(The FASEB Journal. 2002;16:761-770.)
© 2002 FASEB
Enhancement of p53 activity and inhibition of neural cell proliferation by glucocorticoid receptor activation
CHRISTOPHE CROCHEMORE,
THEOLOGOS M. MICHAELIDIS,
DIETER FISCHER,
JEAN-PHILIPPE LOEFFLER* and
OSBORNE F. X. ALMEIDA1
Max Planck Institute of Psychiatry, 80804 Munich, Germany; and
* Faculty of Medicine, Louis Pasteur University, 67000 Strasbourg, France
1Correspondence: Max Planck Institute of Psychiatry, Kraepelinstrasse 210, D-80804 Munich, Germany. E-mail: osa{at}mpipsykl.mpg.de
 |
ABSTRACT
|
|---|
In analyzing the molecular mechanisms underlying glucocorticoid-induced apoptosis in neural cells, we observed that dexamethasone, by activating glucocorticoid receptors, causes arrest of HT-22 cells in the G1 phase of the cell cycle; upon withdrawal of the agonist, cells resume proliferation. Our investigations revealed that glucocorticoid treatment, although having no effects on endogenous p53 protein stability, induces rapid translocation of p53 to the nucleus and enhances its transcriptional activity. Consistently, transfection studies with p53-responsive promoters revealed a substantial stimulation of the trans-activation potential of exogenous p53 by dexamethasone. Cells arrested in G1 failed to show signs of apoptosis even after overexpression of p53. Although dexamethasone induced transcription of the proapoptotic gene bax, there was no increase of Bax protein levels. We conclude that glucocorticoid receptor-induced neural cell cycle arrest is associated with an increase in nuclear translocation and transcriptional activity of p53, and suggest that potentiation of p53 may serve as a brake on cell proliferation and may prime cells for differentiation or death induced by other signals.Crochemore, C., Michaelidis, T. M., Fischer, D., Loeffler, J. -P., Almeida, O. F. X. Enhancement of p53 activity and inhibition of neural cell proliferation by glucocorticoid receptor activation.
Key Words: corticosteroid cell cycle arrest apoptosis HT-22 neural cell line
 |
INTRODUCTION
|
|---|
CELL PROLIFERATION, DIFFERENTIATION, and death allow organ remodeling throughout life. These processes, which may show spatio-temporal overlapping, normally occur according to strictly regulated inherent programs whose execution depends on signals from neighboring cells as well as the external environment. Glucocorticoids (GC) have long been known to influence cell proliferation and fate; the majority of information relating to the underlying mechanisms of action derives from work on immune cells (1
, 2)
. GC are increasingly being recognized as key players in the development and maintenance of brain structures, particularly the hippocampus. Thus, in vivo activation of glucocorticoid receptors (GR) attenuates neurogenesis (3)
, possibly by exerting antiproliferative effects on neuronal progenitor cells. At the same time, GR activation results in significant hippocampal cell loss (4
5
6
7)
at least partly through apoptotic mechanisms (8
, 9)
. Since a sizable number of hippocampal cells succumbing to GR-mediated apoptosis are located in the germinative or subgranular layer of the dentate gyrus, we had suggested that dividing or newly born granule cells might be glucocorticoid targets (8)
. Besides their actions on neural cell proliferation and death, glucocorticoids are involved in the differentiation of neural cells (10
, 11)
.
The molecular mechanisms underlying the effects of GC on neuronogenesis and neuronal survival are unknown. Since GR are ligand-dependent transcription factors (12)
, elucidation of GR-related transduction pathways is a challenging task. Our group has shown that administration of the highly specific GR agonist dexamethasone (DEX) to rats results in apoptosis in the hippocampus; the apoptosis was associated with alterations in the ratio of pro- (Bax) to anti-apoptotic (Bcl-2, Bcl-XL) molecules (9)
. We also demonstrated that Bax is essential for GC-induced apoptosis and that DEX treatment results in increased expression of the tumor suppressor protein p53. Other studies have implicated p53 in regulating neuronal cell numbers after manipulation of the glucocorticoid milieu. Adrenalectomy, which induces both cell death (13
, 14)
and neurogenesis (3)
in the hippocampus, is accompanied by increased p53 gene expression (15)
. Against this background and because p53 is a key player in the regulation of the proliferation and death of various neural and non-neural cells (16
17
18)
, we hypothesized that p53 may serve as the key link in GC-associated cell death, ultimately effected by its downstream target Bax in the hippocampus. In proliferating cells (including neurons), however, another p53-responsive gene p21WAF1/CIP1 is a critical player in establishment of the postmitotic/differentiated state (19
20
21
22)
.
The present studies were carried out on a cycling mouse neural cell line (HT22). We observed that rather than leading to cell death, DEX treatment results in an arrest of the cell cycle. The cells were arrested in G1, which, at least in non-neural cells, represents a critical phase when the cell must choose between cell cycle progression and quiescence (16
17
18
, 23)
. Since p53 plays a major role in this decision process, we examined the potential of GR to influence the transcriptional activity of p53 on cell cycle- or apoptosis-related genes. Indeed, GR activation by DEX was found to induce the translocation of p53 to the nucleus, enhance transcription of p53-responsive genes p21, GADD45, and bax (24
, 25)
, and increase the trans-activation potential of exogenous p53. Understanding how hormonal signals are transduced to the apoptotic or cell cycle regulatory machinery is important for elucidation of the mechanisms underlying neurogenesis/differentiation and neurodegeneration (e.g., priming cells for death induced by other signals).
 |
MATERIALS AND METHODS
|
|---|
Cell lines
The neural cell line HT-22 (26
, 27)
and a human osteosarcoma cell line (Saos-2) were used. Cells were grown on either plastic or glass (Cell Locate®, Eppendorf, Hamburg, Germany) surfaces. All cell culture reagents were purchased from Life Technologies (Eggenstein, Germany) unless specifically mentioned otherwise. Cells were initially grown at 37°C (5% CO2) in Dulbeccos modified medium (DMEM) supplemented with 4.5 g/L D-glucose, 1% kanamycin, 110 mg/L sodium pyruvate, Glutamax I, and 10% fetal calf serum (FCS). After 24 h, cells were transferred to the above medium supplemented with 10% dextran/charcoal-stripped bovine calf serum (BCS; Sigma Chemical Co., Deisenhofen, Germany; cortisol and corticosterone concentrations<1 nmol).
Treatments
Cells were exposed to the GR agonist DEX for 13 days. DEX (Fortecortin®, Merck, Darmstadt, Germany) was used at a final concentration of 10-6 M; this dose was found to produce consistent results in preliminary dose-response studies. GR activation was antagonized by pretreating cells for 2 h with RU38,486 (10-6 M in ethanol at a final concentration of 0.001%; Roussel-Uclaf, Romainville, France).
Cell counts and cell cycle analysis
At various intervals, HT22 cells were trypsinized (0.25% trypsin in Ca2+/Mg2+-free phosphate-buffered saline [PBS]) and resuspended in 1 mL of DMEM containing 0.04% trypan blue. Viable cells were counted using a hemocytometer.
For FACS analysis, cells were washed once with PBS, trypsinized as above, harvested in DMEM/10% FCS, and centrifuged (150 g, 3 min, RT). The resulting pellet was resuspended in 100 µL 0.1M PBS and added to 900 µL of cold lysis buffer (0.1M PBS containing 0.1% sodium citrate and 0.1% Triton X-100). After addition of propidium iodide (10 µg/mL; Sigma), the cell suspension was vortexed and incubated in the dark for at least 1 h (4°C). Cell cycle analysis was performed using a Coulter EPICS XL flow cytometer (flow rate of 250 cells/s; 15,000 events recorded, with single events representing 9098% of the total populations analyzed). All parameters were measured on a linear scale and data were analyzed using Multicycle Software® (Phoenix Flow Systems, San Diego, CA).
Plasmids
The following plasmids were used: pBax-CAT (25)
, p53wt (expressing wild-type p53), p53
(expressing a point mutant of p53 that does not bind DNA) (28)
, p53-RE-CAT (PG13-CAT, a typical p53 reporter construct which contains multiple p53 binding sites linked to a basal promoter) and its negative control p53-RE
-CAT (MG15-CAT) (29)
, pCMV-hGR (30)
, and pCMV-EGFP (Clontech, Heidelberg, Germany).
Transfection and reporter assays
One day before transfection with polyethylenimine (PEI; Eurogentec, Illkirch, France), HT-22 cells were seeded in DMEM-10% FCS at 70% confluence (150,000 cells/mL) in 6-well plates. The transfection procedure was performed as described (31)
. Transfection mixture containing 0.21.5 µg (see figure legends) was added to each culture well. After centrifugation (5 min, 250 g, RT), cells were returned to the incubator (37°C, 5% CO2) for 70 min, washed with DMEM, and incubated with stripped BCS-DMEM. DEX (10-6 M) was added to the cells 30 h before assessment of chloramphenicol acetyltransferase (CAT) activity (32)
. Cells were harvested with a rubber policeman and resuspended in 110 µL Tris HCl (250 mM, pH 7.4) before being subjected to 5 freeze-thaw cycles (liquid N2/37°C). The resulting extract was heated at 65°C for 5 min and centrifuged (20,000 g, 8 min, 4°C). The supernatant was collected, one aliquot of which was used to determine protein content (33)
. To another aliquot (90 µL), 10 µL Tris-HCl (250 mM pH 7.4) containing 0.1 mCi [14C]chloramphenicol (47 mCi/mmol; Amersham, Braunschweig, Germany) and 4 mM acetyl-coenzyme A (Sigma) were added. This latter mixture was incubated for 1 h (37°C) before adding 200 µL TMPD/xylene (1 part 2,6,10,14-tetramethyl-pentadecane: 2 parts xylene; Sigma). After thorough mixing (2x15 s) and centrifugation (10000 g, 3 min, RT), 150 µL of the aqueous phase was removed and prepared for liquid scintillation counting.
RT-PCR
Relative levels of bax, p53, p73, p21, and GADD45 mRNA were measured using semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), where GAPDH mRNA levels served as the internal standard. Total RNA, free from chromosomal DNA contamination, was isolated and reverse transcribed with SUPERSCRIPTTM II RNA H-reverse transcriptase (Life Technologies) using oligo-dT1218 primers (MWG Biotech, Ebersberg, Germany). The gene-specific primers used were:
Murine bax (315 bp) sense 5' GGATGCGTCCACCAAGAAGC 3' antisense 5' CACCCTGGTCTTGGATCCAG 3';
Murine p21(313 bp) sense 5' AGTATGCCGTCGTCTGTTCGGTC 3' antisense 5' CCAGAGTGCAAGACAGCGACAAG 3';
Murine p73 (380 bp) sense 5' AGTTCAATTTGCTCAGCAGTGC 3' antisense 5' TGTCGGTCACATGCTCTGCCTT 3';
Murine p53 (380 bp) sense 5'CCGAGGCCGGCTCTGAGTATACCACCATCC 3' antisense 5' CTCATTCAGCTCCCGGAACATCTCGAAGCG 3';
Murine GADD45 sense 5' CTGGAGGAAGTGCTCAGCAAGG 3' antisense 5' CTGATCCATGTAGCGACTTTCC 3'.
RT-PCR was performed as described (9)
. Optimal amplifications of bax, p53, p73, p21, and GADD45 were achieved after 24, 28, 30, 28, and 26 PCR cycles, respectively, using the following conditions: denaturation for 40 s at 94°C; annealing for 40 s at 56°C (bax), 62°C (p21WAF1/CIP1), 65°C (p53), 58°C (p73), or 59°C (GADD45); primer extension for 2 min at 72°C. PCR products were electrophoresed on agarose gels, stained with ethidium bromide, and visualized under UV light. Intensities of amplified bax, p21, p53, p73, and GADD45 were normalized against those obtained for GAPDH in the same sample. Linearity of PCR amplifications was verified by amplifying serial dilutions of reverse transcribed cDNA.
Nuclear and cytoplasmic extracts were made as described previously (34)
. For total protein extracts, cells were lysed (0.1M Tris HCl, 250 mM NaCl, 1% Nonidet P-40, 1 mM EDTA, and protease inhibitor mixture; Perbio, Bonn, Germany), centrifuged (8 min, 20,000 g, 4°C), and supernatants containing equal amounts of protein were subjected to gel electrophoresis and transferred onto PVDF membranes (Bio-Rad, Munich, Germany). Blots were incubated in blocking buffer (5% dried nonfat milk in 1x PBS/0.2% Tween 20) and incubated with one of the following antisera: polyclonal anti-GR (1:2000; Santa Cruz Biotechnologies, Santa Cruz, CA), monoclonal anti-p53 (1:2000; Santa Cruz Biotechnology), monoclonal anti-p21 (1:500; PharMingen, Heidelberg, Germany), polyclonal anti-Bax (1:1000; PharMingen) and monoclonal anti-actin (0.2 µg/mL; Roche, Mannheim, Germany). Blots were washed before incubation with horseradish peroxidase-labeled secondary antibodies (Amersham; 1:2500 for 1 h at RT) and specific protein bands were detected using chemoluminescence (ECL-Plus, Amersham). Densitometry was used to obtain semiquantitative levels of the various proteins after correction for differences in actin levels in individual samples.
TUNEL reaction
Apoptosis was detected using TUNEL histochemistry (35)
on cells grown on gelatin/poly-D-lysine-coated glass coverslips and fixed in 0.1 M PBS containing 4% paraformaldehyde (10 min at RT). After rinsing in PBS and permeabilization (2 min in ice-cold PBS+0.1% sodium citrate+0.1% Triton X-100), coverslips were incubated in PBS containing 1% H2O2 (3 min) and rinsed twice with PBS. TUNEL reaction was performed for 1 h at 37°C in a solution containing terminal deoxynucleotidyl transferase (TdT; 0.15 U/µL; MBI Fermentas, Heidelberg, Germany), TdT buffer, and biotin-16-dUTP (0.01 pmol/µL; Roche). After thorough washing, coverslips were washed with PBS and incubated (1 h; RT) in streptavidin-coupled peroxidase (1:200; Sigma), 0.1% Triton X-100 in 4x SSC. After three washes, peroxidase activity was revealed with Tris-buffered 3,3'-diaminobenzidine tetrahydrochloride (0.025%; Sigma). Cell preparations were then dehydrated, cleared, mounted, and examined microscopically.
Detection of nuclear p53 by immunofluorescence
Control and DEX-treated HT-22 cells were fixed briefly in methanol/acetone (RT), washed, permeabilized with PBS+1% horse serum+0.5% BSA+0.1% Triton X-100, washed, and incubated with anti-p53 (Ab1, 2 µg/mL, 2 h, RT; Oncogene, Schwalbach, Germany). After incubation with avidin-conjugated anti-mouse IgG (Sigma), specimens were incubated with fluorescein-conjugated biotin (Vector, Burlingame, CA) and mounted in anti-fading medium before microscopic examination. HT-22 cells treated with doxorubicin (0.2 µg/mL; Adrimedac® Medac, Hamburg, Germany) served as positive controls.
Data analysis
All experiments were repeated (36 replicates per run) on at least three separate occasions. Quantitative and semiquantitative values were subjected to ANOVA, followed by appropriate post hoc testing (P<0.05).
 |
RESULTS
|
|---|
Dexamethasone inhibits HT-22 cell proliferation without inducing apoptosis
We have shown that GR activation leads to apoptosis in a subpopulation of rat hippocampal cells in vivo (9)
. Using a mouse neural cell line (HT-22) demonstrated to express functional GR (36)
, we observed that treatment with the GR agonist DEX (1 µM in charcoal-stripped, steroid-depleted medium) results in pronounced inhibition of cell proliferation. Phase contrast microscopy revealed that in the presence of DEX, HT-22 cells failed to reach confluency even after an extended period in culture (Fig. 1
A). As measured by the trypan blue exclusion test, the number of cells in DEX-treated cultures was reduced by 30% (48 h) and 42% (72 h) (Fig. 1B
; lower panel). Inhibition of cell proliferation was not observed when DEX was added to HT-22 cells growing in unstripped serum-supplemented medium (Fig. 1B
, upper panel), suggesting that steroids present in normal medium may counteract actions of the GR agonist. The DEX-induced reduction in total cell number was not due to a demise of cells through apoptosis (Fig. 1C
).

View larger version (76K):
[in this window]
[in a new window]
|
Figure 1. Phase contrast microscopy demonstrating that exposure of HT-22 cells to DEX (10-6 M) results in reduced cell proliferation when the drug is added to charcoal-stripped, serum-supplemented DMEM (lower panel); results from untreated cells are shown in the upper panel. Cells were grown on Cell Locate® coverslips, allowing the same starting population of cells to be monitored sequentially (A). Temporal pattern of cell numbers (trypan blue dye exclusion test) in DEX-treated (10-6 M) HT-22 cells. Upper panel: DMEM+unstripped FCS; lower panel: DMEM+charcoal-stripped FCS. Note the different scales in the two panels (P 0.05: upper vs. lower panels for all treatment conditions and time points) (B). Treatment with DEX (10-6 M in charcoal-stripped serum-supplemented DMEM) does not result in increased apoptosis. Representative photomicrographs of cultures processed for TUNEL histochemistry as well as numbers of healthy vs. apoptotic cells as a function of time are shown. Arrows indicate TUNEL-positive cells (C).
|
|
GR activation leads to reversible arrest in the G1 phase of the cell cycle
Flow cytometric analysis revealed that DEX-treated HT-22 cells arrest in G1 phase of the cell cycle with a concomitant reduction in the fraction of cells in the S phase (Fig. 2
A). As shown in Fig. 2B
, the percentage of cells in G1 steadily increased over time, whereas that of cells in S phase declined; the earliest inhibition of cell proliferation was observed at 12 h. Next, we examined whether the DEX-induced cell cycle arrest in HT-22 cells was due to the trans-activation properties of GR by comparing the effects of DEX with those of the GR antagonist RU38,486 (37)
. As shown in Fig. 2C
, the ability of DEX to inhibit cell proliferation was significantly attenuated (P
0.05) in the presence of RU38,486, indicating that the DEX effects observed result from activation of the glucocorticoid receptor. The slight increase of cells arrested in G1 phase observed after treatment with RU38,486 alone is consistent with the antagonists partial agonistic properties (38)
.
GR activation has been shown to induce reversible arrest of the cell cycle in G1 in many cell types of non-neural origin (39
40
41)
. Glucocorticoids have also been shown to cause irreversible apoptotic cell death (42
43
44
45)
. Our failure to observe apoptosis in HT-22 cells after DEX treatment (Fig. 1C
) suggested that the cell cycle arrest observed might be reversible after glucocorticoid withdrawal. To test this, we examined whether different durations of exposure to and withdrawal from DEX influenced the proportion HT-22 cells in the G1 phase. As depicted in Fig. 3
A, even after 48 h of continuous exposure to DEX, HT-22 cells were able to progress through G1 after removal of the glucocorticoid, restarting mitosis within 24 h of DEX withdrawal (columns A and D in Fig. 3A
).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 3. Induction of HT-22 cell cycle arrest by DEX is dependent on the continuous presence of the glucocorticoid in the culture medium. Cells were exposed to DEX (10-6 M) for various durations, after which drug-containing medium was replaced with DEX-free medium. In all cases, FACS analysis was performed after 72 h in culture (A). Representative Western blot showing that continuous exposure of HT-22 cells to DEX results in a down-regulation of GR. Note that changes in GR concentration do not interfere with the ability of DEX to cause arrest of the cell cycle (Fig. 2B
), and that constant exposure to DEX is necessary to maintain cells in the arrested state (B; cf. panel A).
|
|
In line with earlier observations (46)
immunoblot analysis revealed significant DEX-induced down-regulation of GR (Fig. 3B
). This down-regulation did not, however, interfere with the antiproliferative actions of DEX; as shown in Fig. 3A
, DEX must be continuously present to keep cells arrested at G1.
GR activation is associated with nuclear translocation and activation of p53
GR-induced growth arrest suggested that essential cell cycle regulatory components might be influenced. This prompted us to test whether GR activation might influence the activity of p53 (see ref 9
). RT-PCR analysis revealed that DEX treatment resulted in small but significant increases in the endogenous mRNA levels of three key downstream transcriptional targets of p53: GADD45, p21, and bax (Fig. 4
A).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 4. Up-regulation of mRNA levels for various p53-responsive genes by DEX (10-6 M; 24 h). Data represent semiquantitative RT-PCR product analyses (mean±SE, n= 36), normalized for corresponding mRNA expression in control cultures. *P 0.05 vs. non-DEX-treated cells (A). Representative immunoblots (upper panel) and semiquantitative data from immunoblot analyses (lower panel) demonstrating that DEX treatment (10-6 M, up to 48 h) does not influence p53 levels in HT-22 (data shown are mean±SE, n= 4 (B). GR activation by DEX in HT-22 cells induces translocation of p53 from its cytoplasmic localization to the nucleus. p53 was revealed by immunofluorescence. For comparison, the mobilization of p53 after exposure of HT-22 cells to doxorubicin (DOX) is shown (C). Representative Western blots demonstrating the time course of GR and p53 nuclear translocation after exposure of HT-22 cells to DEX. D) Semiquantitative kinetic analysis of mobilization of GR and p53 from the cytoplasm to nucleus in DEX-treated HT-22 cells (0, 30 min, 2, 6, and 24 h); the data, presented as log changes from CON (non-DEX-treated cells), represent means from two independent experiments in which proteins in the different cell compartments were assayed by Western blotting (E; cf. panel B).
|
|
We next examined whether the increased response to p53 resulted from its increased expression and/or translocation into the nucleus. No significant changes in p53 mRNA (data not shown) or protein levels (Fig. 4B
) were observed in DEX-treated HT-22 cells at the times investigated. However, immunofluorescence microscopy revealed translocation of p53 to the nucleus in 8090% of cells after a 24 h exposure to DEX (Fig. 4C
). As a positive control in these studies, HT-22 cells were treated with doxorubicin (0.2 µg/mL), an established inducer of p53 activity (Fig. 4C
). These morphological observations were further supported by immunoblot analysis of cytoplasmic and nuclear extracts shown in Fig. 4D, E
. Mobilization of p53 was temporally associated with translocation of GR to the nucleus. Increased nuclear localization of GR and p53 first occurred within 30 min of DEX application; maximum transport of GR and p53 to the nuclear compartment was observed by 6 h after exposure to DEX, i.e., preceding the first indications of cell growth arrest by
2 h (Fig. 2B
).
Activation of GR enhances the transcriptional activity of p53 in HT-22 cells
To assess whether activation of GR directly influences the trans-activation potential of p53, we performed transfection experiments with vectors expressing wild-type (p53wt) or a mutated, inactive form of p53 (p53
; ref 28
) and a plasmid carrying the p53-responsive promoter of the human bax gene (25)
upstream of the bacterial chloramphenicol CAT gene as the reporter (pBax-CAT). As expected, expression of wild-type, but not mutant, p53 resulted in > 10-fold induction of the pBax-CAT reporter (Fig. 5
A). The presence of DEX substantially increased p53 activity (
4.5-fold); this effect was efficiently blocked by the GR antagonist RU38,486 (Fig. 5A
). The same analysis was performed using an artificial p53-responsive promoter (29)
containing multiple p53 binding sites different from those of bax but similar to the consensus sequence (p53-RE-CAT). Again, DEX treatment resulted in a significant (threefold) stimulation of the p53-mediated induction of the p53-RE-CAT reporter (Fig. 5B
). These observations indicate that activated GR enhances the trans-activation properties of p53 independent of the promoter context and is not limited to a single target sequence (see ref 47
). In contrast to these observations with HT-22 cells, when p53 was overexpressed in p53-deficient Saos-2 cells (48)
, a decrease rather than an increase in the trans-activation potential of p53 was observed (Fig. 5C
), reminiscent of earlier observations with fibroblasts (49)
. The contrasting findings in Saos-2 and HT-22 cells underscore the cell type specificity of p53GR interactions.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 5. Potentiation of p53 activity by activated GR as seen on the pBax-CAT reporter. HT-22 cells were transiently transfected with 0.25 µg of the pBax-CAT reporter plasmid and 0.25 µg of plasmids encoding either wild-type (p53wt) or mutant p53 (p53 , that does not bind to DNA). Transfected cells were exposed (30 h) to DEX (10-6 M) ± the GR antagonist RU38,486 (10-6 M) before being assayed for CAT activity (see Materials and Methods). Note that RU38,486 significantly attenuated DEX-induced potentiation of p53 transcriptional activity. Values represent mean ± SE from 46 independent experiments (each with triplicate determinations). Asterisks represent significant differences (P<0.05) from the corresponding controls. The inset shows a dose-response curve for GR activation by DEX and the activity of the bax promoter (A). Potentiation of p53 by GR is not promoter context-dependent. HT-22 cells were transfected, as above, with a p53-RE-CAT reporter plasmid carrying multiple repeats of a p53 binding site and either the wild-type or mutant p53 expression vector (as above) (B). GR activation decreases the trans-activation potential of p53 in the p53-deficient human osteosarcoma cell line Saos-2. Cells were transfected with 0.25 µg p53-RE-CAT and 0.25 µg of either wild-type or mutant p53 (as above). In parallel experiments, transfections also included 0.2 µg plasmid expressing the human GR. Data are representative of 3 independent experiments (each in triplicate) (C).
|
|
Mechanisms operating downstream of p53 provide an additional point of control on cell fate
Activation of p53 can lead to cell cycle arrest or apoptosis. These two phenomena seem to be mediated by different pathways (50)
. Induction of Bax by p53 is considered a crucial step in the promotion of apoptosis, whereas cell cycle arrest is frequently associated with induction of the cyclin-dependent kinase inhibitor p21 (51)
. Although p21 and bax mRNA levels were both elevated in HT-22 cells after stimulation of p53 by DEX (see Fig. 4A
), our results show that the pathway(s) leading to cell cycle arrest prevail over those leading to apoptosis. However, exposure of HT-22 cells to DEX for 24 and 48 h resulted in a significant up-regulation of p21 protein but not of Bax (Fig. 6
A). Cotransfection studies using a Bax expression vector and a fluorescent marker (EGFP) demonstrated that Bax-dependent apoptotic pathway(s) are intact in HT-22 cells. As shown in Fig. 6B
, the number of surviving HT-22 cells was markedly reduced after overexpression of Bax, implying that Bax levels might be critical in determining cell survival. These observations may explain the inability of DEX to promote cell death in HT-22 cells, suggesting an additional level for controlling Bax expression, downstream of its transcriptional induction by p53 (see ref 52
).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 6. Exposure of HT-22 cells to DEX results in stimulation of p21 (upper panel), but not Bax (lower panel), protein levels (A). The Bax-dependent apoptotic pathway is intact in HT-22 cells. Compared to cells expressing EGFP alone (fluorescent cells in upper panel), HT-22 cells expressing EGFP and Bax displayed dramatic cell death, as indicated by the loss of fluorescent cells (lower panel). All transfections performed when cultures had reached 70% confluence. Cell counts of untransfected and transfected (EGFP+empty vector or EGFP+BAX vector) are shown in the histograms where data represent means ± SE (P 0.05 in EGFP+BAX-transfected cells vs. EGFP-empty plasmid-transfected cells) (B).
|
|
 |
DISCUSSION
|
|---|
Glucocorticoids exert antiproliferative effects in many cell types by inhibiting cell cycle progression or inducing cell death. Our recent studies of the rodent hippocampus in vivo revealed that the GR agonist DEX can lead to apoptosis in neuronal cells also (8
, 9)
, albeit through as yet undefined mechanisms. Here we report that contrary to our expectation, DEX fails to induce apoptosis in the mouse neural cell line HT-22, but instead leads to a marked reduction in cell proliferation, with cells being arrested in the G1 phase of the cell cycle. The cell cycle arrest is a GR-mediated event insofar as it can be attenuated by the GR antagonist RU38,486. To our knowledge, this is the first report demonstrating GR-mediated cell cycle arrest in a neural cell.
Our study also shows that maintenance of cells in the arrested state depends on the continuous presence of DEX in the culture medium. This requirement was sustained even after GR had been substantially down-regulated. This observation suggests that a relatively small number of receptors is sufficient for the antiproliferative action of DEX to be manifest. The issue of GR concentrations is important because the levels of glucocorticoid receptors fluctuate during development (53)
, aging (54)
, and the cell cycle (55
, 56)
. Other authors working with lymphoid cells have suggested that GR down-regulation may serve to protect cells from glucocorticoid-induced cell death (57)
. Since cell cycle arrest might be a way to circumvent cell death, the present results imply that similar, but not identical (e.g., the need for continuous ligand availability), mechanisms might operate in neural cells.
On the basis of the observations that GR activation leads to either cell cycle arrest or apoptosis, it was deemed useful to analyze which regulatory components of these two processes might be involved. A key molecule that has the potential to regulate both of the above processes is the tumor suppressor p53, a transcription factor that binds to DNA in a sequence-specific manner, inducing or repressing the expression of target genes (16
, 58
, 59)
. Previous in vivo findings that DEX treatment results in elevated levels of p53 in the rat hippocampus (9)
also suggest p53 to be a likely player in GR-mediated growth arrest. Among the established p53-responsive genes that mediate the effects of p53 are p21, bax, and GADD45. In agreement with our hypothesis, significant increases in the mRNA levels of all these genes were observed. The p53 homologue p73, which trans-activates p53 target genes such as p21 and bax and induces apoptosis and growth suppression (60
, 61)
, was not detected in HT-22 cells under any culture conditions (T. M. Michaelidis, C. Crochemore, and D. Fischer, unpublished observations). Thus, the increased expression of p21, bax, and GADD45 most likely results from stimulation of p53 transcriptional activity by DEX. Subsequent transfection experiments revealed that GR activation indeed causes a substantial increase in the activity of exogenously introduced p53 on two different promoters: the bax promoter (25)
and a synthetic promoter (29)
. In the first case, transcriptional activation is mediated by a cooperative induction of three adjacent p53 half-sites that are not very similar to the consensus (47)
, whereas the synthetic promoter contains multiple p53 binding sites similar to the consensus sequence (29)
. The observation that DEX enhanced the transcriptional activity of p53 on both promoters ruled out the possibility that potentially cryptic cis-acting elements might be responsible for the stimulation of the p53-mediated transcription, supporting our conjecture that activation of GR directly influences the trans-activation potential of p53 protein.
How can activated GR potentiate the activity of p53? It is generally accepted that normally inactive p53 can be rapidly activated by a variety of stimuli (16
17
18
, 62)
. Activation of p53 usually involves alterations in the stability of the protein and its mobilization to the nucleus. Here we show that activation of GR in HT-22 cells did not increase mRNA or protein levels of p53. However, the treatment induced rapid translocation of p53 into the nucleus, as revealed by immunofluorescence and immunoblot analysis. Nuclear translocation of GR and p53 occurred contemporaneously, suggesting that physical interactions between these two transcriptional factors can occur (see ref 63
). Post-translational modifications are necessary for converting p53 into a transcriptionally competent form (64
, 65)
. Our data cannot rule out the possibility that GR activation may induce a qualitative conversion of p53 from a latent to an active form by influencing its phosphorylation, acetylation, or glycosylation status.
In contrast to what we observed with mouse-derived HT-22 cells, activation of GR in a non-neural human cell line (Saos-2) revealed an inhibitory effect on p53 activity. Together with previous reports showing an inhibitory effect of GR on p53 activity in fibroblasts (49)
and human neuroblastoma cell lines (66)
, these observations suggest a cell type- and/or species-specific mode of interaction between GR and p53. In addition to their DNA-recognition sequences, both transcription factors require proteinprotein interaction with basal transcription factors and numerous accessory proteins (67)
. The existence of tissue-specific sets of transcriptional coregulators shared by different families of transcription factors (68
, 69)
may explain the distinct responses to GR activation by potentiation/attenuation of p53 in different experimental models. Exploitation of the differing results from various studies should provide a better appreciation of the cell type-specific actions of glucocorticoids and p53.
Arrest of cells in G1 accounts for most of the antiproliferative effects of glucocorticoids (48
, 70
71
72)
. Recent studies in fibroblasts (73)
, osteosarcoma (48)
, and hepatoma (74)
cells pointed to p21 as a critical component in GR-induced growth arrest. Our findings extend these data by showing that the same might be true in neural cells and that these GR-induced effects may be caused by a potentiation of the transcriptional activity of p53. Direct induction of p21 expression by GR appears to be relatively complex: its transcriptional activation has been proposed to occur via direct proteinprotein interactions of the activated GR with preexisting p21 promoter-bound transcription factors (74)
and/or by the induction of C/EBP
, which binds directly to cognate DNA binding sites on the p21 promoter (75)
. On the other hand, p53 is an established regulator of p21 expression in response to several stimuli through its direct interaction with the cognate binding site on the p21 promoter (76)
. Moreover, DEX-mediated induction of p21 was recently shown to be associated with increased p53 phosphorylation, suggesting that p53 may be a critical mediator in GR-induced signaling networks that control p21 expression (77)
. Thus, although our experiments do not rule out a direct contribution of GR to the induction of p21 (41
, 74)
, the above-mentioned observations (76
, 77)
, together with the demonstration reported here of concurrent activation of two other p53-responsive genesbax and GADD45favor a p53-mediated effect in HT-22 cells.
Introduction of p53 in various tumor cell lines results in apoptosis whereas in normal cells it induces a reversible arrest of the cell cycle (78
79
80)
. The differential effects of p53 on normal vs. tumor cells raise the interesting question of what determines which outcome will prevail. The recent identification and analysis of mutants dissociating the apoptotic and cell cycle-arresting properties of p53 (50
, 81)
revealed that the response to p53 depends on cell type, cell environment, and genetic composition/integrity (82)
. Consistent with the notion that low levels of p53 favor activation of cell cycle arrest whereas higher levels of p53 expression are necessary for the induction of apoptosis (83)
, the moderate potentiation of p53 by GR observed in the present study might be of considerable biological significance. This study demonstrates that functional cross-talk between GR and p53, which, at least in HT-22 cells, potentiates the growth arrest properties of p53. The present work was initiated in an attempt to define the mechanisms by which glucocorticoids induce apoptosis in the hippocampus in vivo, but the model we used (HT-22 cells) led us to the discovery that at least in some neural cells, GR activation can result in cell cycle arrest. Resolving the different players and pathways leading to GR-mediated cell cycle arrest or apoptosis remains a challenging task for the future, especially in the context of neurogenesis (3)
and neural repair vs. neurodegeneration (36
; see ref 84
). Last, it merits mention that glucocorticoids are used to reduce inflammation and edema in neuro-oncology (11
, 85)
; a hitherto unrecognized benefit of such treatment may be proliferation arrest.
 |
ACKNOWLEDGMENTS
|
|---|
Drs. Christian Behl (Munich) and David Schubert (La Jolla) provided the HT-22 cell line, Dr. Barbara Demeneix (Paris) provided the PEI and advice on its use, Dr. John Reed (La Jolla) made available the pBax-CAT reporter plasmid, Drs. Daniel Goula (Munich) and Christian Gaiddon (Strasbourg) suggested improvements to the manuscript, and Carola Hetzel edited the manuscript. This work was partly supported by the European Commission (QLG32000-00844); C.C. was supported by a fellowship from the Max Planck Society.
Received for publication July 10, 2001.
Revision received January 2, 2002.
 |
REFERENCES
|
|---|
-
Oldenburg, N. B., Evans-Storms, R. B., Cidlowski, J. A. (1997) In vivo resistance to glucocorticoid-induced apoptosis in rat thymocytes with normal steroid receptor function in vitro. Endocrinology 138,810-818[Abstract/Free Full Text]
-
Thompson, E. B. (1999) Mechanisms of T-cell apoptosis induced by glucocorticoids. Trends Endocrinol. Metab. 10,353-358[CrossRef][Medline]
-
Tanapat, P., Gould, E. (1999) Stress and hippocampal neurogenesis. Biol. Psychiat. 46,1472-1479[CrossRef][Medline]
-
Sapolsky, R. M., Krey, L. C., McEwen, B. S. (1985) Prolonged glucocorticoid exposure reduces hippocampal neuron number: implications for aging. J. Neurosci. 5,1222-1227[Abstract]
-
Reagan, L. P., McEwen, B. S. (1997) Controversies surrounding glucocorticoid-mediated cell death in the hippocampus. J. Chemical Neuroanatomy 13,149-167[CrossRef][Medline]
-
Lupien, S. J., de Leon, M., de Santi, S., Convit, A., Tarshish, C., Nair, N. P., Thakur, M., McEwen, B. S., Hauger, R. L., Meaney, M. J. (1998) Cortisol levels during human aging predict hippocampal atrophy and memory deficits. Nat. Neurosci. 1,69-73[CrossRef][Medline]
-
Sousa, N., Paula-Barbosa, M. M., Almeida, O. F. X. (1999) Ligand and subfield specificity of corticoid-induced neuronal loss in the rat hippocampal formation. Neuroscience 89,1079-1087[CrossRef][Medline]
-
Hassan, A. H. S., von Rosenstiel, P., Patchev, V. K., Holsboer, F., Almeida, O. F. X. (1996) Exacerbation of apoptosis in the dentate gyrus of the aged rat by dexamethasone and the protective role of corticosterone. Exp. Neurol. 140,43-52[CrossRef][Medline]
-
Almeida, O. F. X., Condé, G. L., Crochemore, C., Demeneix, B. A., Fischer, D., Hassan, A. H. S., Meyer, M., Holsboer, F., Michaelidis, T. M. (2000) Subtle shifts in the ratio between pro- and antiapoptotic molecules after activation of corticosteroid receptors decide neuronal fate. FASEB J. 14,779-790[Abstract/Free Full Text]
-
Meyer, J. S. (1985) Biochemical effects of corticosteroids on neural tissues. Physiol. Rev. 65,946-1020[Abstract/Free Full Text]
-
Glick, R. D., Medary, I., Aronson, D. C., Scotto, K. W., Swendeman, S. L., La Quaglia, M. P. (2000) The effects of serum depletion and dexamethasone on growth and differentiation of human neuroblastoma cell lines. J. Pediatr. Surg. 35,465-472[CrossRef][Medline]
-
Beato, M., Herrlich, P., Schutz, G. (1995) Steroid hormone receptors: many actors in search of a plot. Cell 83,851-857[CrossRef][Medline]
-
Sloviter, R. S., Valiquette, G., Abrams, G. M., Ronk, E. C., Sollas, A. L., Paul, L. A., Neubort, S. (1989) Selective loss of hippocampal granule cells in the mature rat brain after adrenalectomy. Science 243,535-538[Abstract/Free Full Text]
-
Woolley, C. S., Gould, E., Sakai, R. R., Spencer, R. L., McEwen, B. S. (1991) Effects of aldosterone or RU28362 treatment on adrenalectomy-induced cell death in the dentate gyrus of the adult rat. Brain Res. 554,312-315[CrossRef][Medline]
-
Schreiber, S. S., Sakhi, S., Dugich-Djordjevic, M. M., Nichols, N. R. (1994) Tumor suppressor p53 induction and DNA damage in hippocampal granule cells after adrenalectomy. Exp. Neurol. 130,368-376[CrossRef][Medline]
-
Ko, L. J., Prives, C. (1996) p53: puzzle and paradigm. Genes Dev. 10,1054-1072[Free Full Text]
-
Miller, F. D., Pozniak, C. D., Walsh, G. S. (2000) Neuronal life and death: an essential role for the p53 family. Cell Death Differ. 7,880-888[CrossRef][Medline]
-
Woods, D. B., Vousden, K. H. (2001) Regulation of p53 function. Exp. Cell Res. 264,56-66[CrossRef][Medline]
-
van Lookeren Campagne, M., Gill, R. (1998) Tumor-suppressor p53 is expressed in proliferating and newly formed neurons of the embryonic and postnatal rat brain: comparison with expression of the cell cycle regulators p21Waf1/Cip1, p27Kip1, p57Kip2, p16Ink4a, cyclin G1, and the proto-oncogene Bax. J. Comp. Neurol. 397,181-198[CrossRef][Medline]
-
Parker, S. B., Eichele, G., Zhang, P., Rawls, A., Sands, A. T., Bradley, A., Olson, E. N., Harper, J. W., Elledge, S. J. (1995) p53-independent expression of p21Cip1 in muscle and other terminally differentiating cells. Science 267,1024-1027[Abstract/Free Full Text]
-
Wang, J., Walsh, K. (1996) Resistance to apoptosis conferred by Cdk inhibitors during myocyte differentiation. Science 273,359-361[Abstract]
-
Wu, H., Wade, M., Krall, L., Grisham, J., Xiong, Y., Van Dyke, T. (1996) Targeted in vivo expression of the cyclin-dependent kinase inhibitor p21 halts hepatocyte cell-cycle progression, postnatal liver development and regeneration. Genes Dev 10,245-260[Abstract/Free Full Text]
-
Polyak, K., Waldman, T., He, T. C., Kinzler, K. W., Vogelstein, B. (1996) Genetic determinants of p53-induced apoptosis and growth arrest. Genes Dev. 10,1945-1952[Abstract/Free Full Text]
-
el-Deiry, W. S. (1998) Regulation of p53 downstream genes. Semin. Cancer Biol. 8,345-357[CrossRef][Medline]
-
Miyashita, T., Reed, J. C. (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80,293-299[CrossRef][Medline]
-
Whittemore, S. R., Holets, V. R., Keane, R. W., Levy, D. J., McKay, R. D. (1991) Transplantation of a temperature-sensitive, nerve growth factor-secreting, neuroblastoma cell line into adult rats with fimbria-fornix lesions rescues cholinergic septal neurons. J. Neurosci. Res. 28,156-170[CrossRef][Medline]
-
Davis, J. B., Maher, P. (1994) Protein kinase C activation inhibits glutamate-induced cytotoxicity in a neuronal cell line. Brain Res. 652,169-173[CrossRef][Medline]
-
Baker, S. J., Markowitz, S., Fearon, E. R., Willson, J. K., Vogelstein, B. (1990) Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 249,912-915[Abstract/Free Full Text]
-
Kern, S. E., Pietenpol, J. A., Thiagalingam, S., Seymour, A., Kinzler, K. W., Vogelstein, B. (1992) Oncogenic forms of p53 inhibit p53-regulated gene expression. Science 256,827-830[Abstract/Free Full Text]
-
Hollenberg, S. M., Weinberger, C., Ong, E. S., Cerelli, G., Oro, A., Lebo, R., Thompson, E. B., Rosenfeld, M. G., Evans, R. M. (1985) Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature (London) 318,635-641[CrossRef][Medline]
-
Boussif, O., Lezoualch, F., Zanta, M. A., Mergny, M. D., Scherman, D., Demeneix, B., Behr, J. P. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc. Natl. Acad. Sci. USA 92,7297-7301[Abstract/Free Full Text]
-
Barthel, F., Remy, J. S., Loeffler, J. P., Behr, J. P. (1993) Gene transfer optimization with lipospermine-coated DNA. DNA Cell Biol. 12,553-560[Medline]
-
Lowry, O. H., Roseborough, N. J., Farr, A. L., Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193,265-275[Free Full Text]
-
Schreiber, E., Matthias, P., Müller, M. M., Schaffner, W. (1989) Rapid detection of octamer binding proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Res. 17,6419[Free Full Text]
-
Gavrieli, Y., Sherman, Y., Ben-Sasson, S. A. (1992) Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119,493-501[Abstract/Free Full Text]
-
Behl, C., Lezoualch, F., Trapp, T., Widmann, M., Skutella, T., Holsboer, F. (1997) Glucocorticoids enhance oxidative stress-induced cell death in hippocampal neurons in vitro. Endocrinology 138,101-106[Abstract/Free Full Text]
-
Bourgeois, S., Pfahl, M., Baulieu, E. E. (1984) DNA binding properties of glucocorticosteroid receptors bound to the steroid antagonist RU-486. EMBO J. 3,751-755[Medline]
-
Cadepond, F., Ulmann, A., Baulieu, E. E. (1997) RU486 (mifepristone): mechanisms of action and clinical uses. Annu. Rev. Med. 48,129-156[CrossRef][Medline]
-
Steffen, M., Scherdin, U., Duvigneau, C., Holzel, F. (1988) Glucocorticoid-induced alterations of morphology and growth of fibrosarcoma cells derived from 7,12-dimethylbenz(a)anthracene rat mammary tumor. Cancer Res. 48,7212-7218[Abstract/Free Full Text]
-
Tchekneva, E., Serafin, W. E. (1994) Kirsten sarcoma virus-immortalized mast cell lines. Reversible inhibition of growth by dexamethasone and evidence for the presence of an autocrine growth factor. J. Immunol. 152,5912-5921[Abstract]
-
Rogatsky, I., Hittelman, A. B., Pearce, D., Garabedian, M. J. (1999) Distinct glucocorticoid receptor transcriptional regulatory surfaces mediate the cytotoxic and cytostatic effects of glucocorticoids. Mol. Cell. Biol. 19,5036-5049[Abstract/Free Full Text]
-
Schwartzman, R. A., Cidlowski, J. A. (1993) Apoptosis: the biochemistry and molecular biology of programmed cell death. Endocr. Rev. 44,133-145
-
Chapman, M. S., Askew, D. J., Kuscuoglu, U., Miesfeld, R. L. (1996) Transcriptional control of steroid-regulated apoptosis in murine thymoma cells. Mol. Endocrinol. 10,967-978[Abstract/Free Full Text]
-
Meagher, L. C., Cousin, J. M., Seckl, J. R., Haslett, C. (1996) Opposing effects of glucocorticoids on the rate of apoptosis in neutrophilic and eosinophilic granulocytes. J. Immunol. 156,4422-4428[Abstract]
-
Dempster, D. W., Moonga, B. S., Stein, L. S., Horbert, W. R., Antakly, T. (1997) Glucocorticoids inhibit bone resorption by isolated rat osteoclasts by enhancing apoptosis. J. Endocrinol. 154,397-406[Abstract/Free Full Text]
-
Burnstein, K. L., Jewell, C. M., Sar, M., Cidlowski, J. A. (1994) Intragenic sequences of the human glucocorticoid receptor complementary DNA mediate hormone-inducible receptor messenger RNA down-regulation through multiple mechanisms. Mol. Endocrinol. 8,1764-1773[Abstract/Free Full Text]
-
Thornborrow, E. C., Manfredi, J. J. (1999) One mechanism for cell type-specific regulation of the bax promoter by the tumor suppressor p53 is dictated by the p53 response element. J. Biol. Chem. 274,33747-33756[Abstract/Free Full Text]
-
Rogatsky, I., Trowbridge, J. M., Garabedian, M. J. (1997) Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms. Mol. Cell. Biol. 17,3181-3193[Abstract]
-
Maiyar, A. C., Huang, A. J., Phu, P. T., Cha, H. H., Firestone, G. L. (1996) p53 stimulates promoter activity of the sgk serum/glucocorticoid-inducible serine/threonine protein kinase gene in rodent mammary epithelial cells. J. Biol. Chem. 271,12414-12422[Abstract/Free Full Text]
-
Rowan, S., Ludwig, R. L., Haupt, Y., Bates, S., Lu, X., Oren, M., Vousden, K. H. (1996) Specific loss of apoptotic but not cell-cycle arrest function in a human tumor derived p53 mutant. EMBO J. 15,827-838[Medline]
-
Sherr, C. J., Roberts, J. M. (1999) CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13,1501-1512[Free Full Text]
-
Kren, B. T., Trembley, J. H., Krajewsky, S., Behrens, T. W., Reed, J. C., Steer, C. J. (1996) Modulation of apoptosis-associated genes bcl-2, bcl-x and bax during rat liver regeneration. Cell Growth Differ. 7,1633-1642[Abstract]
-
Rosenfeld, P., Sutanto, W., Levine, S., De Kloet, E. R. (1988) Ontogeny of type I and type II corticosteroid receptors in the rat hippocampus. Brain Res. 470,113-118[Medline]
-
Hassan, A. H. S., Patchev, V. K., von Rosenstiel, P., Holsboer, F., Almeida, O. F. X. (1999) Plasticity of hippocampal corticosteroid receptors during aging in the rat. FASEB J. 13,115-122[Abstract/Free Full Text]
-
Cidlowski, J. A., Michaels, G. A. (1977) Alteration in glucocorticoid binding site number during the cell cycle in HeLa cells. Nature (London) 266,643-645[CrossRef][Medline]
-
Coleman, R. E. (1992) Glucocorticoids in cancer therapy. Biotherapy 4,37-44[CrossRef][Medline]
-
Geley, S., Hartmann, B. L., Hala, M., Strasser-Wozak, E. M., Kapelari, K., Kofler, R. (1996) Resistance to glucocorticoid-induced apoptosis in human T-cell acute lymphoblastic leukemia CEM-C1 cells is due to insufficient glucocorticoid receptor expression. Cancer Res. 56,5033-5038[Abstract/Free Full Text]
-
Levine, A. J. (1997) p53, the cellular gatekeeper for growth and division. Cell 88,323-331[CrossRef][Medline]
-
Gottlieb, T. M., Oren, M. (1998) p53 and apoptosis. Semin. Cancer Biol. 8,359-368[CrossRef][Medline]
-
Jost, C. A., Marin, M. C., Kaelin, W. G., Jr (1997) p73 is a human p53-related protein that can induce apoptosis. Nature (London) 389,191-194[CrossRef][Medline]
-
Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C., Valent, A., Minty, A., Chalon, P., Lelias, J. M., Dumont, X., Ferrara, P., McKeon, F., Caput, D. (1997) Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90,809-819[CrossRef][Medline]
-
Oren, M. (1999) Regulation of the p53 tumor suppressor protein. J. Biol. Chem. 274,36031-36034[Free Full Text]
-
Sengupta, S., Wasylyk, B. (2001) Ligand-dependent interaction of the glucocorticoid receptor with p53 enhances their degradation by Hdm2. Genes Dev. 15,2367-2380[Abstract/Free Full Text]
-
Hupp, T. R., Meek, D. W., Midgley, C. A., Lane, D. P. (1992) Regulation of the specific DNA binding function of p53. Cell 71,875-886[CrossRef][Medline]
-
Chernov, M. V., Ramana, C. V., Adler, V. V., Stark, G. R. (1998) Stabilization and activation of p53 are regulated independently by different phosphorylation events. Proc. Natl. Acad. Sci. USA 95,2284-2289[Abstract/Free Full Text]
-
Sengupta, S., Vonesch, J. L., Waltzinger, C., Zheng, H., Wasylyk, B. (2000) Negative cross-talk between p53 and the glucocorticoid receptor and its role in neuroblastoma cells. EMBO J. 19,6051-6064[CrossRef][Medline]
-
McEwan, I. J., Wright, A. P., Gustafsson, J. A. (1997) Mechanism of gene expression by the glucocorticoid receptor: role of proteinprotein interactions. Bioessays 19,153-160[CrossRef][Medline]
-
Glass, C. K., Rosenfeld, M. G. (2000) The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev. 14,121-141[Free Full Text]
-
Sterner, D. E., Berger, S. L. (2000) Acetylation of histones and transcription-related factors. Microbiol. Mol. Biol. Rev. 64,435-459[Abstract/Free Full Text]
-
Sanchez, I., Goya, L., Vallerga, A. K., Firestone, G. L. (1993) Glucocorticoids reversibly arrest rat hepatoma cell growth by inducing an early G1 block in cell cycle progression. Cell Growth Differ. 4,215-225[Abstract]
-
Rhee, K., Reisman, D., Bresnahan, W., Thompson, E. A. (1995) Glucocorticoid regulation of G1 cyclin-dependent kinase genes in lymphoid cells. Cell Growth Differ. 6,691-698[Abstract]
-
Corroyer, S., Nabeyrat, E., Clement, A. (1997) Involvement of the cell cycle inhibitor CIP1/WAF1 in lung alveolar epithelial cell growth arrest induced by glucocorticoids. Endocrinology 138,3677-3685[Abstract/Free Full Text]
-
Ramalingam, A., Hirai, A., Thompson, E. A. (1997) Glucocorticoid inhibition of fibroblast proliferation and regulation of the cyclin kinase inhibitor p21Cip1. Mol. Endocrinol. 11,577-586[Abstract/Free Full Text]
-
Cha, H. H., Cram, E. J., Wang, E. C., Huang, A. J., Kasler, H. G., Firestone, G. L. (1998) Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21waf1/cip1 promoter in rat hepatoma cells. J. Biol. Chem. 273,1998-2007[Abstract/Free Full Text]
-
Cram, E. J., Ramos, R. A., Wang, E. C., Cha, H. H., Nishio, Y., Firestone, G. L. (1998) Role of the CCAAT/enhancer binding protein-alpha transcription factor in the glucocorticoid stimulation of p21waf1/cip1 gene promoter activity in growth-arrested rat hepatoma cells. J. Biol. Chem. 273,2008-2014[Abstract/Free Full Text]
-
Agarwal, M. L., Taylor, W. R., Chernov, M. V., Chernova, O. B., Stark, G. R. (1998) The p53 network. J. Biol. Chem. 273,1-4[Free Full Text]
-
Zuo, Z., Urban, G., Scammell, J. G., Dean, N. M., McLean, T. K., Aragon, I., Honkanen, R. E. (1999) Ser/Thr protein phosphatase type 5 (PP5) is a negative regulator of glucocorticoid receptor-mediated growth arrest. Biochemistry 38,8849-8857[CrossRef][Medline]
-
Crook, T., Marston, N. J., Sara, E. A., Vousden, K. H. (1994) Transcriptional activation by p53 correlates with suppression of growth but not transformation. Cell 79,817-827[CrossRef][Medline]
-
Di Leonardo, A., Linke., S. P., Clarkin, K., Wahl, G. M. (1994) DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev. 8,2540-2551[Abstract/Free Full Text]
-
Pietenpol, J. A., Tokino, T., Thiagalingam, S., el-Deiry, W. S., Kinzler, K. W., Vogelstein, B. (1994) Sequence-specific transcriptional activation is essential for growth suppression by p53. Proc. Natl. Acad. Sci. USA 91,1998-2002[Abstract/Free Full Text]
-
Delia, D., Goi, K., Mizutani, S., Yamada, T., Aiello, A., Fontanella, E., Lamorte, G., Iwata, S., Ishioka, C., Krajewski, S., Reed, J. C., Pierotti, M. A. (1997) Dissociation between cell cycle arrest and apoptosis can occur in Li-Fraumeni cells heterozygous for p53 gene mutations. Oncogene 14,2137-2147[CrossRef][Medline]
-
Bates, S., Vousden, K. H. (1996) p53 in signaling checkpoint arrest or apoptosis. Curr. Opin. Genet. Dev. 6,12-18[CrossRef][Medline]
-
Chen, X., Ko, L. J., Jayaraman, L., Prives, C. (1996) p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells. Genes Dev. 10,2438-2451[Abstract/Free Full Text]
-
Jordan, J., Galindo, M. F., Prehn, J. H., Weichselbaum, R. R., Beckett, M., Ghadge, G. D., Roos, R. P., Leiden, J. M., Miller, R. J. (1997) p53 expression induces apoptosis in hippocampal pyramidal neuron cultures. J. Neurosci. 17,1397-1405[Abstract/Free Full Text]
-
Koehler, P. J. (1995) Use of corticosteroids in neuro-oncology. Anticancer Drugs 6,19-33[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
X. Wang, Y. Li, X. Zhu, Y. Wang, F. Diao, and J. Lu
Signal regulatory protein {alpha}1 is involved in the inhibitory effect of glucocorticoid receptor on the proliferation of murine macrophage RAW264.7 cell and mouse peritoneal macrophage
J. Mol. Endocrinol.,
November 1, 2008;
41(5):
393 - 403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sola, J. D. Amaral, P. M. Borralho, R. M. Ramalho, R. E. Castro, M. M. Aranha, C. J. Steer, and C. M. P. Rodrigues
Functional Modulation of Nuclear Steroid Receptors by Tauroursodeoxycholic Acid Reduces Amyloid {beta}-Peptide-Induced Apoptosis
Mol. Endocrinol.,
October 1, 2006;
20(10):
2292 - 2303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. W. Trotter and T. K. Archer
Reconstitution of Glucocorticoid Receptor-Dependent Transcription In Vivo
Mol. Cell. Biol.,
April 15, 2004;
24(8):
3347 - 3358.
[Abstract]
[Full Text]
[PDF]
|
 |
|