FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by PLAT, J.
Right arrow Articles by MENSINK, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by PLAT, J.
Right arrow Articles by MENSINK, R. P.
(The FASEB Journal. 2002;16:1248-1253.)
© 2002 FASEB

Increased intestinal ABCA1 expression contributes to the decrease in cholesterol absorption after plant stanol consumption

JOGCHUM PLAT1 and RONALD P. MENSINK

Department of Human Biology, Maastricht University, Maastricht, Netherlands

1Correspondence: Department of Human Biology/Maastricht University, P.O. Box 616, 6200 MD, Maastricht, Netherlands. E-mail: J.Plat{at}HB.UNIMAAS.NL

ABSTRACT

The hypocholesterolemic effect of plant stanols is explained by a decreased intestinal cholesterol absorption due to a competition between plant stanols and cholesterol for incorporation into mixed micelles. Earlier we had suggested that plant stanols have a so far unknown action inside the enterocytes. The recent discovery of the involvement of ATP binding cassette (ABC) transporters in cholesterol absorption was a lead to further explore the hypocholesterolemic mechanism of plant stanols. We found that mixed micelles enriched with sitostanol or with cholesterol plus sitostanol were potent inducers of ABCA1 expression in caco-2 cells, an accepted model to study human intestinal lipoprotein metabolism. Based on these findings, we now hypothesize that plant stanols—and possibly plant sterols—increase ABCA1-mediated cholesterol efflux back into the intestinal lumen. We further hypothesize that intracellular levels of plant stanols are monitored by the same sensors (SREBP-2 and LXR) as those that monitor cholesterol. Consequently, increased plant stanol levels within the enterocyte activate cholesterol efflux through ABCA1- but not SREBP-2-mediated endogenous cholesterol synthesis even if intracellular cholesterol concentrations are lowered through consumption of plant stanols. If our hypothesis is correct, then the LXR pathway may be a target for dietary regulation of intestinal lipid metabolism.—Plat, J., Mensink, R. P. Increased intestinal ABCA1 expression contributes to the decrease in cholesterol absorption after plant stanol consumption.


Key Words: sitostanol • intestine • LXR • cholesterol transport

FUNCTIONAL FOODS ENRICHED with plant stanol esters selectively lower cholesterol concentrations in the atherogenic low density lipoproteins (LDL) (1) . The mechanism underlying the hypocholesterolemic effect of these so-called 4-desmethylsterols are explained by a competition between plant stanols and intestinal cholesterol for incorporation into mixed micelles (2) . In this way, cholesterol absorption is decreased.

Recently, however, we have reported that consumption of plant stanols once a day at lunch resulted in a similar LDL cholesterol reduction compared with consumption of a similar dose of plant stanols divided over the three meals. This suggests that for a cholesterol-lowering effect, plant stanols do not need to be present in the intestinal lumen simultaneously with dietary cholesterol. We have therefore suggested that plant stanols may have a so far unknown action inside the enterocytes (3) . The recent discovery of the involvement of ATP binding cassette (ABC) transporters in cholesterol absorption was a lead to further explore the effects of plant stanols on intestinal cholesterol metabolism.

Effects of plant stanols on intestinal cholesterol absorption

Plant sterols and stanols, which are structurally related to cholesterol, are the natural occurring equivalent of mammalian cholesterol. The hypocholesterolemic effects of plant sterols were demonstrated more than 50 years ago (4) . Plant stanols are the saturated derivatives of plant sterols. The hypocholesterolemic effects of plant stanols and sterols are caused by a reduced cholesterol absorption, which is ascribed to a competition with intestinal cholesterol for incorporation into mixed micelles (2) . This suggests that plant stanols and sterols need to be consumed simultaneously with dietary cholesterol to be effective. Recently, however, we demonstrated that this is not true. A daily consumption of 2.5 g plant stanols and their fatty acid esters once a day was as effective as an equal dose divided over three meals (3) . To explain these results, we suggested that plant stanols remain in the intestine for a while or lower intestinal cholesterol absorption not only by an effect on micellar composition. After the discovery of ABCA1 as sterol transporter in the intestine, we decided to look for the effects of plant stanols on ABCA1 expression in the human derived caco-2 cell line, an accepted model to study human intestinal lipoprotein metabolism (5) . Based on the outcome of these experiments and on data from the literature, we present another explanation for the cholesterol-lowering mechanism of plant stanols.

Effects of plant stanols on the incorporation of cholesterol into mixed micelles

To mimic the physiological situation as much as possible, we presented sitostanol—the major plant stanol in functional foods—to the caco-2 cells incorporated into mixed micelles of various compositions. The mixed micelles were prepared by combining various amounts of cholesterol (0–250 µM) and/or sitostanol (0–250 µM) with 5 mM taurocholate, 390 µM oleic acid, and 110 µM mono-olein in Dulbecco’s modified Eagle medium (DMEM) (Gibco BRL, Life Technologies, Breda, Netherlands) supplemented with 1% nonessential amino acids, penicillin 100 U/mL, and streptomycin (100 µg/mL). This mixture was sonificated for 30 min at 37°C. For analysis of the composition of the mixed micelles, the micellar phase was separated by ultracentrifugation (6) . Micellar cholesterol and sitostanol concentrations were quantified by gas liquid chromatography analysis as described (7) .

The proportion of cholesterol incorporated into mixed micelles did not depend on the amount of cholesterol and was ~93% when the micelles were prepared with 125 µM, 96% when the micelles were prepared with 250 µM, and 89% when the micelles were prepared with 500 µM. This illustrates that up to 500 µM cholesterol can easily be incorporated into in vitro synthesized mixed micelles. In the following experiments, the total sterol concentration therefore never exceeded 500 µM. Sitostanol was efficiently incorporated into the micelles, for 93% at low (125 µM) and for 80% at high (250 µM) concentrations. In agreement with earlier in vitro and in vivo studies (2 , 6) , addition of 250 µM sitostanol lowered the incorporation of cholesterol. When the micelles were prepared with 250 µM sitostanol, the proportion of cholesterol incorporated into the mixed micelles was reduced by ~25% both at low (125 µM) and high (250 µM) cholesterol concentrations.

Role of ABCA1 in cholesterol absorption

ABC transporters are integral membrane proteins that use the energy generated by hydrolysis of ATP for transportation of a substrate over the membrane. They belong to a large family of proteins involved in the transport of a specific substrate into another compartment (8) . ABCA1 has been identified as a specific sterol transporter. Tangier disease, a disorder in which the efflux of cholesterol from cells is defective, is probably the most striking example of a defect in ABCA1 function (9 10 11) .

ABCA1 expression is transcriptionally regulated by LXR/RXR heterodimers (12 , 13) . After cloning, an oxysterol responsive element (DR4) was found in the human ABCA1 gene and certain DR4 mutations reduced the oxysterol-inducible ABCA1 gene expression (14) . Not only specific LXR or RXR agonists, but also cholesterol, up-regulates ABCA1 expression (13) . It has therefore been suggested that a biological role of LXR is to detect high intracellular cholesterol concentrations and to prevent accumulation of cellular cholesterol by increasing the expression of genes, such as ABCA1 (15) . In agreement with this function is the finding that LXR{alpha} (-/-) mice do not tolerate high cholesterol diets (15) .

In the small intestine, ABCA1 is involved in the transport of cholesterol from the enterocyte into the lumen (13 , 16) . The ABCA1 expression pattern is consistent with the localization of cholesterol absorption along the cephalocaudal axis in the small intestine (17) . It was recently found that mice treated with RXR or LXR agonists showed a marked increase in intestinal ABCA1 mRNA levels and a subsequent reduction in intestinal cholesterol absorption. It was therefore suggested that a higher ABCA1 expression lowers cholesterol absorption by transporting free cholesterol from the enterocytes back into the lumen (13) . Results from studies with transgenic mice, however, are not consistent. Cholesterol absorption was increased in ABCA1 knockout mice on a DBA background (16) , but decreased in ABCA1 knockout mice on an sv129 background (18) . These contrasting findings suggest that differences in genetic background modulate the effects of ABCA1 on cholesterol absorption in mice. However, it is also known that ABCA1 (-/-) mice on an sv129 background suffer from various pathologies (19) , which may have influenced the results.

Effects of plant stanols on ABCA1 expression in intestinal caco-2 cells

Caco-2 cells were cultured on collagen-coated polytetrafluoroethylene membrane transwell filter inserts with an 0.4 µm membrane pore size (Costar Co., Cambridge, MA) in DMEM (Life Technologies) supplemented with heat-inactivated fetal calf serum (20%), nonessential amino acids (1%), sodium pyruvate (1%), penicillin (100 U/mL), and streptomycin (100 µg/mL). When cultured on transwell filter systems, caco-2 cells behave like they have an apical (luminal) and a basolateral (lymphatic) side, mimicking the in vivo situation. Experiments were conducted 14 days after confluency was reached in serum-free conditions. Total RNA was isolated from caco-2 cells using Tryzol (Life Technologies), and after removing possible traces of contaminating DNA (DNase Rnase-free, Promega). ABCA1 and ß-actin expression were measured by RT-PCR using ABCA1-specific primers (sense TGACAAGTCTGTGCAATGGATCAA, antisense GATACGAGACACAGCCTGGTAGAT) and ß-actin-specific primers (sense ACCTGACTGACTACCTCATGAAGATC, antisense CGTCATACTCCTGCTTGCTGAT). The sense primers were 5'-cy-5 labeled (Sigma-Genosys, Cambridge, UK), enabling detection of the subsequently formed fluorescent-labeled PCR fragments on an ALF-express DNA sequencer (Pharmacia Biotech, Roosendaal, Netherlands). All experiments were carried out in duplicate.

Mixed micelles were supplied for 3 and 6 h to the apical side of intestinal caco-2 cells. Figure 1 shows that 6 h after addition of cholesterol-containing micelles to the luminal surface of caco-2 cells, cellular ABCA1 expression increased by 53% compared with cholesterol-free micelles. Micelles containing only sitostanol increased ABCA1 expression by as much as 118%. Effects for sitostanol appeared to be dose dependent, but for cholesterol a maximal effect was already reached at a concentration of 125 µM. Since micelles containing only sitostanol are not physiologically relevant, we also analyzed the effects of micelles with 250 µM cholesterol and increasing amounts of sitostanol. These micelles also increased ABCA1 expression (Fig. 2 ). For all experiments, increases in ABCA1 expression were time dependent and higher after 6 h vs. 3 h (data not shown).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Effects on ABCA1 expression in caco-2 cells after addition of mixed micelles synthesized in vitro with cholesterol (0, 125, 250 µM) or sitostanol (0, 125, 250 µM).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Effects on ABCA1 expression in caco-2 cells after addition of mixed micelles synthesized in vitro with sitostanol (0, 125, 250 µM) plus cholesterol (250 µM).

An alternative hypothesis to explain the decrease in cholesterol absorption after plant stanol consumption

All cells in the human body need cholesterol, and intracellular cholesterol homeostasis is tightly regulated by different mechanisms. Two important routes to maintain a balance in cellular cholesterol levels—endogenous cholesterol synthesis and receptor-mediated uptake of circulating lipoproteins—have been discussed in detail (20) . It is known that low intracellular free cholesterol concentrations induce proteolysis of sterol regulatory elements (pre-SREBP), which results in the formation of a sterol response element binding protein (SREBP-2). Transcription of the genes coding for the LDL receptor and HMG-CoA reductase are initiated by binding of SREBP-2 to regulatory sterol response elements (SRE) present in the promotor regions of these two genes (21) . For example, the decrease in intracellular cholesterol concentrations caused by drugs that inhibit HMG-CoA reductase, the rate-limiting enzyme in cholesterol synthesis, results in a higher LDL receptor-mediated cellular cholesterol uptake. Cellular sterol depletion by statin (HMG-CoA reductase inhibitors) treatment, however, not only activates the SREBP-2 pathway but also lowers mRNA levels of ABCA1 (22) . This clearly indicates that intracellular cholesterol concentrations also determine ABCA1 expression. As mentioned before, this latter effect is mediated by the cholesterol sensor LXR. Thus, at least two different cholesterol sensors—SREBP-2 and LXR—are involved in the regulation of cellular cholesterol homeostasis.

We now propose that intracellular levels of free sitostanol or sitosterol are monitored by the same sensors (SREBP-2 and LXR) as those that monitor free cholesterol. This concept is supported by an earlier finding that supplementation of sitosterol-enriched micelles to caco-2 cells did not increase HMG-CoA reductase expression, despite a decrease in intracellular cholesterol concentrations (23) . To further substantiate this finding in other cell types and for sitostanol, we cultured human U937 monocytes (RPMI 1640, Gibco BRL, Life Technologies), sodium pyruvate (1%), penicillin (100 U/mL), and streptomycin (100 µg/mL) under serum-free conditions for 15 h with 2.5 µM mevastatin (Sigma, St. Louis, MO) or 10 µM sitostanol (Sigma) and determined expression of the LDL receptor by Western blotting. An LDL receptor-specific monoclonal antibody (Amersham, Uppsala, Sweden) was used for this, visualized by rabbit anti-mouse peroxidase (DAKO, Glostrup, Denmark). As expected, mevastatin increased LDL receptor expression. Sitostanol, however, lowered LDL receptor expression (Fig. 3 ). The findings on the effects of sitosterol on HMG CoA reductase expression on one hand (23) and of sitostanol on LDL receptor and ABCA1 expression on the other suggest that intracellular levels of these plant sterols or stanols affect expression of SREBP- and LXR-regulated genes. Based on these findings, we now hypothesize that plant stanols lower intestinal cholesterol absorption not only via an effect on the incorporation of cholesterol into mixed micelles, but also via an increase in the ABCA1-mediated cholesterol efflux back into the lumen. In other words, the enterocyte does not fully differentiate between cholesterol and a plant stanol or sterol. At increased intracellular plant stanol and sterol levels, it therefore activates its cholesterol efflux mechanism through ABCA1 but does not increase its endogenous cholesterol synthesis (23) , even if intracellular cholesterol concentrations are lowered. This mechanism as schematically depicted in Fig. 4 also explains our earlier findings that plant stanols lower serum cholesterol concentrations whether consumed simultaneously with each cholesterol-containing meal or only at lunch (3) .



View larger version (94K):
[in this window]
[in a new window]
 
Figure 3. Effects of mevastatin (2.5 µM) and sitostanol (10 µM) on LDL receptor protein expression compared with control (upper panel). Total protein concentrations were visualized by Coomassie blue staining (lower panel). BL; control, SN sitostanol, ST; mevastatin, M; Marker.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. Hypothesized effect of plant stanols (or sterols) on intestinal lipoprotein metabolism. Plant stanols or sterols are taken up into the enterocytes. In contrast to cholesterol, these compounds are poorly esterified by ACAT and remain in their free form inside the enterocyte. We now hypothesize that free plant sterols and stanols, or possibly an unknown derivative or metabolite, are sensed by LXR and consequently induce a higher ABCA1 expression, which shuttles cholesterol out of the enterocyte back into the lumen. Earlier studies have shown that sitosterol may also be sensed by another cholesterol sensor, SREBP-2, which lowers intracellular cholesterol synthesis despite a lower intracellular cholesterol concentration (21) . These two processes lead to a low cholesterol concentration in the enterocyte and consequently to a lower cholesterol incorporation into chylomicrons. ACAT, acyl-coenzyme A:cholesterol acyltransferase; SREBP, sterol response element binding protein; SRE, sterol response element; HMG-CoA, hydroxymethylglutaryl coenzyme A reductase; LXR, liver X receptor; ABC1, ATP binding cassette; B48, apolipoprotein B48; CE, cholesteryl ester; SE, sitostanol ester.

Since ABCA1 expression is LXR/RXR mediated, our findings suggest that sitostanol or perhaps an unknown derivative or metabolite is a suitable ligand for LXR/RXR. Indeed, a group of different oxysterols were identified as natural ligands for the LXR{alpha}/RXR heterodimer (24) . From these studies, it appeared that a 3ß-hydroxyl group and an additional hydroxyl group in the side chain of the sterol molecule are obligate. However, there are exceptions since FF-MAS, a meiosis activating sterol without the side chain hydroxyl group, is a potent LXR ligand (24) . Sitostanol lacks the side chain hydroxyl group, but has instead an extra ethyl group at carbon atom 24. It remains to be elucidated whether these characteristics make sitostanol a potential ligand for the LXR/RXR heterodimer. Besides sitostanol, there are other plant sterols that share structural characteristics with cholesterol such as {alpha}-amyrin, lupeol. In contrast to the 4-desmethylsterols, these 4,4-dimethylsterols do not lower LDL cholesterol concentrations (25 , 26) . We now propose that 4,4-dimethylsterols, in contrast to sitostanol, are not suitable ligands for activation of the LXR-mediated ABCA1 pathway.

Effects of sitostanol on ABCA1 expression seemed to be more pronounced than those of a similar concentration of cholesterol (Fig. 1) . A possible explanation for this difference may be found in the metabolism of plant stanols within the enterocyte. After absorption, intracellular free cholesterol is esterified by acyl-coenzyme A:cholesterol acyltransferase (ACAT) and stored as cholesterol esters or excreted as such via chylomicrons. Based on structure–activity relationship studies (24) , esterified cholesterol is a poorer ligand for LXR than free cholesterol, since a 3ß-hydroxyl group seems obligate for LXR activation. Plant sterols, and probably plant stanols, are a poor substrate for intestinal ACAT and therefore are hardly esterified and excreted via chylomicrons (27) . In other words, intracellular free cholesterol concentrations, and therefore their oxysterol metabolites, may be lowered more efficiently than those of free sitostanol.

Besides ABCA1, other ABC transporters like ABCG5 and ABCG8 play an important role in intestinal sterol metabolism (28) . Since expression of ABCA1 and ABCG5 or ABCG8 increases under the same experimental conditions (i.e., high intracellular concentrations of free cholesterol or LXR ligands), Lee et al. (29) suggested that ABCG5 and ABCG8 shuttle intracellular sterols out of the cells, possibly in cooperation with ABCA1.

In conclusion, it has often been suggested that the LXR pathway is a useful target for pharmacological regulation of cellular lipid metabolism. This may also be true for dietary components, if our hypothesis that 4-desmethylsterols really affect the expression of intestinal ABC transporters is true. Detailed studies of the effects of the various sterols and stanols, and their metabolites, on intestinal gene expression are therefore needed to confirm or refute our hypothesis.

ACKNOWLEDGMENTS

We are indebted to Mr. M. G. S. Kunen for analyzing ABCA1 and ß-actin mRNA concentrations and to Mr. F. J. J. Cox for analyzing micellar sterol compositions. The study was supported by the Netherlands Organization for Scientific Research (project: 014–12-010) and by the RAISIO GROUP, Raisio, Finland.

Received for publication November 28, 2001. Revision received April 17, 2002. REFERENCES

  1. Law, M. (2000) Plant sterol and stanol margarines and health. Br. Med. J. 320,861-864[Free Full Text]
  2. Ikeda, I., Tanabe, Y., Sugano, M. (1989) Effects of sitosterol and sitostanol on micellar solubility of cholesterol. J. Nutr. Sci. Vitaminol. 35,361-369
  3. Plat, J., Onselen van, E. N. M., Heugten van, M. M. A., Mensink, R. P. (2000) Effects on serum lipids, lipoproteins and fat-soluble antioxidant concentrations of consumption frequency of margarines and shortenings enriched with plant stanol esters. Eur. J. Clin. Nutr. 54,671-677[CrossRef][Medline]
  4. Peterson, D. W. (1951) Effect of soybean sterols in the diet on plasma and liver cholesterol in chicks. Proc. Exp. Biol. Med. 78,143-147[CrossRef][Medline]
  5. Levy, E., Mehran, M., Seidman, E. (1995) Caco-2 cells as a model for intestinal lipoprotein synthesis and secretion. FASEB J. 9,626-635[Abstract]
  6. Ikeda, I., Tanaka, K., Sugano, M., Vahouny, G. V., Gallo, L. (1988) Inhibition of cholesterol absorption in rats by plant sterols. J. Lipid Res. 29,1573-1582[Abstract]
  7. Plat, J., Mensink, R. P. (2001) Effects of diets enriched with two different plant stanol ester mixtures on plasma ubiquinol-10 and fat-soluble antioxidant concentrations. Metabolism 50,520-529[CrossRef][Medline]
  8. Dean, M., Hamon, Y., Chimini, G. (2001) The human ATP-binding cassette (ABC) transporter superfamily. J. Lipid Res. 42,1007-1017[Abstract/Free Full Text]
  9. Brooks-Wilson, A., Marcil, M., Clee, S. M., Zhang, L. H., Roomp, K., van Dam, M., Yu, L., Brewer, C., Collins, J. A., Molhuizen, H. O., Loubser, O., Ouelette, B. F., Fichter, K., Ashbourne-Excoffon, K. J., Sensen, C. W., Scherer, S., Mott, S., Denis, M., Martindale, D., Frohlich, J., Morgan, K., Koop, B., Pimstone, S., Kastelein, J. J., Hayden, M. R. (1999) Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat. Genet. 22,316-318[CrossRef][Medline]
  10. Bodzioch, M., Orso, E., Klucken, J., Langmann, T., Bottcher, A., Diederich, W., Drobnik, W., Barlage, S., Buchler, C., Porsch-Ozcurumez, M., Kaminski, W. E., Hahmann, H. W., Oette, K., Rothe, G., Aslanidis, C., Lackner, K. J., Schmitz, G. (1999) The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat. Genet. 22,347-351[CrossRef][Medline]
  11. Rust, S., Rosier, M., Funke, H., Real, J., Amoura, Z., Piette, J. C., Deleuze, J. F., Brewer, H. B., Duverger, N., Denefle, P., Assmann, G. (1999) Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat. Genet. 22,352-355[CrossRef][Medline]
  12. Venkateswaran, A., Lafitte, B. A., Joseph, S. B., Mak, P. A., Wilpitz, D. C., Edwards, P. A., Tontonoz, P. (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR{alpha}. Proc. Natl. Acad. Sci. USA 97,12097-12102[Abstract/Free Full Text]
  13. Repa, J. J., Turley, S. D., Labaccaro, J. M. A., Medina, J., Li, L., Lustig, K., Shan, B., Heyman, R. A., Dietchy, J. M., Mangelsdorf, D. J. (2000) Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289,1524-1529[Abstract/Free Full Text]
  14. Costet, P., Luo, Y., Wang, N., Tall, A. R. (2000) Sterol dependent transactivation of the ABC1 promotor by the liver X receptor/retinoid X receptor. J. Biol. Chem. 275,28240-28245[Abstract/Free Full Text]
  15. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J. M. A., Hammer, R. E., Mangelsdorf, D. J. (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR{alpha}. Cell 93,693-704[CrossRef][Medline]
  16. McNeish, J., Aiello, R. J., Guyot, D., Turi, T., Gabel, C., Aldinger, C., Hoppe, K. L., Roach, M. L., Royer, L. J., de Wet, J., Broccardo, C., Chimini, G., Francone, O. L. (2000) High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc. Natl. Acad. Sci. USA 97,4245-4250[Abstract/Free Full Text]
  17. Sylven, C., Nordstrom, C. (1970) The site of absorption of cholesterol and sitosterol in the rat small intestine. Scand. J. Gastroenterol. 5,57[Medline]
  18. Drobnick, W., Lindenthal, B., Lieser, B., Ritter, M., Christiansen-Weber, T., Liebisch, G., Giesa, U., Igel, M., Von Bergmann, K., Schmitz, G. (2001) ATP-Binding cassette transporter A1 (ABCA1) affects total body sterol metabolism. Gastroenterology 120,1203-1211[CrossRef][Medline]
  19. Christiansen-Weber, T., Voland, J. R., Wu, Y., Ngo, K., Roland, B. L., Nguyen, S., Peterson, P. A., Fung-Leung, W. P. (2000) Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am. J. Pathol. 157,1017-1029[Abstract/Free Full Text]
  20. Brown, M. S., Goldstein, J. L. (1986) A receptor mediated pathway for cholesterol homeostasis. Science 232,34-47[Free Full Text]
  21. Brown, M. S., Goldstein, J. L. (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89,331-340[CrossRef][Medline]
  22. Le Lay, S., Krief, S., Farnier, C., Lefrere, I., Le Liepvre, X., Bazin, R., Ferre, P., Dugail, I. (2001) Cholesterol, a cell size-dependent signal that regulates glucose metabolism and gene expression in adipocytes. J. Biol. Chem. 276,16904-16910[Abstract/Free Full Text]
  23. Field, F. J., Born, E., Mathur, S. N. (1997) Effect of micellar ß-sitosterol on cholesterol metabolism in caco-2 cells. J. Lipid Res. 38,348-360[Abstract]
  24. Janowski, B. A., Willy, P. J., Devi, T. R., Falck, J. R., Mangelsdorf, D. J. (1996) An oxysterol signalling pathway mediated by the nuclear receptor LXR{alpha}. Nature (London) 383,728-731[CrossRef][Medline]
  25. Sierksma, A., Weststrate, J. A., Meijer, G. W. (1999) Spreads enriched with plant sterols, either esterified 4,4-dimethylsterols or free 4-desmethylsterols, and plasma total- and LDL-cholesterol concentrations. Br. J. Nutr. 82,273-282[Medline]
  26. Weststrate, J. A., Meijer, G. W. (1998) Plant sterol-enriched margarines and reduction of plasma total- and LDL-cholesterol concentrations in normocholesterolaemic and mildly hypercholesterolaemic subjects. Eur. J. Clin. Nutr. 52,334-343[CrossRef][Medline]
  27. Field, F. J., Mathur, S. N. (1983) ß-Sitosterol: esterification by intestinal acylcoenzyme A:cholesterol acyltransferase (ACAT) and its effect on cholesterol esterification. J. Lipid Res. 24,409-417[Abstract]
  28. Berge, K. E., Tian, H., Graf, G. A., Yu, L., Grishin, N. V., Schultz, J., Kwiterovich, P., Shan, B., Barnes, R., Hobbs, H. H. (2000) Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 290,1771-1775[Abstract/Free Full Text]
  29. Lee, M. H., Lu, K., Patel, S. B. (2001) Genetic basis of sitosterolemia. Curr. Opin. Lipidol. 12,141-149[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Clin. Nutr.Home page
S. Devaraj, B. C Autret, and I. Jialal
Reduced-calorie orange juice beverage with plant sterols lowers C-reactive protein concentrations and improves the lipid profile in human volunteers.
Am. J. Clinical Nutrition, October 1, 2006; 84(4): 756 - 761.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
I. G.E. Zarraga and E. R. Schwarz
Impact of Dietary Patterns and Interventions on Cardiovascular Health
Circulation, August 29, 2006; 114(9): 961 - 973.
[Full Text] [PDF]


Home page
J. Nutr.Home page
T. Plosch, J. K. Kruit, V. W. Bloks, N. C. A. Huijkman, R. Havinga, G. S. M. J. E. Duchateau, Y. Lin, and F. Kuipers
Reduction of Cholesterol Absorption by Dietary Plant Sterols and Stanols in Mice Is Independent of the Abcg5/8 Transporter
J. Nutr., August 1, 2006; 136(8): 2135 - 2140.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Jakulj, M. D. Trip, T. Sudhop, K. von Bergmann, J. J. P. Kastelein, and M. N. Vissers
Inhibition of cholesterol absorption by the combination of dietary plant sterols and ezetimibe: effects on plasma lipid levels
J. Lipid Res., December 1, 2005; 46(12): 2692 - 2698.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. Plat, J. A. Nichols, and R. P. Mensink
Plant sterols and stanols: effects on mixed micellar composition and LXR (target gene) activation
J. Lipid Res., November 1, 2005; 46(11): 2468 - 2476.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
F. J. Field, E. Born, and S. N. Mathur
Stanol esters decrease plasma cholesterol independently of intestinal ABC sterol transporters and Niemann-Pick C1-like 1 protein gene expression
J. Lipid Res., December 1, 2004; 45(12): 2252 - 2259.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
M. G Traber
The ABCs of vitamin E and {beta}-carotene absorption
Am. J. Clinical Nutrition, July 1, 2004; 80(1): 3 - 4.
[Full Text] [PDF]


Home page
J. Lipid Res.Home page
F. J. Field, E. Born, and S. N. Mathur
LXR/RXR ligand activation enhances basolateral efflux of {beta}-sitosterol in CaCo-2 cells
J. Lipid Res., May 1, 2004; 45(5): 905 - 913.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. Quilez, M. Rafecas, G. Brufau, P. Garcia-Lorda, I. Megias, M. Bullo, J. A. Ruiz, and J. Salas-Salvado
Bakery Products Enriched with Phytosterol Esters, {alpha}-Tocopherol and {beta}-Carotene Decrease Plasma LDL-Cholesterol and Maintain Plasma {beta}-Carotene Concentrations in Normocholesterolemic Men and Women
J. Nutr., October 1, 2003; 133(10): 3103 - 3109.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Kaneko, M. Matsuda, Y. Yamada, Y. Tachibana, I. Shimomura, and M. Makishima
Induction of Intestinal ATP-binding Cassette Transporters by a Phytosterol-derived Liver X Receptor Agonist
J. Biol. Chem., September 19, 2003; 278(38): 36091 - 36098.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
E. Naumann, J. Plat, and R. P. Mensink
Changes in Serum Concentrations of Noncholesterol Sterols and Lipoproteins in Healthy Subjects Do Not Depend on the Ratio of Plant Sterols to Stanols in the Diet
J. Nutr., September 1, 2003; 133(9): 2741 - 2747.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. J. Aiello, D. Brees, and O. L. Francone
ABCA1-Deficient Mice: Insights Into the Role of Monocyte Lipid Efflux in HDL Formation and Inflammation
Arterioscler Thromb Vasc Biol, June 1, 2003; 23(6): 972 - 980.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by PLAT, J.
Right arrow Articles by MENSINK, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by PLAT, J.
Right arrow Articles by MENSINK, R. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS