fig. 4B
, the Dox-samples in which DSCR1 (Adapt78) was overexpressed for 144 h before the start of the experiment had a dramatically higher cell number (about double) than the control (Dox+) cells. Cell number was therefore roughly proportional to the expression of DSCR1 (Adapt78).
Transgenic DSCR1 (Adapt78) protects cells against stress damage
We next tested whether up-regulated expression of the DSCR1 (Adapt78) transgene could protect against oxidative stress and calcium stress and whether antisense oligonucleotides could decrease resistance. Cells in which DSCR1 (Adapt78) was expressed at different levels as described (Fig. 4)
were exposed to 24 µmol/107 cell (730 µM) hydrogen peroxide or 1.25 µg/ml calcium ionophore A23187 for 1 h. They were rinsed with PBS and plated (reseeded) in 100 mm dishes at a density of 2000 cells per plate. To ensure that all cells expressed DSCR1 (Adapt78) after treatments at the same level, all samples were incubated after the exposures in media containing doxycycline. Thus, differences in stress susceptibility can be ascribed to differences in DSCR1 (Adapt78) expression during the actual stress exposures rather than during stress recovery. Cytotoxicity was assessed by a colony-forming assay (31)
.
Cells were maintained for 2 wk until visible colonies were formed (consisting of
100 cells/colony), then fixed, stained, and counted as described (31)
. Control cells, which were not exposed to H2O2, formed
200 colonies in each experiment. Exposure to either hydrogen peroxide or calcium ionophore A23187 drastically decreased colony formation in Dox+ cells in which the DSCR1 (Adapt78) transgene was repressed (Fig. 6
). Dox- cells, in which the DSCR1 (Adapt78) transgene was overexpressed, exhibited approximately double the growth of Dox+ cells when exposed to either H2O2 stress (Fig. 6A
) or calcium ionophore A23187 (Fig. 6B
). In the presence of doxycycline and DSCR1 (Adapt78) antisense oligonucleotides [which permitted the least DSCR1 (Adapt78) expression, as shown in Fig. 4
], cells became maximally sensitive to H2O2 toxicity (Fig. 6A
) and A23187 toxicity (Fig. 6B
), whereas standard oligonucleotides had no effect on either DSCR1 (Adapt78) and calcipressin expression (Fig. 4)
or H2O2/A23187 toxicity (Fig. 6A, B
). Thus, the extent of the acute protective effect of DSCR1 (Adapt78) roughly correlates with DSCR1 (Adapt78) expression level.
|
In related experiments, the protective effect of transient DSCR1 (Adapt78) overexpression on the survival of cells in which intracellular Ca2+ concentration was elevated by A23187 could be seen directly by microscopic examination (Fig. 7
). To keep intracellular Ca2+ levels constantly elevated, we incubated PC-12 cells in media containing 1.25 µg/ml calcium ionophore A23187 without replacement. Control (Dox+) cells in which DSCR1 (Adapt78) was not overexpressed continuously shrank, detached, and were completely dead after 48 h of incubation, whereas many of the cells in which DSCR1 (Adapt78) was overexpressed survived (Fig. 7)
. The differences in survival in Fig. 7
are extreme because we used a more severe stress treatment in this experiment that in Fig. 6
. In Fig. 7
, cells were treated with A23187 for 48 h before survival was measured, whereas only a 1 h treatment was used in Fig. 6
. Despite the severity of A23187 treatment, it is clear there were still living cells in Fig. 7C
, where the DSCR1 (Adapt78) transgene was overexpressed by prior doxycycline withdrawal for 144 h, whereas there were no live cells whatsoever in Fig. 7B
, in which the DSCR1 (Adapt78) transgene was down-regulated by doxycycline. With milder or shorter A23187 treatments we are able to obtain survival of
20% in DSCR1 (Adapt78) down-regulated (Dox+) cells, whereas cells overexpressing the DSCR1 (Adapt78) transgene (Dox- cells) exhibit 4050% survival. Although such results may appear more appropriate in some ways, they actually make the differences between Dox+ and Dox- cells more difficult to discern in photomicrographs.
| DISCUSSION |
|---|
|
|
|---|
We also demonstrate that DSCR1 (Adapt78) mRNA isoform 1 and isoform 4 are both expressed in human brain. These findings contradict previously published results (4)
in which exon 4 (of isoform 4) was not found in adult brain. This apparent discrepancy is probably explained by the lower sensitivity of the Northern hybridization technique used in the previous study by Fuentes et al. (4)
compared with the LA RT-PCR technique used in this study. We did find that the level of expression of isoform 1 was significantly higher than that of isoform 4: approximately double. Since we have previously demonstrated that DSCR1 (Adapt78) is predominantly expressed in neuronal cells (5)
rather than in astrocytes or microglia, it now seems probable that isoform 1 is the predominant isoform expressed in neurons. These findings provided the rationale for studying an isoform 1 transgene in our current stress protection experiments.
It is now possible to hypothesize about the mechanism by which the DSCR1 (Adapt78) protein calcipressin 1 may protect cells against transient oxidative stress or calcium stress. It is well documented that oxidant insults in PC-12 cells involve large increases in intracellular Ca2+ (33
, 34)
, therefore the effects of oxidants or Ca2+ excess might be mediated through the same pathways. We earlier showed that several of the genes induced during adaptation to oxidative stress are actually calcium-inducible genes (29
, 35
36
37
38
39
40)
and, of course DSCR1 (Adapt78) itself is a calcium-inducible gene (1
, 2)
.
During oxidative stress the serine-threonine phosphatase calcineurin is stimulated by calmodulin binding in a process that is activated by calcium excess. Since high calcineurin activity can lead to apoptosis (15
, 41)
, inhibition of calcineurin should be beneficial to cells, and we demonstrate here that overexpression of the DSCR1 (Adapt78) calcineurin inhibitory protein calcipressin 1 can actually rescue PC-12 cells from Ca2+-induced death. This agrees with previous findings that exogenous calcineurin inhibitors can protect astrocytes against Ca2+-induced apoptosis (41)
. In the present study, we found that DSCR1 (Adapt78) overexpression can protect PC-12 cells from hydrogen peroxide damage. Thus, it is most likely that DSCR1 (Adapt78) can protect cells against multiple stresses mediated by calcium. Although the exact mechanism of DSCR1 (Adapt78)/calcipressin 1 protection against stress has not yet been proved, it is likely to involve signal transduction pathways that are activated by kinases. Many inducible, protective cellular stress responses are mediated by a variety of kinases whose activity is opposed by phosphatases (39
, 40)
. Thus, in a very simplistic model, DSCR1 (Adapt78)/calcipressin 1 may protect against calcium-mediated stresses by antagonizing calcineurin and permitting kinases to activate the expression of various defensive genes.
We now report that DSCR1 (Adapt78) mRNA isoform 1 significantly stimulates growth of PC-12 cells. Although we have not tested the mechanism of this phenomenon, we can speculate that binding and regulation of calcineurin might be not the only function of DSCR1 (Adapt78)/calcipressin 1. It was recently demonstrated that a stretch of
80 amino acids near the NH2 terminus of DSCR1 (Adapt78) protein family members shows similarity with an RNA recognition motif (42)
. This motif is found in many RNA binding proteins and in a few single-stranded DNA binding proteins; it is possible that DSCR1 (Adapt78) mRNA may bind to RNA or DNA and regulate expression of genes involved in cell proliferation. The possibility that calcipressin 1 may function as an as RNA or DNA binding protein has not yet been properly tested.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G. Ermak, K. J. Hench, K. T. Chang, S. Sachdev, and K. J. A. Davies Regulator of Calcineurin (RCAN1-1L) Is Deficient in Huntington Disease and Protective against Mutant Huntingtin Toxicity in Vitro J. Biol. Chem., May 1, 2009; 284(18): 11845 - 11853. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. HATA, Y. WATANABE, H. NAKAI, T. MINAMI, H. OHSAKI, E. HIRAKAWA, and H. HOSHIAI Association of Metastin/a G-protein-coupled Receptor Signaling and Down Syndrome Critical Region 1 in Epithelial Ovarian Cancer Anticancer Res, February 1, 2009; 29(2): 617 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, D. Zhao, L. Qin, J. Li, and H. Zeng Transcription Enhancer Factor 3 (TEF3) Mediates the Expression of Down Syndrome Candidate Region 1 Isoform 1 (DSCR1-1L) in Endothelial Cells J. Biol. Chem., December 5, 2008; 283(49): 34159 - 34167. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Mahoney, A. Safdar, G. Parise, S. Melov, M. Fu, L. MacNeil, J. Kaczor, E. T. Payne, and M. A. Tarnopolsky Gene expression profiling in human skeletal muscle during recovery from eccentric exercise Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1901 - R1910. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Mellstrom, M. Savignac, R. Gomez-Villafuertes, and J. R. Naranjo Ca2+-Operated Transcriptional Networks: Molecular Mechanisms and In Vivo Models Physiol Rev, April 1, 2008; 88(2): 421 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stie and D. Fox Calcineurin Regulation in Fungi and Beyond Eukaryot. Cell, February 1, 2008; 7(2): 177 - 186. [Full Text] [PDF] |
||||
![]() |
T. Kishi, A. Ikeda, R. Nagao, and N. Koyama The SCFCdc4 ubiquitin ligase regulates calcineurin signaling through degradation of phosphorylated Rcn1, an inhibitor of calcineurin PNAS, October 30, 2007; 104(44): 17418 - 17423. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. A. Davies, G. Ermak, B. A. Rothermel, M. Pritchard, J. Heitman, J. Ahnn, F. Henrique-Silva, D. Crawford, S. Canaider, P. Strippoli, et al. Renaming the DSCR1/Adapt78 gene family as RCAN: regulators of calcineurin FASEB J, October 1, 2007; 21(12): 3023 - 3028. [Full Text] [PDF] |
||||
![]() |
C. R. Bush, J. M. Havens, B. M. Necela, W. Su, L. Chen, M. Yanagisawa, P. Z. Anastasiadis, R. Guerra, B. A. Luxon, and E. A. Thompson Functional Genomic Analysis Reveals Cross-talk between Peroxisome Proliferator-activated Receptor {gamma} and Calcium Signaling in Human Colorectal Cancer Cells J. Biol. Chem., August 10, 2007; 282(32): 23387 - 23401. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Porta, S. A. Serra, M. Huch, M. A. Valverde, F. Llorens, X. Estivill, M. L. Arbones, and E. Marti RCAN1 (DSCR1) increases neuronal susceptibility to oxidative stress: a potential pathogenic process in neurodegeneration Hum. Mol. Genet., May 1, 2007; 16(9): 1039 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qin, D. Zhao, X. Liu, J. A. Nagy, M. V. Hoang, L. F. Brown, H. F. Dvorak, and H. Zeng Down Syndrome Candidate Region 1 Isoform 1 Mediates Angiogenesis through the Calcineurin-NFAT Pathway Mol. Cancer Res., November 1, 2006; 4(11): 811 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Sanna, E. B. Brandt, R. A. Kaiser, P. Pfluger, S. A. Witt, T. R. Kimball, E. van Rooij, L. J. De Windt, M. E. Rothenberg, M. H. Tschop, et al. Modulatory calcineurin-interacting proteins 1 and 2 function as calcineurin facilitators in vivo PNAS, May 9, 2006; 103(19): 7327 - 7332. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Miller and H. J. Federoff Altered Gene Expression Profiles Reveal Similarities and Differences Between Parkinson Disease and Model Systems Neuroscientist, December 1, 2005; 11(6): 539 - 549. [Abstract] [PDF] |
||||
![]() |
B. Chan, G. Greenan, F. McKeon, and T. Ellenberger Identification of a peptide fragment of DSCR1 that competitively inhibits calcineurin activity in vitro and in vivo PNAS, September 13, 2005; 102(37): 13075 - 13080. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cano, A. Canellada, T. Minami, T. Iglesias, and J. M. Redondo Depolarization of Neural Cells Induces Transcription of the Down Syndrome Critical Region 1 Isoform 4 via a Calcineurin/Nuclear Factor of Activated T Cells-dependent Pathway J. Biol. Chem., August 19, 2005; 280(33): 29435 - 29443. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ejima, M. Tsuda, S. Takeo, K. Ishii, T. Matsuo, and T. Aigaki Expression Level of sarah, a Homolog of DSCR1, Is Critical for Ovulation and Female Courtship Behavior in Drosophila melanogaster Genetics, December 1, 2004; 168(4): 2077 - 2087. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. ERMAK, C. CHEADLE, K. G. BECKER, C. D. HARRIS, and K. J. A. DAVIES DSCR1(Adapt78) modulates expression of SOD1 FASEB J, January 1, 2004; 18(1): 62 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Chang, Y.-J. Shi, and K.-T. Min The Drosophila homolog of Down's syndrome critical region 1 gene regulates learning: Implications for mental retardation PNAS, December 23, 2003; 100(26): 15794 - 15799. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |