FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GOUNNI, A. S.
Right arrow Articles by HAMID, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GOUNNI, A. S.
Right arrow Articles by HAMID, Q.
(The FASEB Journal. 2001;15:940-949.)
© 2001 FASEB

Human neutrophils express the high-affinity receptor for immunoglobulin E (Fc{varepsilon}RI): role in asthma

ABDELILAH SOUSSI GOUNNI*1, BOUCHAIB LAMKHIOUED{dagger}, LATIFA KOUSSIH{dagger}, CHISEI RA{ddagger}, PAOLO M. RENZI{dagger} and QUTAYBA HAMID*

* Meakins Christie Laboratories, McGill University, Montreal, Quebec, Canada;
{dagger} Centre de Recherche, CHUM, Notre Dame Hospital, Montreal, Quebec, Canada; and
{ddagger} Juntendo University Medical School, Tokyo, Japan

1Correspondence: Meakins-Christie Laboratories, McGill University, 3626 St. Urban Street, H2X2P2, Montreal, Quebec, Canada. E-mail: Abdel{at}meakins.lan.mcgill.ca


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Polymorphonuclear neutrophils (PMNs) are important effector cells in host defense and the inflammatory response to antigen. The involvement of PMNs in inflammation is mediated mainly by the Fc receptor family, including IgE receptors. Recently, PMNs were shown to express two IgE receptors (CD23/Fc{varepsilon}RII and galectin-3). In allergic diseases, the dominant role of IgE has been mainly ascribed to its high-affinity receptor, Fc{varepsilon}RI. We have examined the expression of Fc{varepsilon}RI by PMNs. mRNA and cell surface expression of Fc{varepsilon}RI{alpha} chain was identified on PMNs from asthmatic subjects. Furthermore, preincubation with human IgE Fc fragment blocks completely the binding of anti-Fc{varepsilon}RI{alpha} chain (mAb15–1) to human PMNs. Conversely, preincubation of PMNs with mAb15–1 inhibits significantly the binding of IgE Fc fragment to PMNs, indicating that IgE bound to the cell surface of PMNs mainly via the Fc{varepsilon}RI. Peripheral blood and bronchoalveolar lavage (BAL) PMNs from asthmatic subjects also express intracellular Fc{varepsilon}RI{alpha} and ß chain immunoreactivity. Engagement of Fc{varepsilon}RI induces the release of IL-8 by PMNs. Collectively, these observations provide new evidence that PMNs express the Fc{varepsilon}RI and suggest that these cells may play a role in allergic inflammation through an IgE-dependent activation mechanism.—Gounni, A. S., Lamkhioued, B., Koussih, L., Ra, C., Renzi, P. M, Hamid, Q. Human neutrophils express the high-affinity receptor for immunoglobulin E (Fc{varepsilon}RI): role in asthma.


Key Words: allergic diseases • IgE receptors • interleukin 8


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
NEUTROPHILS (POLYMORPHONUCLEAR NEUTROPHILS, PMNs) are one of the first inflammatory cells to be recruited in response to cell damage, infectious agents, and allergens (1 2 3) . Although the role of PMNs in the pathogenesis of asthma has not been defined, they have been described in the human bronchial wall of both allergic and nonallergic asthmatic subjects (4) . Previous studies have shown that allergen challenge in humans as well as in animal models causes an increase in the number of PMNs within the lung that has been associated with the presence of chemokines in peripheral blood and bronchoalveolar lavage fluid (5 6 7 8 9 10 11) . Moreover, peripheral blood PMNs are activated during active asthma (12) , after exercise-induced bronchospasm (9) , and during both early and late asthmatic reactions induced by allergen (13) . These cells also have the capacity to synthesize and release various mediators, such as cytotoxic compounds and cytokines (14) , suggesting that PMNs could be involved in events central in the pathogenesis of asthma including bronchoconstriction, tissue damage, and chronic airway inflammation (13) .

IgE binding structures play a pivotal role in many pathophysiological mechanisms of atopic diseases such as asthma. So far, two types of IgE receptors have been demonstrated in human PMNs: galactin 3 (Mac-2/{varepsilon}BP) and the low-affinity receptor for IgE (Fc{varepsilon}RII/CD23) (15 16) . Besides these receptors, the high-affinity receptor for IgE (Fc{varepsilon}RI) is a key structure involved in immediate allergic manifestations. Initially, it was described on mast cells and basophils (17 18 19 20) , but more recently on other cell types, including eosinophils, and has been correlated with atopic disease (21 22 23 24 25 26) . However, whether human PMNs express the Fc{varepsilon}RI has not been determined. To improve our understanding of the pathophysiologic role of PMNs in atopic disease, we examined this prospect. Our study shows that human PMNs from asthmatic patients express functional Fc{varepsilon}RI receptor and provide a potential mechanism by which these cells may contribute to the manifestation of allergic disorders.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Reagents and antibodies
Murine anti-human Fc{varepsilon}RI{alpha} chain monoclonal antibody mAb-15 (21) and affinity-purified rabbit polyclonal anti-human Fc{varepsilon}RIß chain (976, raised against a peptide representing amino acids 24–39 of human Fc{varepsilon}RIß chain) were kindly donated by Dr. J. P. Kinet (Harvard Medical School, Boston, Mass.). Murine anti-Fc{varepsilon}RI{alpha} chain mAb mAbCRA2 (mouse IgG1), which recognizes the IgE binding site, was described previously (27) . FITC-labeled goat anti-mouse IgG was purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). FITC-labeled mouse anti-human CD16 mAb (Clone 3G8, IgG1), extravidin-FITC, affinity-purified human IgG, goat anti-mouse IgG(Fab)'2, and IgG1 isotype control mAb (clone MOPC21, IgG1) were obtained from Sigma Chemical Co. (Oakville, Ontario). H. Gould (Randall Royal King Institute, London, U.K.) kindly donated IgE Fc fragment. Azide-free IgE Fc fragment was biotinylated using biotin succinimide (Biosearch, Saint Rafael, Quebec, Canada); excess biotin was then removed by dialyses against PBS. Mouse anti-human elastase mAb, alkaline phosphatase anti-alkaline phosphatase (APAAP), rabbit anti-mouse IgG, streptavidin phosphatase alkaline, swine anti-rabbit F(ab)'2 FITC, FITC-labeled mouse IgG1 isotype control mAb, and biotin-labeled swine anti-rabbit were from Dako (Dakopatt, Denmark). Biotin-labeled horse anti-mouse IgG was from Vector Laboratories (Burlingame, Calif.). Anti-CD16 mAb immunomagnetic beads were from Miltenyi Biotec (Auburn, Calif.). Unless stated otherwise, all other reagents were obtained from Sigma.

Subjects
This study was approved by the Ethics Committee of the Montreal Chest Hospital, Montreal, Quebec. Eighteen mild asthmatic patients, as defined by the American Thoracic Society, were included in this study (28) . Eighteen nonatopic, nonasthmatic controls with negative skin tests and normal spirometry were also studied. Patients had not received inhaled or systemic corticosteroids in the last 3 months and were not receiving any medication other than ß agonists. Subjects who had upper respiratory tract infection within the last month were excluded from the study. Bronchoscopy was performed on asthmatic subjects as described previously (4) .

Human PMN purification
Blood was taken after informed consent and collected into heparinized tubes. Human PMNs were purified as described previously (29) . In brief, blood was diluted with Ca2+/Mg2+-free PBS, then overlaid onto a Ficoll-Paque gradient and centrifuged at 400 g for 20 min. The granulocyte-rich fraction was then mixed with dextran 70 (4.5%) and the red blood cells (RBCs) were allowed to sediment for 30 min at room temperature. The supernatant was collected and centrifuged for 10 min at 400 g to recover the granulocytes. The residual RBCs were lysed with hypotonic saline. The granulocytes were then incubated with anti-CD16-coated microbeads for 30 min at 4°C and the contaminating cells were eluted by washing the cells with PBS/1% BSA through a MACS column. PMNs with a purity of 98% ± 1.4% were obtained using this technique as determined by staining cytospins with Diff-Quick (Fisher Scientific, Pittsburgh, Pa.). The viability of the cells was >98% as assessed by trypan blue dye exclusion.

Cell line and culture conditions
The human cell line HL-60 clone 15 was provided from the American Tissue Culture Collection (ATCC) (Rockville, Md.). Cells were cultured at 37°C in humidified 5% CO2 in RPMI 1640 medium supplemented with 10% heat-inactivated FCS and antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin). Differentiation toward the eosinophils or neutrophils was performed as described previously (30) . Cells were grown in RPMI 1640, 10% FCS in the presence of butyric acid (0.3 mM) or DMSO (1.25% V/V) for 7 days to generate eosinophils or neutrophils, respectively.

Northern blot analysis
Probe: 572 bp of the Fc{varepsilon}RI{alpha} chain cDNA within the coding region was made by RT-PCR using specific primers ({alpha}1 and {alpha}2) of the Fc{varepsilon}RI{alpha} chain (22) . After enzyme digestion analysis and subcloning in pBluescript vector (Stratagene, La Jolla, Calif.), the probe was confirmed by sequencing. The vector was linearized with appropriate digestion enzyme to recover the Fc{varepsilon}RI{alpha} chain cDNA. Total RNA from highly purified PMNs was extracted using Trizol as recommended by the supplier (Gibco BRL, Burlington, Canada). Equal amounts of total RNA (10 µg) were separated by electrophoresis on 1.2% agarose formaldehyde denaturing gel (31) and transferred to nylon membranes (Amersham Int., Burckinghamshire, U.K.). The blots were prehybridized for 2 h at 42°C in hybridization solution (40% formamide, 10% dextran sulfate, 4% SSC, 20 mmol/Tris-HCl pH 7.4, 1x Denhardt’s solution, 50 µg/ml denatured salmon sperm DNA, and 0.1% SDS). Hybridization was performed with human Fc{varepsilon}RI{alpha} chain cDNA probe labeled with 32P-dCTP by random hexamer priming (Amersham) for 18 h at 42°C. The blots were washed at high stringency conditions: three times at room temperature in 2x SSC, 0.05% SDS and twice at 55°C in 0.1x SSC, 0.05% SDS for 30 min each. After hybridization, blots were washed, dried, and exposed to Kodak XAR film with an intensifying screen at -70°C.

RT-PCR analysis
Reverse transcription (RT) was performed by using 2 µg of total RNA of PMNs obtained from each patient in a first-strand cDNA synthesis reaction with Super Script reverse transcriptase as recommended by the supplier (GibcoBRL). PCR was performed by adding 1 µl of the RT product into 50 µl of total volume reaction containing 1x buffer; 200 µmol of each dNTPs; 20 pmol of each oligonucleotide primer and 0.2 unit of Ampli-Taq polymerase (Gibco-BRL). Oligonucleotides specific for {alpha}, ß and {gamma} sequences on either side of a splice junction were used in the PCR reaction to preclude amplification of possible contaminating genomic DNA. Oligonucleotide primers were designed based on the published sequences (20) . The Fc{varepsilon}RI {alpha} chain oligonucleotides were {alpha}1: 5'TACAGTAATGTTGAGGGGCTCAG3'; {alpha}2: 5'CTGTTCTTCGCTCCAGATGGCGTT3'; internal primer or {alpha}3: 5'CCTGTACACATCCCAGTTCCTCCAACCAT3'. The Fc{varepsilon}RIß chain primers were 5'primer: 5'GGACACAGAAAAGTAATAGGAGAG3'; 3'primer: 5'GATCAGGATGGTAATTCCCGTT3'; internal primer: 5' TTTTCATCATTTAAGCAGGTTATCCATT3'. The Fc{varepsilon}RI {gamma} chain primers were: 5' primer: 5' CCAGCAGTGGTCTTGCTCTCTTAC 3'; 3'primer: 5'GCATGCAGGCATATGTGATGCC3'. PCR was carried out as described previously (23) .

Southern blot analysis
Amplified products were blotted on Hybond N membrane using standard methods (31) . Oligonucleotide probes were labeled with 3-deoxy digoxigenin-labeled ATP using terminal transferase. Hybridization was carried out as recommended by the supplier (Boehringer, Mannheim, Germany).

Cytospin preparations
Cytospin slides were prepared from BAL or peripheral blood PMNs, fixed in 4% paraformaldehyde for 20 min at room temperature and washed with 0.05M Tris-HCl-buffered isotonic saline, pH.7.6 (TBS). After drying, the slides were stored at -20°C before immunocytochemistry or in situ hybridization.

In situ hybridization
The vector containing the Fc{varepsilon}RI{alpha} chain cDNA was linearized with the appropriate enzymes and transcribed with [{alpha}35S]UTP to generate sense and antisense riboprobes as recommended by the supplier (Promega, Madison, Wis.). Cytospin preparations were first permeabilized by immersion in 0.3% Triton X-100 in PBS for 10 min, followed by exposure to proteinase K (1 µg/ml in 20 mM Tris-HCL and 1 mM EDTA, pH 7.2) for 30 min at 37°C. The slides were prehybridized with 50% formamide, tRNA, Denhardt’s in 2x SSC for 15 min at 42°C. Hybridization was performed with [{alpha}-35S] UTP-labeled riboprobes (either antisense or sense) for 16 h at 42°C. Posthybridization washings were done with SSC solutions (4x SSC and 0.1x SSC), followed by ribonuclease A treatment to remove unhybridized single-stranded RNA. The preparations were dehydrated, immersed in emulsion, and subjected to autoradiography for 18 days. The slides were developed and subsequently counterstained with hematoxylin. As negative control, sections were hybridized with the sense probe or pretreated with RNAse before hybridization with the antisense probe.

Flow cytometry analysis
Samples of 105 PMNs in 100 µl of PBS/5% FCS were incubated for 30 min on ice with mAb15–1, CRA2, or mAb control (final concentration 10 µg/ml) in the presence of 2 mg/ml of affinity-purified human IgG to block the nonspecific Fc fragment binding. The cells were washed twice with PBS/2% FCS and incubated in the dark for 30 min on ice with goat FITC-conjugated anti-mouse IgG (1:200). The cells were washed three times with PBS/2% FCS, resuspended in 500 µl of PBS and analyzed on FACScan. FACS analysis was done with Cellquest Software (Becton Dickinson, Rutherford, N.J.). The results are presented as overlaid histograms and percentage of positive cells or fold increase of the geometric mean fluorescence intensity (MFI). The fold increase of Fc{varepsilon}RI{alpha} chain expression was calculated by dividing the MFI units of mAb15–1 staining by the MFI units of control mAb staining in each donor.

To inhibit anti-Fc{varepsilon}RI {alpha} chain mAb15–1 binding to the PMNs, 105 cells in 100 µl of PBS/5% FCS were preincubated for 1 h at 4°C with IgE-Fc (10 µg/ml) with gentle agitation. Cells were then washed and incubated with a saturating concentration of mAb15–1 (10 µg/ml) for 1 h at 4°C. After washing, cells were incubated with FITC-conjugated anti-mouse IgG for 30 min, washed, and analyzed as described above.

Inhibition of IgE-Fc fragment binding to PMNs by mAb15–1
To inhibit IgE-Fc Fragment binding to the PMNs, 105 cells in 100 µl of PBS/5% FCS were preincubated for 1 h at 4°C with mAb15–1 or control mAb at (50 µg/ml) with gentle agitation. Cells were then washed and incubated with a saturating concentration of biotin-conjugated IgE-Fc fragment (BIgE-Fc, 10 µg/ml) for 1 h at 4°C. After wash, cells were incubated with extravidin-FITC for 30 min, washed and analyzed as described above.

Immunoprecipitation and Western blot analysis
For protein extraction, highly purified PMNs were lysed for 30 min at 4°C in Nonidet P-40 lysis buffer supplemented with a mixture of protease inhibitors (2 mM sodium orthovanadate, 1 mM phenyl-methylsulfonylfluoride, 10 µg/ml leupeptin, 0.15 units/ml aprotinin, 1 µg/ml pepstatin A) and centrifuged for 20 min to remove nuclei. Cell lysates were sequentially incubated with or without IgE Fc fragment for 16 h at 4°C in a rotating mixer, followed by protein G Sepharose-coated beads conjugated with goat anti-human IgE for 2 h at 4°C. Beads were pelleted by centrifugation and washed three times with the wash buffer (PBS/1%Nonidet P-40). For immunoblotting, samples were separated on SDS-polyacrylamide gel (13%) and electrotransferred onto polyvinylidene membrane (Millipore, Missisauga, Ontario). The membrane was blocked at room temperature for 1 h in blocking solution (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 005% Tween-20, and 1% BSA). Membrane was incubated with anti-Fc{varepsilon}RI{alpha} chain mAb15–1 (1 µg/ml) at room temperature for 2 h, followed by biotin-conjugated horse anti-mouse IgG and streptavidin alkaline phosphatase. The blots were developed by enhanced chemiluminescence as recommended by the supplier (Boehringer).

Immunocytochemistry
Cytopreparations of purified PMNs from asthmatic subjects or normal controls were washed in TBS, saturated with blocking buffer (10% human normal serum, 10% normal goat serum) for 15 min at room temperature, and incubated with mAb15–1 or isotype control mAb both at 10 µg/ml overnight at 4°C. After washing three times with TBS, the cytopreparations were incubated with rabbit anti-mouse IgG (1:60) for 45 min, followed by APAAP for 1 h at room temperature. After washing with TBS, the slides were developed using fast red substrate, followed by counterstaining in hematoxylin.

For ß chain immunodetection, cytopreparation slides were saturated with blocking buffer for 15 min, washed, and incubated with affinity-purified rabbit polyclonal anti-Fc{varepsilon}RIß chain (5 µg/ml) or normal rabbit serum (1:200) overnight at 4°C. After washing, biotinylated swine anti-rabbit IgG (1:200) was added for 30 min at 37°C, followed by incubation with streptavidin-conjugated alkaline phosphatase (1:200) for 1 h at room temperature; then the slides were developed using fast red substrate.

Double immunocytochemistry
To colocalize elastase and the Fc{varepsilon}RIß chain, double immunohistochemistry was performed. After blocking steep, BAL slides were preincubated simultaneously with affinity-purified rabbit polyclonal anti Fc{varepsilon}RI ß chain (5 µg/ml) and anti-elastase mAb (1:100) for 2 h at room temperature. After washing, slides were incubated with biotin-labeled horse anti-mouse IgG (1:100) in the dark for 1 h at room temperature, then with streptavidin-conjugated alkaline phosphatase and FITC-conjugated F(ab)'2 swine anti-rabbit Ig (1:200) for 45 min at room temperature. After visualization with fast red, the cytopreparations were washed and counterstained with hematoxylin. Normal rabbit serum (1:200) and mouse irrelevant IgG1 mAb (1:100) were used as negative controls. These slides were visualized with a Zeiss Axiophot fluorescence microscope (Carl Zeiss, Ltd., Welwyn Garden City, U.K).

PMNs stimulation
Freshly isolated PMNs (2x106/ml) were incubated at 37°C in humidified 5% CO2 in RPMI 1640 medium supplemented with 10% heat-inactivated FCS and antibiotics for 2 h at 37°C with either mAb15–1 or isotype control IgG1 mAb at a final concentration of (10 µg/ml). Cross-linking was then performed by adding goat anti-mouse IgG (Fab)'2 (20 µg/ml) and cells were incubated for another 16 h. Experiments were also performed with mAb15–1, isotype control mAb, and goat anti-mouse Ig (Fab)'2 alone as negative controls. As positive control, the same PMN preparation were stimulated for 18 h with recombinant GM-CSF at 10 ng/ml. After culture, supernatants were removed, clarified by centrifugation, and stored at -80°C until analysis.

IL-8 quantification
Immunoreactive IL-8 was quantitated using dual antibody enzyme-linked immunosorbent assay kit obtained from R&D Systems (Minneapolis, Minn.) according to the manufacturer’s protocol. The sensitivity limit of these kits is 10 pg/ml.

Statistics
Data are presented as mean ± SD. Analysis of difference between Fc{varepsilon}RI {alpha} chain expression in PMNs from asthmatic subjects and normal controls was performed using the Mann Whitney U test. All other differences were determined using analysis of variance with post hoc Fisher’s least significant difference test.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Detection of mRNA encoding Fc{varepsilon}RI {alpha}, ß, and {gamma} subunits
To determine whether human PMNs express Fc{varepsilon}RI, the total RNA extracted from PMNs of asthmatic subjects and controls was probed with cDNA encoding for the Fc{varepsilon}RI{alpha} chain. A specific signal at 1.2 kb was detected in all PMNs RNA preparations from asthmatic subjects with variable intensity according to individual donors (Fig. 1A , lanes 2, 3, 5, 7, and 9). A positive signal was observed in eosinophils from asthmatic subjects (Fig. 1A , lanes 6 and 12) and in eosinophil differentiated HL-60 cells used as positive control (Fig. 1A , lanes 4 and 10), but not in the undifferentiated HL-60 cells (Fig. 1A , lanes 1 and 11). These results agree with the variable levels of Fc{varepsilon}RI{alpha} chain expression observed in monocytes (22) , eosinophils (23) , and platelets (25) . Using RT-PCR and Southern blot analysis, Fc{varepsilon}RI{alpha} chain mRNA expression was also detected in PMNs from asthmatic subjects and the eosinophil differentiated HL-60 cells (Fig. 4B , lanes 2–4, 6), but not in PMNs from normal control (Fig. 1B , lane 5).



View larger version (89K):
[in this window]
[in a new window]
 
Figure 1. Detection of Fc{varepsilon}RI{alpha}, ß, and {gamma} subunit transcripts in human PMN preparations. A) Northern blot analysis of Fc{varepsilon}RI{alpha} chain in peripheral blood PMNs. Undifferentiated HL-60 cell line (clone 15) used as negative control (lanes 1, 11); PMNs obtained from asthmatic donors (lanes 2, 3, 5, 7, 9); eosinophil-differentiated HL-60 cell line (clone 15) used as positive control (lanes 4, 10); eosinophil from two asthmatic donors (lanes 6, 12); PMNs obtained from normal donor (lane 8). B) RT-PCR and Southern blot analysis of Fc{varepsilon}RI{alpha} and ß chain expression on peripheral blood PMNs. No cDNA (lane 1); PMNs obtained from asthmatic donors (lanes 2–4); PMNs obtained from normal control (lane 5) and eosinophil differentiated HL60 cell line (lane 6). RT-PCR was performed with specific primers to {alpha}, ß and the specificity of the amplified fragments was confirmed by Southern blot analysis using an internal nested primer. C) RT-PCR analysis of Fc{varepsilon}RI{gamma} chain expression on peripheral blood PMNs. All RNA preparations tested showed {gamma} specific amplified fragment. ß-Actin was used as control.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Inhibition of IgE Fc fragment binding to PMNs by anti-human Fc{varepsilon}RI{alpha} mAb15–1. PMNs from an asthmatic patient were analyzed by flow cytometry for the expression of Fc{varepsilon}RI{alpha} chain and IgE receptors. Preincubation of PMNs with IgE Fc or mAb15–1 (dashed line in panels A and B, respectively) for 1 h at 4°C results in significant inhibition of mAb15–1 and BIgE Fc fragment binding to PMNs. The binding of mAb15–1 or IgE Fc was not inhibited when PMNs were preincubated with either human IgG (2 mg/ml) or isotype control mAb, respectively (dashed line in panels C, D). Results are representative of three independent experiments performed under the same conditions.

To investigate the nature of the Fc{varepsilon}RI subunits in PMNs, the ß chain mRNA expression in highly purified PMNs was analyzed by RT-PCR and Southern blot analysis. A specific band of the expected size (446 bp) was detected in PMNs from asthmatic subjects and eosinophil differentiated HL-60 cells (Fig. 1B , lanes 2–4, 6). The expression of {gamma} chain mRNA was detected by RT-PCR in all PMN preparations from asthmatic subjects and in normal controls (Fig. 1C ). Two amplified products of Fc{varepsilon}RI{gamma} were detected: one was of the predicted size at 338 bp and one was 100 bp smaller, which may correspond to a splice variant lacking the second transmembrane region coding exon (32) .

Localization of Fc{varepsilon}RI{alpha} chain mRNA to PMNs by in situ hybridization
To ascertain that PMNs could express the Fc{varepsilon}RI{alpha} chain, we performed in situ hybridization on PMN preparations from asthmatic subjects and normal controls. In Fig. 2A , B , PMNs from asthmatic subjects show a positive signal with the 35S-labeled antisense Fc{varepsilon}RI{alpha} chain riboprobe. No cells were labeled when incubated with the sense riboprobe (Fig. 2C ).



View larger version (131K):
[in this window]
[in a new window]
 
Figure 2. Detection of Fc{varepsilon}RI{alpha} chain mRNA in human PMNs by in situ hybridization. A) Positive signal was detected using antisense Fc{varepsilon}RI{alpha} chain riboprobe in PMNs from an asthmatic patient. The Fc{varepsilon}RI{alpha} chain positive cells (dark field, arrows in panel B) shows neutrophil morphology with phase-contrast microscopy (D). C) No specific signal was detected with sense probe. Magnification x200 in panel A, x400 in panels B–D. The data are representative of nine experiments.

Surface expression of Fc{varepsilon}RI on human PMNs from asthmatic subjects
To determine whether peripheral blood PMNs express the Fc{varepsilon}RI receptor on the cell surface, purified cells from 18 atopic asthmatic subjects and 18 normal controls were analyzed by flow cytometry for the expression of Fc{varepsilon}RI{alpha} chain. As shown in Fig. 3A , CD16-positive PMNs from an asthmatic patient were expressed on their surface Fc{varepsilon}RI{alpha} chain when assessed by mAb15–1 with mean percentage of positivity 88% (mean log fluorescence intensities of 5.5-fold over control mAb). The surface Fc{varepsilon}RI expression was confirmed in all subjects with asthma. In every case, Fc{varepsilon}RI expression was detectable with a mean percentage of positive cells 38 ± 30% (mean log fluorescence intensity 3.2±2-fold greater than the negative control mAb, n=18, Fig. 3C ). However, Fc{varepsilon}RI surface expression was not observed in freshly isolated PMNs from normal controls (n=18) as described previously (16 ; Fig. 3B Fig. 3, C ). Surface expression of the Fc{varepsilon}RI{alpha} chain was detected in the neutrophil differentiated human cell line HL-60 (data not shown). Taken together, these data indicate that human PMNs from asthmatic subjects but not from normal controls express the mRNA and the membrane-bound Fc{varepsilon}RI receptor.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Surface expression of Fc{varepsilon}RI on human PMNs from asthmatic subjects and normal controls. Highly purified PMNs from an asthmatic (A) and normal control subjects (B) were analyzed with FITC-conjugated mouse anti-CD16 (left panel), used as positive control, and mouse anti-human Fc{varepsilon}RI{alpha} chain mAb 15–1 (right panel). Similar results were obtained with mAbCRA2 (data not shown). The thin line corresponds to FITC-conjugated control mouse mAb IgG1 (left panel) or IgG1 isotype matched (MOPC-21) (right panel). C) PMNs obtained from additional asthmatic patients (n=18) and normal controls (n=18) were analyzed with mAb15–1 and IgG1 control mAbs. Expressed on the y axis are values of percentage of mAb15–1-positive PMNs obtained in each donor. The percentage of positive cells was calculated by subtracting the isotype control from the specific signal. *P<0.001 using Mann Whitney U test.

Inhibition of IgE Fc fragments binding to PMNs by mAb15–1
We performed an inhibition binding study to determine whether anti-Fc{varepsilon}RI{alpha} chain mAb15–1 could inhibit the binding of biotin-labeled chimeric IgE Fc fragments (BIgE-Fc) to human PMNs. A subpopulation of PMNs from an asthmatic patient expressing Fc{varepsilon}RI receptor (60.7% positivity, Fig. 4A ), was also able to bind the BhIgE-Fc (78.3% positivity, Fig. 4B ). The specificity of IgE binding was confirmed by the fact that it could be inhibited by preincubation of PMNs with the mAb15–1 (Fig. 4B ) or CRA-2 (data not shown). Similar results were obtained in PMNs from additional subjects with a mean percentage of inhibition 67 ± 5.9% (n=3). In contrast to anti-Fc{varepsilon}RI{alpha} chain mAb15–1, IgG1 isotype control has no effect on the binding of BIgE-Fc to PMNs (Fig. 4D ). Conversely, the binding of mAb15–1 was significantly inhibited by preincubation with unlabeled IgE-Fc (Fig. 4A ) but not with a high dose of human IgG (2 mg/ml) (Fig. 4C ). These results demonstrate clearly that human IgE binds mainly to the cell surface of human PMNs via the Fc{varepsilon}RI.

To further support this notion, we identified the Fc{varepsilon}RI{alpha} chain from PMNs total protein extracts using immunoprecipitation with IgE Fc fragment and anti-IgE, followed by Western blot analysis using mAb15–1. A band of the expected molecular size (~46 kDa) corresponding to the Fc{varepsilon}RI{alpha} chain was detected on PMNs and peripheral blood mononuclear cells used as positive control (Fig. 5 , lanes 1–3 and 4, respectively). No band could be detected in PMNs from normal control or when the Western blot was performed with mAb15–1 without prior IgE immunoprecipitation (Fig. 5 , lanes 5, 6).



View larger version (82K):
[in this window]
[in a new window]
 
Figure 5. Detection of Fc{varepsilon}RI{alpha} chain by immunoprecipitation and Western blot analysis. Fc{varepsilon}RI{alpha} chain was detected in PMNs from asthmatic subjects (lanes 1 to 3), peripheral blood mononuclear cells (PBMC) used as positive control (lane4), but not in PMNs from normal control (lane5). Cell lysate was first immunoprecipitated with IgE Fc fragment (lanes 1 to 5) or without IgE Fc fragment (lane 6) and followed by protein G Sepharose-coated beads conjugated with goat anti-human IgE. The eluate was separated by SDS-PAGE (13%) and transferred to membrane. The membrane was incubated with mAb15–1, followed by biotin-conjugated horse anti-mouse Ig and streptavidin alkaline phosphatase.

Detection of Fc{varepsilon}RI{alpha} and ß subunits in peripheral blood and BAL PMNs by immunocytochemistry
To investigate the protein expression of the Fc{varepsilon}RI subunits on PMNs, immunocytochemistry was performed with anti-Fc{varepsilon}RI{alpha} chain mAb15–1 and polyclonal anti-ß chain. Figure 6A , C shows a specific staining with mAb15–1 and polyclonal anti-ß chain in peripheral blood PMNs from an asthmatic subject. Substitution of the primary antibody with irrelevant mouse IgG1 or normal rabbit serum eliminated the immunostaining confirming the specificity of the reaction (Fig. 6B Fig. 6, D ). In addition, the expression of Fc{varepsilon}RI{alpha} chain immunoreactivity in blood PMNs was significantly higher in asthmatic subjects compared to normal controls (data not shown).



View larger version (99K):
[in this window]
[in a new window]
 
Figure 6. Detection of Fc{varepsilon}RI {alpha} and ß chains immunoreactivity on peripheral blood and BAL PMNs. Human peripheral blood and BAL PMNs from an asthmatic donor showed positive immunoreactivity for {alpha} and ß chain using anti-Fc{varepsilon}RI{alpha} chain mAb15–1 (A, E) and polyclonal anti-ß chain (C, G). No staining was detected with the negative control mAb IgG1 (B, F) or normal rabbit serum (D, H). Positive staining was also observed in other cell types including eosinophils and macrophages (filled arrow in panels A, E, and G). I, J) Double immunolocalization of elastase and Fc{varepsilon}RIß chain on BAL cells from asthmatic patient. The anti-human neutrophil elastase positive cells (red staining, I) also showed staining with anti-Fc{varepsilon}RIß chain (fluorescence, J).

Bronchoalveolar lavage (BAL) cytospins from asthmatic subjects were also analyzed using immunocytochemistry with anti-Fc{varepsilon}RI{alpha} and ß chain antibodies. Cells with multilobed nuclei exhibit positive immunoreactivity for the Fc{varepsilon}RI{alpha} and ß chains (red staining) (Fig. 6E Fig. 6, G ). Other cell types in the BAL that show immunoreactivity to mAb15–1 and polyclonal anti-ß chain include macrophages, previously reported to express Fc{varepsilon}RI (26) . However, no signal was detected with isotype control (Fig. 6F , H ). The neutrophil phenotype nature of the positively stained BAL cells was confirmed by double immunocytochemistry using anti-human elastase, a specific marker for PMNs, and polyclonal anti-ß chain (Fig. 6I , J ).

Fc{varepsilon}RI-mediated IL-8 release from human PMNs
IL-8 production and release is one feature of the allergic process (33) . To verify whether the engagement of Fc{varepsilon}RI expressed in human PMNs induce the release of IL-8, peripheral blood PMNs from asthmatic subjects were incubated with mAb15–1(10 µg/ml) and cross-linked with anti-mouse IgG(Fab)'2. The IL-8 release was evaluated in culture medium after 18 h. As shown in Fig. 7 , cross-linking of Fc{varepsilon}RI induced significant release of IL-8 compared to mAb control. Indeed, the levels of IL-8 released in the external milieu was almost 10-fold increased in mAb15–1-stimulated PMNs from asthmatic subjects when compared with control mAb (493±87pg/ml vs. 47±18pg/ml, respectively, P<0.001, n=3). Furthermore, a significant amount of IL-8 was detected in external medium when the same preparation of PMNs was incubated with GM-CSF used as positive control (data not shown). Therefore, these data indicate that PMN activation via Fc{varepsilon}RI leads to the release of IL-8.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Effect of Fc{varepsilon}RI cross-linking on IL-8 release by human PMNs. IL-8 release from PMNs of asthmatic subjects stimulated with either mAb15–1, isotype matched control. Assays were performed in duplicate on (2x106) of PMNs from the same donor. These results represents mean ±SD of three independent experiments performed under the same conditions. ANOVA with post hoc Fisher’s least significant difference test was performed to analyze the difference between the samples. The significance of the difference is *P<0.001 compared to all other samples; and #P=0.052 compared to isotype mAb control.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Although the expression of Fc{varepsilon}RI has been shown on inflammatory cells, its expression on PMNs had not been reported before. In this study, we have shown the surface expression of Fc{varepsilon}RI on peripheral blood PMNs obtained from asthmatic subjects and demonstrated that these cells express the mRNA for all three subunits. Most important, human IgE mainly bind to the cell surface of PMNs from asthmatic subjects via Fc{varepsilon}RI, and the engagement of this receptor is involved in the release of IL-8 from PMNs. The finding that PMNs from asthmatic subjects can be activated through Fc{varepsilon}RI engagement suggests that these cells may have an effect at the site of inflammation through the release of chemokines.

Here we provide several lines of evidence to indicate that PMNs from asthmatic subjects express the Fc{varepsilon}RI receptor at the mRNA and protein level, first by Northern blot and RT-PCR using highly purified PMN preparations (purity more than 98%) and by using in situ hybridization to rule out the possibility of contamination and to colocalize the mRNA of Fc{varepsilon}RI {alpha} chain at the cellular level. We showed clearly the presence of positive signal in a subpopulation of PMN preparation from asthmatic subjects but not in normal controls. This indicates that the expression of Fc{varepsilon}RI{alpha} mRNA is not constitutive, but rather under regulatory control, and it is quite possible that cellular microenvironment such as in allergic asthma may induce Fc{varepsilon}RI expression. Second, FACS analysis using anti-Fc{varepsilon}RI mAbs, mAb15–1, and CRA-2, reagents previously shown to bind specifically to transfectants expressing Fc{varepsilon}RI receptor (20 , 27) , bound in a similar fashion to PMNs. Short-term (1 h) preincubation with mAb15–1 or CRA-2 significantly inhibited (~70%) the IgE binding to PMNs, which is similar to what has been described for eosinophils and platelets (23 , 34) . Conversely, IgE Fc fragment inhibited completely the binding of mAb15–1 to PMNs. Third, immunoprecipitation and Western blot analysis confirmed the presence of Fc{varepsilon}RI{alpha} chain on PMNs. Consistent with membrane surface expression observed with FACS analysis, peripheral blood and BAL PMNs from asthmatic subjects also exhibit positive immunoreactivity for the {alpha} and ß chains; double immunocytochemistry colocalized Fc{varepsilon}RIß chain immunoreactivity to elastase-positive cells in BAL.

Although surface expression of Fc{varepsilon}RI{alpha} was detected on PMNs obtained from the majority of asthmatic subjects, the expression was widely heterogeneous among individual donors, as described previously on other inflammatory cells (22 23 24 25) . Moreover, a significant difference was observed between the level of Fc{varepsilon}RI{alpha} surface expression and Fc{varepsilon}RI immunopositive PMNs detected by immunocytochemistry, which detect both the surface and intracellular stored protein (data not shown). Similar observations have been reported in epidermal Langerhans cells (35) and eosinophils (23 , 36) . Furthermore, in contrast to asthmatic patients, PMNs isolated from normal controls showed no surface expression (16) and immunoreactivity for Fc{varepsilon}RI{alpha}. The lack of Fc{varepsilon}RI{alpha} chain surface expression on PMNs from normal controls may be explained by several possibilities. Previous in vivo and in vitro studies have shown that surface expression of many Fc receptors on human PMNs are up-regulated or induced after treatment with cytokines. In particular, the Th-2 cytokines, GM-CSF, and IL-4 have been shown to induce the surface expression of CD23/Fc{varepsilon}RII (16) and CD11b/CD18 (37) on human PMNs and to up-regulate the Fc{varepsilon}RI{alpha} chain mRNA expression in human eosinophils (38) . In accordance with this, GM-CSF and IL-4 receptors have been demonstrated on human PMNs (39 , 40) . As such, one may speculate that factors highly expressed in allergic asthma such as Th-2 cytokines may induce the Fc{varepsilon}RI{alpha} chain receptor by, to be determined, mechanism(s).

Recently, lack of Fc{varepsilon}RI{alpha} surface expression has been also shown in PMNs isolated from human Fc{varepsilon}RI{alpha} chain transgenic mice (41 , 42) , which is in contrast to our observation in asthmatic subjects but in accordance with normal controls. The basis for the difference of expression between Fc{varepsilon}RI{alpha} transgenic mice and human is not known, and it is quite possible that the cellular microenvironment is one critical factor to explain this difference. To address this issue, it will be worthwhile to investigate the Fc{varepsilon}RI expression in PMNs in immunized and challenged human Fc{varepsilon}RI{alpha} transgenic mice that may mimic, in part, the atopic asthmatic state. Further studies are under way to understand the mechanism underlying the regulation of Fc{varepsilon}RI expression in PMNs.

Human Fc{varepsilon}RI expression on the cell surface is known to require at least the {alpha} and {gamma} chains (43 , 44) . The ability of the {gamma} chain to allow surface expression of the Fc{varepsilon}RI{alpha} chain is analogous to the role of the {zeta} chains in the expression of the TCR-CD3 complex, although the molecular mechanism of the Fc{varepsilon}RI assembly is still unclear. Both the Fc{varepsilon}RI and {gamma} chains are highly conserved at the transmembrane portions, which are suggested to be important for proper assembly of the Fc{varepsilon}RI receptor complex (43 , 44) . We have demonstrated here the expression of mRNA for all three Fc{varepsilon}RI chains, indicating that Fc{varepsilon}RI on PMNs may be a multimeric complex composed of the same polypeptides as that of the Fc{varepsilon}RI of mast cells and basophils (17) . Furthermore, we have showed {alpha} and ß immunoreactivity in blood and BAL PMNs. Since we did not identify all three chains on individual cells, surface expression of functional Fc{varepsilon}RI in the absence of the ß chain, as reported for Langerhans cells, monocytes, and dendritic cells (20 21 , 23) , cannot be ruled out. The role of the ß chain has been suggested by the finding that it is also associated with the Fc{gamma}RIII, which like the Fc{varepsilon}RI contribute to the initiation of allergic reactions (45) . A correlation of mutations on the Fc{varepsilon}RIß chain gene with atopic dermatitis has also been reported (46 , 47) . More recently, analysis of Fc{varepsilon}RI and Fc{gamma}RIII-dependent responses in mouse models provides genetic evidence that ß chain functions as an amplifier of early and late mast cell responses and in vivo anaphylactic responses (42) .

Although PMNs have been largely neglected as immune cells due to their apparent limited capacity to carry out immune functions, recent data show that PMNs can express MHC class II molecules both in vivo and in vitro (48 , 49) and produce cytokines that can stimulate both cellular and humoral immunity (14) . In allergic inflammation, the surface expression of Fc{varepsilon}RI by human PMNs may be involved in IgE-dependent allergen presentation similar to dendritic cells (23) , the release of neutrophil-specific chemoattractants such as LTB4 (13) , cytokines, and/or chemokines as reported in mast cells and basophils (17 18 19) . We found that Fc{varepsilon}RI engagement induces the release of IL-8. IL-8 has been shown to have chemotactic activity for activated T lymphocytes, eosinophils, and basophils and to enhance the expression of integrins in monocytes as well their adherence to endothelial cells (33) . Our finding suggests that the significant contribution of human PMNs via IgE-dependent activation of Fc{varepsilon}RI may be in attracting other inflammatory cells that more directly cause the airway responses. Enhancement of eosinophils and monocytes accumulation are such examples, but it seems reasonable to suggest that neutrophilic inflammation might contribute to the T lymphocyte emigration (50) . This indicates that PMNs may fulfill immunoregulatory functions by contributing to the local recruitment of inflammatory cells. Experiments are under way to fully characterize the functions of Fc{varepsilon}RI on PMNs.

Neutrophilic airway inflammation has been described in subjects with asthma exacerbation (51) . PMNs recruitment may result from an inflammatory cascade, which may include viral infection (51) . Moreover, PMNs are a potential source of variety of proinflammatory mediators, proteases, and cytotoxic molecules that can be toxic to bronchial structures (52 53 54) . The activation of PMNs could be a potentially relevant destructive mechanism of the epithelial lining of the airway in asthma, possibly resulting in increased bronchial hyperresponsiveness. It is tempting to speculate that IgE-dependent activation of PMNs in some asthmatic subjects may play a role in the exacerbation of asthma.

In conclusion, our study presents the first evidence that human PMNs can express functional Fc{varepsilon}RI on their surface and raises the possibility that these cells may play an important role in asthma via an IgE-dependent mechanism.


   ACKNOWLEDGMENTS
 
We would like to thank Dr. H. Gould for providing the IgE Fc fragment, Dr. J. P. Kinet for the anti-Fc{varepsilon}RI{alpha} (mAb15–1) and anti Fc{varepsilon}RI ß chains, Dr. G. Delespesse for helpful discussions, and Dr. L. Cameron for critical reading of the manuscript. The authors also acknowledge Ms. Elsa Schotman for technical assistance. Supported by: Medical Research Council (MRC) of Canada, MT13273 grant to H.Q., MT 14842 grant to P.M.R. S.G.A, was supported by a fellowship from Medical Research Council, Canada.

Received for publication June 5, 2000. Accepted for publication October 9, 2000.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Lehrer, R. I., Ganz, T., Selsted, M. E., Babior, B. M., Curnutte, J. T. (1988) Neutrophils and host defense. Ann. Intern. Med. 109,127-142
  2. Shen, L., Guyre, P. M., Fanger, M. W. (1987) Polymorphonuclear leukocyte function triggered through the high affinity Fc receptor for monomeric IgG. J. Immunol. 139,534-538[Abstract]
  3. Sibille, Y., Reynolds, H. Y. (1990) Macropahges and polymorphonuclear neutrophils in lung defense and injury. Am. Rev. Resp. Dis. 141,471-474[Medline]
  4. Bradley, B. L., Azzawi, M., Jacobson, M., Assoufi, B., Collins, J. V., Irani, A. M., Schwartz, L. B., Durham, S. R., Jeffery, P. K., Kay, A. B. (1991) Eosinophils, T lymphocytes, mast cells neutrophils and macrophages in bronchial biopsies specimens from atopic subjects with asthma: comparison with biopsy specimens from atopic subjects without asthma and normal control subjects and relationship to bronchial hyperresponsiveness. J. Allergy Clin. Immunol. 88,661-674[Medline]
  5. Fabbri, L. M., Boschetto, P., Zocca, E., Milani, G., Pivirotto, F., Plebani, M., Burlina, A., Licata, B., Mapp, C. E. (1987) Bronchoalveolar neutrophilia during late asthmatic reactions induced by toluene diisocyanate. Am. Rev. Resp. Dis. 136,36-42[Medline]
  6. Metzger, W. J., Richerson, H. B., Worden, K., Monick, M., Hunninghake, G. W. (1986) Bronchoalveolar lavage of allergic asthmatic patients following allergen bronchoprovocation. Chest 89,477-483[Abstract/Free Full Text]
  7. Virchow, J. C., Walker, J. R. C., Hafner, D., Kortsik, C., Werner, P., Matthys, H., Kroegel, C. (1995) T cells and cytokines in bronchoalveolar lavage fluid after segmental allergen provocation in atopic asthma. Am. J. Resp. Crit. Care Med. 151,960-965[Abstract]
  8. Smith, H. R., Larsen, G. L., Cherniack, R. M., Wenzel, S. E., Voelkel, N. F., Westcott, J. Y., Bethel, R. A. (1992) Inflammatory cells and eicosanoid mediators in subjects with late asthmatic responses and increase in airway responsiveness. J. Allergy Clin. Immunol. 89,1076-1084[Medline]
  9. Lee, T. H., Nagy, L., Nagakura, T., Walport, M. J., Kay, A. B. (1982) Identification and partial characterisation of an exercise induced neutrophil chemotactic factor in bronchial asthma. J. Clin. Invest. 69,889-899
  10. Venge, P., Henriksen, J., Dahl, R., Hakansson, L. (1990) Exercise induced asthma and the generation of neutrophil chemotactic activity. J. Allergy Clin. Immunol. 85,498-504[Medline]
  11. Driver, A. G., Kukuly, C. A., Metzger, W. J., Mustafa, S. J. (1991) Bronchial challenge with adenosine causes the release of serum neutrophil chemotactic factor in asthma. Am. Rev. Resp. Dis. 143,1002-1007[Medline]
  12. Kay, A. B., Wadlaw, A. J., Moqbel, R., et al (1987) Leukocytes and asthma process. Kay, A. G. eds. Allergy and Inflammation ,203-223 Academic Press London.
  13. Boshetto, P., Mapp, C. E., Picotti, G., Fabbri, L. M. (1989) Neutrophils and asthma. Eur. Resp. J. 6(Suppl.),456-459
  14. Llyold, A. R., Oppenheim, J. J. (1992) Poly’s lament: the neglected role of the polymorphonuclear neutrophil in the afferent limb of the immune response. Immunol. Today 13,169-172[Medline]
  15. Truong, M. J., Gruart, V., Kusnierz, J. P., Papin, J. P., Loiseau, S., Capron, A., Capron, M. (1993) Human neutrophils express immunoglobulin E (IgE)-binding proteins (Mac-2/epsilon BP) of the S-type lectin family: role in IgE-dependent activation. J. Exp. Med. 177,243-248[Abstract/Free Full Text]
  16. Yamaoka, K. A., Arock, M., Issaly, F., Dugas, N., LeGoff, L., Kolb, J. P. (1996) Granulocyte macrophage colony stimulating factor induces Fc{varepsilon}RII/CD23 expression on normal human polymorphonuclear neutrophils. Int. Immunol. 4,479-490
  17. Sutton, B. J., Gould, H. J. (1993) The human IgE network. Nature (London) 366,421-428[Medline]
  18. Burd, P. R., Rogers, H. W., Gordon, J. R. C., Martin, A., Jayaraman, S., Wilson, S. D., Dvorak, A. M., Galli, S. J., Dorf, M. E. (1989) Interleukin-3 dependent and independent mast cells stimulated with IgE and antigen express multiple cytokines. J. Exp. Med. 170,245-257[Abstract/Free Full Text]
  19. Plaut, M., Pierce, J. H. C., Watson, J., Hanley-Hyde, J., Nordan, R. P., Paul, W. E. (1989) Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium ionophores. Nature (London) 339,64-67[Medline]
  20. Gordon, J. R., Galli, S. (1991) Release of both preformed and newly synthesized tumor necrosis factor (TNF-{alpha})/cachectin by mouse mast cells stimulated via the Fc{varepsilon}RI. A mechanism for the sustained action of mast cell derived TNF-{alpha} during IgE dependent biological responses. J. Exp. Med. 174,103-107[Abstract/Free Full Text]
  21. Wang, B., Rieger Kilgus, A., Ochiai, K., Maurer, D., Fodinger, D., Kinet, J. P., Stingl, G. (1992) Epidermal Langerhans cells from normal human skin bind monomeric IgE via Fc epsilon RI. J. Exp. Med. 175,1353-1365[Abstract/Free Full Text]
  22. Maurer, D., Fiebiger, E., Reininger, B., Wolff-Winiski, B., Jouvin, M. H., Kilgus, O., Kinet, J. P., Stingl, G. (1994) Expression of functional high affinity IgE receptors (Fc{varepsilon}RI) on monocytes of atopic individuals. J. Exp. Med. 179,745-750[Abstract/Free Full Text]
  23. Soussi Gounni, A., Lamkhioued, B., Ochiai, K., Tanaka, Y., Delaporte, E., Capron, A., Capron, M. (1994) High affinity IgE receptor on eosinophils is involved in defence against parasites. Nature (London) 367,183-187[Medline]
  24. Maurer, D., Fiebiger, S., Ebner, C., Reininger, B., Fischer, G. F., Wichlas, S., Jouvin, M. H., Schmitt-Egenolf, M., Kraft, D., Kinet, J. P., Stingl, G. (1996) Peripheral blood dendritic cells express Fc epsilon RI as a complex composed of Fc epsilon RI alpha and Fc epsilon RI gamma-chains and can use this receptor for IgE-mediated allergen presentation. J. Immunol. 15,607-616
  25. Joseph, M., Soussi Gounni, A., Kusnierz, J. P., Vorng, H., Sarfati, M., Kinet, J. P., Tonnel, A. B., Capron, A., Capron, M. (1997) Expression and functions of the high-affinity IgE receptor on human platelets and megakaryocyte precursors. Eur. J. Immunol. 27,2212-2218[Medline]
  26. Ying, S., Barata, L. T., Meng, Q., Grant, J. A., Barkans, J., Durham, S. R., Kay, A. B. (1996) High-affinity immunoglobulin E receptor (Fc epsilon RI) bearing eosinophils, mast cells, macrophages and Langerhans’ cells in allergen-induced late-phase cutaneous reactions in atopic subjects. Immunology 93,281-288
  27. Ra, C., Kuromitsu, S., Hirose, S., Yasuda, K., Furuichi, K., Okumura, K. (1993) Soluble human high affinity receptor for IgE abrogates the IgE mediated allergic reaction. Int. Immunol. 5,47-52[Abstract/Free Full Text]
  28. . American Thoracic Society (1987) Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease (COPD) and asthma. Am. Rev. Resp. Dis. 136,225[Medline]
  29. Hansel, T. T., DeVries, I. J. M., Iff, T., Rihs, S., Wandzilak, M., Betz, S., Blaser, K., Walker, C. (1991) An improved immunomagnetic procedure for the isolation of high purified human blood eosinophils. J. Immunol. Methods 145,105-110[Medline]
  30. Fischkof, S. A. (1988) Graded increase probability of eosinophilic differentiation of HL-60 promyelocytic leukemia cells induced in culture under alkaline conditions. Leukoc. Res. 12,679-683
  31. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular Cloning: A laboratory Manual 2nd Ed Cold Spring Harbor Laboratory Press Cold Spring Harbor, New York.
  32. Kuster, H., Hompson, H., Kinet, J. P. (1990) Characterization and expression of the gene for the human Fc receptor gamma subunit. Definition of a new gene family. J. Biol. Chem. 265,6448-6452[Abstract/Free Full Text]
  33. Wuyts, A., Proost, P., Damme, J. V. (1998) Interleukin-8 and other CXC chemokines. Thomson, A. eds. The Cytokine Handbook ,185-208 San Diego California.
  34. Hasegawa, S., Pawankar, R., Suzuki, K., Nakahata, T., Furukawa, S., Okumura, K., Ra, C. (1999) Functional expression of the high affinity receptor for IgE (Fc{varepsilon}RI) in human platelets and its intracellular expression in human megakaryocytes. Blood 93,2543-2551[Abstract/Free Full Text]
  35. Kraft, S., Wessendorf, J. H., Hanau, D., Bieber, T. (1998) Regulation of the high affinity receptor for IgE on human epidermal Langerhans cells. J. Immunol. 161,1000-1006[Abstract/Free Full Text]
  36. Soussi Gounni, A., Lamkhioued, B., Masao, M., Delphine, A., Sarfati, M., Capron, A., Capron, M. (1998) Molecular characterisation of the low affinity IgE receptor Fc{varepsilon}RII/CD23 expressed by human eosinophils. Int. Immunol. 10,395-404[Abstract/Free Full Text]
  37. Dale, D. C., Liles, W. C., Lewellyn, C., Price, T. H. (1998) Effects of granulocyte–macrophage colony-stimulating factor (GM-CSF) on neutrophil kinetics and function in normal human volunteers. Am. J. Hematol. 57,7-15[Medline]
  38. Terada, N., Konno, A., Terada, Y., Fukuda, S., Yamashita, T., Abe, T., Shimada, H., Ishida, K., Yoshimura, K., Tanaka, Y., Ra, C., Ishikawa, K., Togawa, K. (1995) IL-4 upregulate Fc{varepsilon}RI{alpha} chain messenger RNA in eosinophils. J. Allergy Clin. Immunol. 96,1161-1169[Medline]
  39. Lopez, A. F., Williamson, D. J., Gamble, J. R., Begely, C. G., Harlan, J. M., Klebanoff, S. J., Waltersdorph, A., Wong, G., Clark, S. C., Vadas, M. A. (1986) Recombinant human granulocyte macrophage colony stimulating factor stimulates in vitro mature human and eosinophil function, surface receptor expression, and survival. J. Clin. Invest. 78,1220-1227
  40. Girard, D., Paquin, R., Bealieu, A. D. (1997) Responsiveness of human neutrophils to interleukin-4: induction of cytoskeletal rearrangements, de novo protein synthesis and delay of apoptosis. Biochem. J. 325,147-153
  41. Dombrowicz, D., Brini, A. T., Flammand, V., Hicks, E. J., Snouwaert, N., Kinet, J. P., Koller, B. H. (1996) Anaphylaxis mediated through a humanized high affinity IgE receptor. J. Immunol. 157,1645-1651[Abstract]
  42. Dombrowicz, D., Lin, S., Flammand, V., Brini, A. T., Koller, B. H., Kinet, J. P. (1998) Allergy associated FcR beta is a molecular amplifier of IgE and IgG mediated in vivo responses. Immunity 8,517-529[Medline]
  43. Ra, C., Jouvin, M. H., Kinet, J. P. (1991) Complete structure of the mouse mast cell receptor for IgE (Fc{varepsilon}RI) and surface expression of chimeric receptors (rat-mouse-human) on transfected cells. J. Biol. Chem. 264,15323-15327[Abstract/Free Full Text]
  44. Varin-Blank, N., Metzger, H. (1990) Surface expression of mutated subunits of the high affinity mast cell receptor for IgE. J. Biol. Chem. 265,15685-15694[Abstract/Free Full Text]
  45. Kurosaki, T., Gander, I., Wirthmueller, U., Ravetch, J. V. (1992) The ß subunit of the Fc{varepsilon}RI is associated with the Fc{gamma}RIII on mast cells. J. Exp. Med. 175,447-451[Abstract/Free Full Text]
  46. Ravetch, J. V. (1994) Atopy and Fc receptors: mutation is the message?. Nat. Genet. 7,117-118[Medline]
  47. Shirakawa, T., Li, A., Dubowitz, M., Dekker, J. W., Shaw, A. E., Faux, J. A., Ra, C., Cookson, W. M., Hopkin, J. M. (1994) Association between atopy and various of the ß subunits of the high affinity immunoglobulin E receptor. Nat. Genet. 7,125-129[Medline]
  48. Gosselin, E. J., Wardwell, K., Rigby, W. F., Guyre, P. M. (1993) Induction of MHC class II on human polymorphonuclear neutrophils by granulocyte/macrophage colony-stimulating factor, IFN-gamma, and IL-3. J. Immunol. 151,1482-1490[Abstract]
  49. Carulli, G. (1997) Effects of recombinant human granulocyte colony stimulating factor administration on neutrophil phenotype and functions. Haematology 82,606-616
  50. Taub, D. D., Anver, M., Oppenheim, J. J., Longo, D. L., Murphy, W. J. (1996) T lymphocyte recruitment by interleukin-8 (IL-8). IL-8 induced degranulation of neutrophils releases potent chemoattractants for human T lymphocytes both in vitro and in vivo. J. Clin. Invest. 97,1931-1941[Medline]
  51. Fahy, J. V., Kim, K. W., Liu, J., Boushey, H. A. (1995) Prominent neutrophilic inflammation in sputum from subjects with asthma exacerbation. J. Allergy Clin. Immunol. 95,843-852[Medline]
  52. Brusasco, V., Crimi, E., Gianiorio, P., Lantero, S., Rossi, G. A. (1990) Allergen-induced increase in airway responsiveness and inflammation in mild asthma. J. Cell. Physiol. 69,2209-2214
  53. Fujisawa, T., Kephart, G. M., Gray, B. H., Gleich, G. J. (1990) The neutrophil and chronic allergic inflammation. Immunochemical localization of neutrophil elastase. Am. Rev. Resp. Dis. 141,689-697[Medline]
  54. Hallahan, A. R., Armour, C. L., Black, J. L. (1990) Products of neutrophils and eosinophils increase the responsiveness of human isolated bronchial tissue. Eur. Resp. J. 3,554-558[Abstract]



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
D. M. Cooper, S. Radom-Aizik, C. Schwindt, and F. Zaldivar Jr.
Dangerous exercise: lessons learned from dysregulated inflammatory responses to physical activity
J Appl Physiol, August 1, 2007; 103(2): 700 - 709.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Vega, P. Chacon, J. Monteseirin, R. El Bekay, G. Alba, J. Martin-Nieto, and F. Sobrino
Expression of the transcription factor NFAT2 in human neutrophils: IgE-dependent, Ca2+- and calcineurin-mediated NFAT2 activation
J. Cell Sci., July 15, 2007; 120(14): 2328 - 2337.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. S. Saffar, M. P. Alphonse, L. Shan, K. T. HayGlass, F. E. R. Simons, and A. S. Gounni
IgE Modulates Neutrophil Survival in Asthma: Role of Mitochondrial Pathway
J. Immunol., February 15, 2007; 178(4): 2535 - 2541.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Takahashi, N. Hayashi, S. Kaminogawa, and C. Ra
Molecular Mechanisms for Transcriptional Regulation of Human High-Affinity IgE Receptor beta-Chain Gene Induced by GM-CSF
J. Immunol., October 1, 2006; 177(7): 4605 - 4611.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. S. Gounni
The high-affinity IgE receptor (Fc{epsilon}RI): a critical regulator of airway smooth muscle cells?
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L312 - L321.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Vega, P. Chacon, G. Alba, R. El Bekay, J. Monteseirin, J. Martin-Nieto, and F. Sobrino
Modulation of IgE-dependent COX-2 gene expression by reactive oxygen species in human neutrophils
J. Leukoc. Biol., July 1, 2006; 80(1): 152 - 163.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Suzukawa, K. Hirai, M. Iikura, H. Nagase, A. Komiya, C. Yoshimura-Uchiyama, H. Yamada, C. Ra, K. Ohta, K. Yamamoto, et al.
IgE- and Fc{varepsilon}RI-mediated migration of human basophils
Int. Immunol., September 1, 2005; 17(9): 1249 - 1255.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. M. Gueders, M. Balbin, N. Rocks, J.-M. Foidart, P. Gosset, R. Louis, S. Shapiro, C. Lopez-Otin, A. Noel, and D. D. Cataldo
Matrix Metalloproteinase-8 Deficiency Promotes Granulocytic Allergen-Induced Airway Inflammation
J. Immunol., August 15, 2005; 175(4): 2589 - 2597.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. S. Gounni, V. Wellemans, J. Yang, F. Bellesort, K. Kassiri, S. Gangloff, M. Guenounou, A. J. Halayko, Q. Hamid, and B. Lamkhioued
Human Airway Smooth Muscle Cells Express the High Affinity Receptor for IgE (Fc{epsilon}RI): A Critical Role of Fc{epsilon}RI in Human Airway Smooth Muscle Cell Function
J. Immunol., August 15, 2005; 175(4): 2613 - 2621.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Monteseirin, P. Chacon, A. Vega, R. El Bekay, M. Alvarez, G. Alba, M. Conde, J. Jimenez, J. A. Asturias, A. Martinez, et al.
Human neutrophils synthesize IL-8 in an IgE-mediated activation
J. Leukoc. Biol., September 1, 2004; 76(3): 692 - 700.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Idzko, E. Panther, C. Stratz, T. Muller, H. Bayer, G. Zissel, T. Durk, S. Sorichter, F. Di Virgilio, M. Geissler, et al.
The Serotoninergic Receptors of Human Dendritic Cells: Identification and Coupling to Cytokine Release
J. Immunol., May 15, 2004; 172(10): 6011 - 6019.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Takahashi, C. Nishiyama, M. Hasegawa, Y. Akizawa, and C. Ra
Regulation of the Human High Affinity IgE Receptor {beta}-Chain Gene Expression Via an Intronic Element
J. Immunol., September 1, 2003; 171(5): 2478 - 2484.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Taube, A. Dakhama, Y.-H. Rha, K. Takeda, A. Joetham, J.-W. Park, A. Balhorn, T. Takai, K. R. Poch, J. A. Nick, et al.
Transient Neutrophil Infiltration After Allergen Challenge Is Dependent on Specific Antibodies and Fc{gamma}III Receptors
J. Immunol., April 15, 2003; 170(8): 4301 - 4309.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
D. D. Cataldo, J. Bettiol, A. Noel, P. Bartsch, J.-M. Foidart, and R. Louis
Matrix Metalloproteinase-9, but Not Tissue Inhibitor of Matrix Metalloproteinase-1, Increases in the Sputum From Allergic Asthmatic Patients After Allergen Challenge
Chest, November 1, 2002; 122(5): 1553 - 1559.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Dang, S. Wiehler, and K. D. Patel
Increased PSGL-1 expression on granulocytes from allergic-asthmatic subjects results in enhanced leukocyte recruitment under flow conditions
J. Leukoc. Biol., October 1, 2002; 72(4): 702 - 710.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. G. Harris, R. S. Smith, and R. P. Phipps
15-Deoxy-{Delta}12,1412,14-PGJ2 Induces IL-8 Production in Human T Cells by a Mitogen-Activated Protein Kinase Pathway
J. Immunol., February 1, 2002; 168(3): 1372 - 1379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GOUNNI, A. S.
Right arrow Articles by HAMID, Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GOUNNI, A. S.
Right arrow Articles by HAMID, Q.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS