| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
The H. Hubert Humphrey Center for Experimental Medicine and Cancer Research, The Hebrew University Faculty of Medicine, Jerusalem 91120, Israel; and
* Division of Clinical Pharmacology, Department of Medicine Ludwig-Maximilians-University, 80336 Munich, Germany
1Correspondence: The H. Hubert Humphrey Center for Experimental Medicine and Cancer Research, The Hebrew University Faculty of Medicine, P.O. Box 12272, Jerusalem 91120, Israel. E-mail: barsha{at}cc.huji.ac.il
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B activation in murine macrophages. In light of the pivotal role played by NF-B in osteoclast differentiation, we examined the ability of CpG ODN to modulate osteoclastogenesis. CpG ODN alone induced TRAP-positive cells in bone marrow macrophage (BMM) cultures, but not multinucleation or calcitonin receptor expression. CpG ODN inhibited RANKL-induced osteoclastogenesis when present from the beginning of BMM culture, but strongly increased RANKL-induced osteoclastogenesis in RANKL-pretreated BMMs. CpG ODN enhanced the expression of interleukin 1ß (IL-1ß) and tumor necrosis factor 
(TNF-). Antibodies to TNF- and the TNF type 1 receptor, but not the addition of IL-1 receptor antagonist, blocked CpG ODN-induced osteoclastogenesis in RANKL-pretreated cultures. On the other hand, CpG ODN reduced expression of the M-CSF receptor, which is critical during the initiation of osteoclast differentiation. These results suggest that CpG ODN, via the induction of TNF-, support osteoclastogenesis in cells that are committed to the osteoclast differentiation pathway but, due to down-modulation of M-CSF receptor, inhibit early steps of osteoclast differentiation. Thus, CpG ODN represents a potential therapeutic tool for treating bone diseases.—Zou, W., Schwartz, H., Endres, S., Hartmann, G., Bar-Shavit, Z. CpG oligonucleotides: novel regulators of osteoclast differentiation.
Key Words: RANKL • TNF- • M-CSF • bone • immunostimulatory oligodexynucleotide
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2
3
4)
. It became evident during the last few years that the transcription factor nuclear factor B (NF-B), known for its functions in immune cells, including mononuclear phagocytes (5)
, is a key player in osteoclast differentiation, viability, and resorptive activity. It was found that deletion of the P50 and P52 subunits of NF-B leads to osteopetrosis due to impaired osteoclast differentiation (6
, 7)
. It was also shown that the ligand for RANK (receptor activator of NF-B), (RANKL) is essential for osteoclastogenesis (8
, 9)
. In fact, RANKL is the stromal cell/osteoblast-derived factor that, together with M-CSF, is responsible for the ability of these cells to support osteoclast differentiation in bone marrow and spleen cell cultures (10)
.
The transcriptional activity of NF-B in immune cells is also stimulated by CpG oligodeoxynucleotides (CpG ODN). CpG ODN contain unmethylated CG dinucleotides within certain sequence contexts (CpG motifs) (11
12
13
14
15)
. Based on CpG motifs, the vertebrate immune system is able to detect bacterial DNA leading to a coordinated set of immune responses that includes innate and acquired immunity (16
, 17)
. Recognition of CpG motifs is mediated by toll-like receptor 9 (TLR9), a member of the family of TLR that represents phylogenetically conserved receptors of innate immunity essential for recognition of pathogen-associated microbial molecules (18)
.
In the murine system, cellular targets for CpG-ODN include lymphocytes (B, T, and NK cells) and mononuclear phagocytes (monocytes, macrophages, and dendritic cells). All cell types are able to take up DNA in a CpG-motif independent manner (17)
. Interference with ODN-induced immune stimulation by drugs such as monensin, chloroquine, and bafilomycin A suggests that endosomal acidification is required for release of the ODNs from endosomes to the cytoplasm (19
, 20)
. An essential step in CpG-ODN activity involves nuclear translocation of NF-B, leading to transcriptional activation of various cytokines, including those known to be involved in modulating osteoclast differentiation and activity (21)
.
Since NF-B plays a key role in both osteoclastogenesis and in CpG ODN-mediated effects, we examined whether CpG ODN could modulate osteoclastogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Oligodeoxynucleotides
Completely and partially phosphorothioate-modified ODNs were provided by the Coley Pharmaceutical Group in Wellesley, MA. (Lowercase letters: phosphorothioate linkage; capital letters: phosphodiester linkage 3' of the base; boldface: CpG-dinucleotides; c-methylated cytosine.)
ODN-1826: 5'-tccatgacgttcctgacgtt-3'; ODN-1982: 5'-tccaggacttctctcaggtt-3';
ODN-2216: 5'-ggGGGACGATCGTCgggggG-3';
ODN-2118: 5'ggGGTCAAGCTTGAgggggG3';
ODN-1759: 5'ataatccagcttgaaccaag3'; ODN-1760: 5'ataatcgacgttcaagcaag3';
ODN-2183: 5'tttttttttttttttttttttttT3'; ODN-2143: 5'TtcgtcgTTTTGTCGTTTTGTCGTT3';
ODN-1812: 5'tctcccagcgtgcgc3'.
All ODNs had undetectable lipopolysaccharides (LPS) according to limulus amoebocyte lysate assay (BioWhittaker, Walkersville, MD) following the manufacturer’s instructions. ODNs 1826 and 1982 were also purchased from BTG (Rehovot, Israel) and their activity was identical to the ODNs provided by Coley.
Reagents
GST-RANKL (residues 158–316) was prepared (22)
from a plasmid kindly provided by Drs. Ross and Teitelbaum (Washington University, St. Louis, MO). Each preparation was tested for lack of detectable LPS and for total inhibition of activity by osteoprotegerin (OPG). Rat monoclonal anti-mouse tumor necrosis factor ;(TNF-) and hamster monoclonal anti-mouse p55 [TNF- receptor 1 (TNFR-1)] neutralizing antibodies were purchased from PharMingen (San Diego, CA), rabbit anti-mouse M-CSF receptor antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant mouse TNF-, OPG-Fc (OPG/Fc chimera containing OPG amino acids 1–398 residues), and M-CSF were purchased from R&D Systems (Minneapolis, MN). Recombinant mouse interleukin 1ß (IL-1ß) and IL-1 receptor antagonist were kindly provided by Dr. Charles Dinarello (University of Colorado, Denver). Endotoxin testing confirmed the absence of LPS contamination in our reagents. LPS was purchased from Difco Laboratories (Detroit, MI). Media and sera were purchased from Biological Industries (Beth Haemek, Israel). All chemicals and reagents were of analytical grade.
In vitro osteoclast formation assay
Bone marrow mononuclear cells (BMMs) were harvested as described previously (23)
. Cells (1.3x105/well) were plated in 96-well plates in 0.2 ml of -MEM containing 10% FCS in the presence of mouse M-CSF (30 ng/ml) and the indicated dose of RANKL, TNF-, IL-1ß, or ODN. On day 3, medium was changed and osteoclast formation was evaluated on day 4 or 5. We have demonstrated (23)
that these cultures do not contain endogenous RANKL.
Tartrate-resistant acid phosphatase (TRAP) staining
A commercial kit (Cat. No. 387-A, Sigma, St. Louis, MO) was used according to the manufacturer’s instructions, omitting counterstain with hematoxylin. TRAP-positive cells containing three or more nuclei were scored as osteoclasts.
May-Grunwald-Giemsa staining
Cells were fixed in methanol and stained with May-Grunwald and Giemsa solutions (Pioneer Research Chemical Ltd., Essex, England) by standard procedure.
Methylene blue staining
The cell number was estimated by the methylene blue staining assay (24)
using a plate reader (Dynatech, Vienna, VA).
RT-PCR analysis
First strand cDNA was synthesized from 1 µg of total RNA [1 h, 42°C using avian myeloblastosis virus with random hexanucleotides (Promega, Madison, WI)], and subjected to PCR amplification with Taq DNA polymerase (Roche Molecular Biochemical, Mannheim, Germany) using specific PCR primers for 30 cycles. Each cycle consisted of denaturation (94°C), annealing (60°C), and extension (72°C) (1 min each). Calcitonin receptor: sense: 5'-TTTCAAGAACCTTAGCTGCCAGAG-3', antisense: 5'-CAAGGCACGGACAATGT-TGAGAAG-3'; GAPDH: sense: 5'-ACCACAGTCCATGCCATCAC-3', antisense: 5'-TCCACCACCCTGTTGCTGTA-3'.
Western blot analysis
Western analysis was performed as described (25)
, except the enzyme used for detection was horseradish peroxidase. Bands were quantified by densitometry.
Northern blot analysis (26)
Total cellular RNA was extracted using TRI REAGENT, fractionated by electrophoresis on 1.2% agarose formaldehyde gels (10 µg/lane), and transferred to nylon membranes (Hybond-N, Amersham International, Little Chalfont, UK). [32P]-labeled 1.1 Kb mouse TNF-, 752 bp M-CSF receptor, 671 bp IL-1ß, and mouse ribosomal protein L32 cDNA (as an internal housekeeping gene control) were used for hybridization. The hybridized membrane was then subjected to autoradiography and the density of each mRNA band was quantified using Fluor-STM MultiImager and Multi-Analyst/PC software (Bio-Rad Laboratories, Hercules, CA).
Statistical analysis
Student’s t test was used to determine the significance of differences. Values are presented as mean ± SD of (n=4–6).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B, we first examined whether such an ODN (ODN-1826) exerts an osteoclastogenic effect on BMMs in the presence of M-CSF. Figure 1
A shows the absence of TRAP in cells treated with M-CSF only; cell morphology (May-Grunwald-Giemsa staining) is shown in Fig. 1B
. As expected, upon incubation with RANKL, in the presence of M-CSF, TRAP-positive multinucleated cells (Fig. 1C, D
) are formed. ODN-1826 induces a low degree of multinucleation and low-intensity TRAP staining in the presence of M-CSF (Fig. 1E, F
), whereas no effect was observed by the GC-ODN control (ODN-1982) (Fig. 1G, H
) in the presence of M-CSF.
|
RT-PCR analysis shows that calcitonin receptors are acquired only by the RANKL-treated cells and not by cells treated with either ODN-1826 or ODN-1982 (Fig. 2
). The quality and quantity of RNA was assured by the equal expression of GAPDH in all conditions.
|
We wondered whether CpG-ODN was able to modulate the osteoclastogenic activity of RANKL. BMMs are cultured in the presence of M-CSF (30 ng/ml) and RANKL (20 ng/ml) with different concentrations of either ODN-1826 or ODN-1982 for 5 days. In Fig. 3
A we see that ODN-1826 inhibits RANKL-induced osteoclastogenesis in a dose-dependent manner. ODN-1982 exhibits a much lower effect. Except for the ODNs (5 nM), significant differences are observed at all doses in the effects of the two ODNs (P<0.001). The ODNs do not affect the cellular contents of the wells, as determined by methylene blue uptake (Fig. 3B
).
|
We next examined whether ODNs modulate RANKL-induced osteoclastogenesis when added at different times after addition of RANKL. ODN-1826 or ODN-1982 (100 nM) or when the same volume of medium is added to BMMs [incubated with M-CSF (30 ng/ml) and RANKL (5 ng/ml)] after the start of the BMM cultures (total incubation time, 102 h). We see in Fig. 4
A that when ODN-1826 is included for the entire experiment (added at 0 h), no osteoclasts are observed, consistent with the data shown in Fig. 3A
. The inhibition becomes less pronounced when ODN-1826 is added later. Addition of ODN-1826 10 and 24 h after the start of the experiment results in inhibition by 95% (P<0.001) and 40% (P<0.001), respectively. No significant inhibition is observed when ODN-1826 is added 48 h after the start of the culture. When ODN-1826 is added 72 h after the start of the experiment, a significant enhancement of RANKL osteoclastogenic activity is obtained (>90%, P<0.001). Neither ODN-1982 nor medium additions at the various times affect the activity of RANKL. In Fig. 4B
we demonstrate that the enhancement obtained in the presence of ODN-1826 during the last 30 h of the experiment (i.e., added at 72 h) is already evident at 20 nM (P<0.001) of the ODN. Specificity is demonstrated by the inability of ODN-1982 to exert any significant effect. Neither ODN affected the cellular content of the well (not shown).
|
Figure 4C
shows that ODN-1826 induces osteoclastogenesis even in the absence of RANKL during the last 30 h, but no such effect is exerted by the ODN-1982. A significant effect is already observed at 20 nM of the ODNs (387 vs. 228 osteoclasts per well in the presence of ODN-1826 and ODN-1982, respectively). At 50 and 100 nM, a > 2.5-fold difference is observed between the ODNs. Figure 4D
shows that RANKL–RANK interactions are not involved in ODN-1826-induced osteoclastogenesis, as demonstrated by the inability of the specific RANKL decoy receptor OPG to inhibit the CpG-ODN activity while totally blocking RANKL-induced activity.
We wondered whether the osteoclastogenic effect of ODN-1826 added on day 3 requires previous exposure to RANKL. BMMs were incubated with M-CSF (30 ng/ml) for 72 h and for another 72 h in the presence of different concentrations of ODN-1826. ODN-1826 fails to induce osteoclastic differentiation without prior exposure to RANKL (not shown), similar to its inability to promote differentiation in freshly isolated BMMs (Figs. 1
, 2)
.
To examine whether ODN-1826 would promote RANKL-induced osteoclastogenesis after preincubation with M-CSF, BMMs were incubated with M-CSF for 72 h and then either ODN-1826 or ODN-1982 were added in the presence of RANKL (40 ng/ml). We see in Fig. 5
that, similar to the inhibitory effect of ODN-1826 in freshly isolated BMMs, ODN-1826 (but not ODN-1982) also inhibits osteoclastogenesis of RANKL in this setting. Thus ODN-1826 seems to promote osteoclastogenesis only under conditions with prior exposure of BMMs to RANKL (in the absence of the ODN), suggesting the need for a priming phase dependent on RANKL–RANK interaction.
|
To examine whether ODN-1826 modulation of osteoclastogenesis is CpG-motif dependent, we compared the activities of several ODNs. First we compared the ability of various ODNs to inhibit RANKL-induced osteoclastogenesis (Table 1
, first column). Like ODN-1826, the ODNs 1760, 2216, and 2143, which contain CpG motifs, exhibit inhibitory activity. ODN-1812, an ODN containing methylated CpG motifs, was inactive. The ODN GC controls (ODNs 2118 and 1759) and poly-dT (ODN-2183) were inactive, similar to ODN-1982.
|
In another series of experiments, ODNs were tested for their ability to induce osteoclastogenesis in RANKL-pretreated BMMs (Table 1
, second column). All CpG ODNs (ODNs 1826, 1760, 2216, and 2143) exhibited (although to different degrees) an osteoclastogenic activity when BMMs had been pretreated with RANKL. Conversely, the same ODNs that failed to inhibit RANKL-induced osteoclastogenesis when present throughout the experiment (1982, 1812, 2118, 1759, and 2183) also failed to induce osteoclast differentiation when added later.
LPS is also able to promote osteoclast differentiation in RANKL-pretreated BMMs (W. Zou and Z. Bar-Shavit, unpublished results). The ODN preparations we used did not contain detectable LPS levels. Furthermore, the CpG motif dependency of ODN activity makes it unlikely that LPS is involved. To remove any doubt, we used chloroquine, which is known to inhibit CpG ODNs but not LPS activities. In Fig. 6
we see that ODN-1826 and LPS both induce osteoclastic differentiation in RANKL-pretreated BMMs. Chloroquine, which by itself does not affect osteoclast differentiation in RANKL-pretreated cells, inhibits > 98% of CpG activity whereas only a modest inhibition of LPS activity was obtained.
|
The cytokines TNF- and IL-1ß are known to modulate osteoclast differentiation and activity. Northern blot analyses revealed that ODN-1826, but not ODN-1982, increases mRNA levels of both cytokines in BMMs whether or not they were pretreated with RANKL (Fig. 7
A). Increased mRNA levels are detected within 30 min after ODN-1826 addition and persist for at least 4 h. Dose response (Fig. 7B
) demonstrates that an increase is observed at 20 nM of the ODN. Using ELISA, we also find that ODN-1826 (but not ODN-1982) induces TNF- release into the medium. The release is evident after 4 h (0.5 ng/ml), maximizes after 6 h (1.0 ng/ml), and persists at least for 12 h. In ODN-1982-treated cells, the levels of immunoreactive TNF- in the medium are between 0.01 ng/ml (4 h) and 0.05 ng/ml (12 h).
|
We therefore examined the possible involvement of those cytokines in the osteoclastogenic activity of CpG ODN. In our system, TNF- alone exhibits only low osteoclastogenic activity (23)
and no activity is observed with IL-1ß. However, these cytokines effectively induce osteoclast differentiation in RANKL-primed cells (Fig. 8
A). The osteoclastogenic effect of TNF- is blocked by anti-TNF- and anti TNFR-1 antibodies, whereas the effect of IL-1ß is abolished by addition of the IL-1 receptor antagonist (IL-1ra). The osteoclastogenic effect of ODN-1826 is not affected by IL-1ra, but is blocked by anti-TNF- and anti-TNFR-1 antibodies (Fig. 8B
). Unrelated control IgG preparations (at 10 µg/ml, similar to the antibodies concentrations in this experiment) are inactive. Consistent with previous studies of TNF- osteoclastogenic activity (23
, 27)
, antibodies to its type 2 receptors are ineffective (not shown).
|
ODN-1826 treatment also increases the abundance of TNF- and IL-1ß transcripts under conditions where ODN inhibits osteoclastogenesis. Since an M-CSF/M–CSF receptor interaction is required during osteoclastogenesis, we examined the influence of ODN-1826 on M-CSF receptor expression. BMMs were grown in the presence of RANKL and M-CSF (5 and 30 ng/ml, respectively) in the absence or presence of ODNs as described below. Using Northern and Western blot analyses, we find that M-CSF receptor mRNA (Fig. 9
A) and protein (Fig. 9B
) levels are both reduced by ODN-1826 but not by ODN-1982. When ODN-1826 is present for 72 and 48 h (conditions in which ODN inhibited osteoclastogenesis), a reduction in M-CSF receptor transcript abundance of 65% and 32%, respectively, is observed. The reduction in M-CSF receptor mRNA levels is less pronounced (17%) when the ODN is present for 24 h (when enhanced osteoclastogenesis is observed). The presence of the control ODN (1982) for 3 days caused a small reduction (12%). Similar effects are observed when the M-CSF receptor protein is assessed by Western analysis. In Fig. 9C
, cells were grown with M-CSF and RANKL (20 ng/ml) in the absence or presence of ODNs for 72 h. A dose-dependent reduction in M-CSF receptor mRNA abundance was observed. ODN-1826 at 5, 20, 50, and 100 nM caused a reduction of 12%, 56%, 79%, and 80%, respectively. At 100 nM, ODN-1982 caused 15% inhibition.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and on intact active NF-B (6
, 7)
. Therefore, we decided to examine whether CpG ODNs (which are known to activate NF-B) are capable of modulating osteoclast differentiation.
Our model system is BMMs grown in the presence of M-CSF, which is known to be essential for RANKL activity in these cells (8
9
10)
. We found that CpG ODN alone does not induce osteoclast differentiation. Surprisingly, the ODN even inhibited the ability of RANKL to promote osteoclastogenesis. In contrast, CpG ODN strongly supported osteoclastogenesis in RANKL-primed BMMs. Control ODN and blockade of CpG-mediated effects by chloroquine revealed that these effects were CpG specific. Thus, depending on the experimental design, CpG ODN either inhibited or induced osteoclast differentiation. Enhanced osteoclastogenesis in the presence of CpG ODN is observed only in BMMs primed with RANKL, i.e., having already received a signal to differentiate toward the osteoclastic phenotype.
The cytokines TNF- and IL-1ß have been shown to play a role in osteoclastogenesis and bone resorption (29
, 30)
. We have shown recently that TNF- mediates at least in part the osteoclastogenic effect of RANKL (23)
. We and others have shown (23
, 31)
that TNF- is a potent activator of osteoclast differentiation in RANKL-primed cells. This, together with previous reports about CpG ODN-mediated increase of cytokine expression, including TNF- and IL-1ß (17)
, prompted us to examine the involvement of these cytokines in the induction of differentiation by CpG-ODN. We found that although IL-1ra did not affect osteoclastogenic activity of CpG ODN, antibodies to TNF- and its type 1 receptors blocked this activity. Together with the known capability of TNF- to induce differentiation in RANKL primed cells and the induction of the cytokine expression by CpG ODN, our data suggest that TNF- mediates the osteoclastogenic activity of CpG-ODN.
However, despite the induction of TNF-, CpG ODN, if added together with RANKL from the beginning of BMM culture, inhibited osteoclastogenic activity of RANKL. Since the interaction of M-CSF with its receptor is critical to osteoclast differentiation in vivo (32
33
34
35)
and in the in vitro system we used (8
9
10)
, we examined the effect of CpG ODN on M-CSF receptor expression in BMMs. Indeed, we found that CpG ODN reduce M-CSF receptor mRNA abundance as well as the level of the receptor protein in a manner similar to the inhibitory effect on osteoclastogenesis. It has been reported that CpG ODN leads to down-regulation and internalization of the M-CSF receptor (36)
. Thus, the effect of CpG ODN on osteoclast differentiation includes a stimulatory effect (via increased expression of TNF-) and an inhibitory effect (via decreasing M-CSF receptor levels).
Bacteria are involved in pathological bone remodeling (periodontitis, osteomyelitis, bacterial arthritis, and infected metal implants). A variety of bacterial products such as LPS, teichoic acid, and other cell wall components stimulate osteoclastic bone resorption (37)
. Our findings demonstrate that bacterial DNA has the potential to join this list.
So far, clinical implications of CpG-mediated effects are directed toward modulation of immune functions. Several therapeutic concepts have been developed, including the use of CpG ODN as an adjuvant for vaccine therapy in infectious disease and cancer (38)
. Here we demonstrate for the first time a new mechanism by which CpG ODN modulates biological functions beyond immunostimulation. We show that CpG ODN affects osteoclast formation and thus bone resorption. It is important to know whether in vivo CpG ODN therapy is causing promotion or inhibition of bone resorption. This is highly relevant for CpG ODN-mediated immunotherapy in general. If in vivo effects on bone resorption are found, a better understanding of the interaction of CpG ODN with bone cells might also lead to new therapies to treat bone disease.
|
ACKNOWLEDGMENTS |
|---|
Received for publication August 22, 2001.
Revision received November 5, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-mediated shock. Eur. J. Immunol. 27,1671-1679[Medline]
/-ß in plasmacytoid dendritic cells. Eur. J. Immunol. 31,2154-2163[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  J. Lorenzo, M. Horowitz, and Y. Choi Osteoimmunology: Interactions of the Bone and Immune System Endocr. Rev., June 1, 2008; 29(4): 403 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Ofek, M. Karsak, N. Leclerc, M. Fogel, B. Frenkel, K. Wright, J. Tam, M. Attar-Namdar, V. Kram, E. Shohami, et al. Peripheral cannabinoid receptor, CB2, regulates bone mass PNAS, January 17, 2006; 103(3): 696 - 701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Amcheslavsky, W. Zou, and Z. Bar-Shavit Toll-like Receptor 9 Regulates Tumor Necrosis Factor-{alpha} Expression by Different Mechanisms: IMPLICATIONS FOR OSTEOCLASTOGENESIS J. Biol. Chem., December 24, 2004; 279(52): 54039 - 54045. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-I. Hayashi, M. Tsuneto, T. Yamada, M. Nose, M. Yoshino, L. D. Shultz, and H. Yamazaki Lipopolysaccharide-Induced Osteoclastogenesis in Src Homology 2-Domain Phosphatase-1-Deficient Viable Motheaten Mice Endocrinology, June 1, 2004; 145(6): 2721 - 2729. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-I. Hayashi, T. Yamada, M. Tsuneto, T. Yamane, M. Takahashi, L. D. Shultz, and H. Yamazaki Distinct Osteoclast Precursors in the Bone Marrow and Extramedullary Organs Characterized by Responsiveness to Toll-Like Receptor Ligands and TNF-{alpha} J. Immunol., November 15, 2003; 171(10): 5130 - 5139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cella, C. Buonsanti, C. Strader, T. Kondo, A. Salmaggi, and M. Colonna Impaired Differentiation of Osteoclasts in TREM-2-deficient Individuals J. Exp. Med., August 18, 2003; 198(4): 645 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krug, S. Rothenfusser, S. Selinger, C. Bock, M. Kerkmann, J. Battiany, A. Sarris, T. Giese, D. Speiser, S. Endres, et al. CpG-A Oligonucleotides Induce a Monocyte-Derived Dendritic Cell-Like Phenotype That Preferentially Activates CD8 T Cells J. Immunol., April 1, 2003; 170(7): 3468 - 3477. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
