|
|
||||||||
RI): role in asthma




* Meakins Christie Laboratories, McGill University, Montreal, Quebec, Canada;
Centre de Recherche, CHUM, Notre Dame Hospital, Montreal, Quebec, Canada; and
Juntendo University Medical School, Tokyo, Japan
1Correspondence: Meakins-Christie Laboratories, McGill University, 3626 St. Urban Street, H2X2P2, Montreal, Quebec, Canada. E-mail: Abdel{at}meakins.lan.mcgill.ca
| ABSTRACT |
|---|
|
|
|---|
RII and galectin-3). In allergic diseases, the
dominant role of IgE has been mainly ascribed to its high-affinity
receptor, Fc
RI. We have examined the expression of Fc
RI by PMNs.
mRNA and cell surface expression of Fc
RI
chain was identified on
PMNs from asthmatic subjects. Furthermore, preincubation with human IgE
Fc fragment blocks completely the binding of anti-Fc
RI
chain
(mAb151) to human PMNs. Conversely, preincubation of PMNs with
mAb151 inhibits significantly the binding of IgE Fc fragment to PMNs,
indicating that IgE bound to the cell surface of PMNs mainly via the
Fc
RI. Peripheral blood and bronchoalveolar lavage (BAL) PMNs from
asthmatic subjects also express intracellular Fc
RI
and ß chain
immunoreactivity. Engagement of Fc
RI induces the release of IL-8 by
PMNs. Collectively, these observations provide new evidence that PMNs
express the Fc
RI and suggest that these cells may play a role in
allergic inflammation through an IgE-dependent activation
mechanism.Gounni, A. S., Lamkhioued, B., Koussih, L., Ra, C.,
Renzi, P. M, Hamid, Q. Human neutrophils express the high-affinity
receptor for immunoglobulin E (Fc
RI): role in asthma.
Key Words: allergic diseases IgE receptors interleukin 8
| INTRODUCTION |
|---|
|
|
|---|
IgE binding structures play a pivotal role in many pathophysiological
mechanisms of atopic diseases such as asthma. So far, two types of IgE
receptors have been demonstrated in human PMNs: galactin 3
(Mac-2/
BP) and the low-affinity receptor for IgE (Fc
RII/CD23)
(15
16)
. Besides these receptors, the high-affinity
receptor for IgE (Fc
RI) is a key structure involved in immediate
allergic manifestations. Initially, it was described on mast cells and
basophils (17
18
19
20)
, but more recently on other cell types,
including eosinophils, and has been correlated with atopic disease
(21
22
23
24
25
26)
. However, whether human PMNs express the Fc
RI
has not been determined. To improve our understanding of the
pathophysiologic role of PMNs in atopic disease, we examined this
prospect. Our study shows that human PMNs from asthmatic patients
express functional Fc
RI receptor and provide a potential mechanism
by which these cells may contribute to the manifestation of allergic
disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RI
chain monoclonal antibody mAb-15
(21)
RIß chain (976, raised against a peptide representing amino
acids 2439 of human Fc
RIß chain) were kindly donated by Dr.
J. P. Kinet (Harvard Medical School, Boston, Mass.). Murine
anti-Fc
RI
chain mAb mAbCRA2 (mouse IgG1), which recognizes the
IgE binding site, was described previously (27)
Subjects
This study was approved by the Ethics Committee of the Montreal
Chest Hospital, Montreal, Quebec. Eighteen mild asthmatic patients, as
defined by the American Thoracic Society, were included in this study
(28)
. Eighteen nonatopic, nonasthmatic controls with
negative skin tests and normal spirometry were also studied. Patients
had not received inhaled or systemic corticosteroids in the last 3
months and were not receiving any medication other than ß agonists.
Subjects who had upper respiratory tract infection within the last
month were excluded from the study. Bronchoscopy was performed on
asthmatic subjects as described previously (4)
.
Human PMN purification
Blood was taken after informed consent and collected into
heparinized tubes. Human PMNs were purified as described previously
(29)
. In brief, blood was diluted with
Ca2+/Mg2+-free PBS, then
overlaid onto a Ficoll-Paque gradient and centrifuged at 400
g for 20 min. The granulocyte-rich fraction was then mixed
with dextran 70 (4.5%) and the red blood cells (RBCs) were allowed to
sediment for 30 min at room temperature. The supernatant was collected
and centrifuged for 10 min at 400 g to recover the
granulocytes. The residual RBCs were lysed with hypotonic saline. The
granulocytes were then incubated with anti-CD16-coated microbeads for
30 min at 4°C and the contaminating cells were eluted by washing the
cells with PBS/1% BSA through a MACS column. PMNs with a purity of
98% ± 1.4% were obtained using this technique as determined by
staining cytospins with Diff-Quick (Fisher Scientific, Pittsburgh,
Pa.). The viability of the cells was >98% as assessed by trypan blue
dye exclusion.
Cell line and culture conditions
The human cell line HL-60 clone 15 was provided from the
American Tissue Culture Collection (ATCC) (Rockville, Md.). Cells were
cultured at 37°C in humidified 5% CO2 in RPMI
1640 medium supplemented with 10% heat-inactivated FCS and antibiotics
(100 U/ml penicillin and 100 µg/ml streptomycin). Differentiation
toward the eosinophils or neutrophils was performed as described
previously (30)
. Cells were grown in RPMI 1640, 10% FCS
in the presence of butyric acid (0.3 mM) or DMSO (1.25% V/V) for 7
days to generate eosinophils or neutrophils, respectively.
Northern blot analysis
Probe: 572 bp of the Fc
RI
chain cDNA within the coding
region was made by RT-PCR using specific primers (
1 and
2) of the
Fc
RI
chain (22)
. After enzyme digestion analysis and
subcloning in pBluescript vector (Stratagene, La Jolla, Calif.), the
probe was confirmed by sequencing. The vector was linearized with
appropriate digestion enzyme to recover the Fc
RI
chain cDNA.
Total RNA from highly purified PMNs was extracted using Trizol as
recommended by the supplier (Gibco BRL, Burlington, Canada). Equal
amounts of total RNA (10 µg) were separated by electrophoresis on
1.2% agarose formaldehyde denaturing gel (31)
and
transferred to nylon membranes (Amersham Int., Burckinghamshire, U.K.).
The blots were prehybridized for 2 h at 42°C in hybridization
solution (40% formamide, 10% dextran sulfate, 4% SSC, 20
mmol/Tris-HCl pH 7.4, 1x Denhardts solution, 50 µg/ml denatured
salmon sperm DNA, and 0.1% SDS). Hybridization was performed with
human Fc
RI
chain cDNA probe labeled with
32P-dCTP by random hexamer priming (Amersham) for
18 h at 42°C. The blots were washed at high stringency
conditions: three times at room temperature in 2x SSC, 0.05% SDS and
twice at 55°C in 0.1x SSC, 0.05% SDS for 30 min each. After
hybridization, blots were washed, dried, and exposed to Kodak XAR film
with an intensifying screen at -70°C.
RT-PCR analysis
Reverse transcription (RT) was performed by using 2 µg of
total RNA of PMNs obtained from each patient in a first-strand cDNA
synthesis reaction with Super Script reverse transcriptase as
recommended by the supplier (GibcoBRL). PCR was performed by adding 1
µl of the RT product into 50 µl of total volume reaction containing
1x buffer; 200 µmol of each dNTPs; 20 pmol of each oligonucleotide
primer and 0.2 unit of Ampli-Taq polymerase (Gibco-BRL).
Oligonucleotides specific for
, ß and
sequences on either side
of a splice junction were used in the PCR reaction to preclude
amplification of possible contaminating genomic DNA. Oligonucleotide
primers were designed based on the published sequences
(20)
. The Fc
RI
chain oligonucleotides were
1:
5'TACAGTAATGTTGAGGGGCTCAG3';
2: 5'CTGTTCTTCGCTCCAGATGGCGTT3';
internal primer or
3: 5'CCTGTACACATCCCAGTTCCTCCAACCAT3'. The
Fc
RIß chain primers were 5'primer: 5'GGACACAGAAAAGTAATAGGAGAG3';
3'primer: 5'GATCAGGATGGTAATTCCCGTT3'; internal primer: 5'
TTTTCATCATTTAAGCAGGTTATCCATT3'. The Fc
RI
chain primers were: 5'
primer: 5' CCAGCAGTGGTCTTGCTCTCTTAC 3'; 3'primer:
5'GCATGCAGGCATATGTGATGCC3'. PCR was carried out as described previously
(23)
.
Southern blot analysis
Amplified products were blotted on Hybond N membrane using
standard methods (31)
. Oligonucleotide probes were labeled
with 3-deoxy digoxigenin-labeled ATP using terminal transferase.
Hybridization was carried out as recommended by the supplier
(Boehringer, Mannheim, Germany).
Cytospin preparations
Cytospin slides were prepared from BAL or peripheral blood PMNs,
fixed in 4% paraformaldehyde for 20 min at room temperature and washed
with 0.05M Tris-HCl-buffered isotonic saline, pH.7.6 (TBS). After
drying, the slides were stored at -20°C before immunocytochemistry
or in situ hybridization.
In situ hybridization
The vector containing the Fc
RI
chain cDNA was linearized
with the appropriate enzymes and transcribed with
[
35S]UTP to generate sense and antisense
riboprobes as recommended by the supplier (Promega, Madison, Wis.).
Cytospin preparations were first permeabilized by immersion in 0.3%
Triton X-100 in PBS for 10 min, followed by exposure to proteinase K (1
µg/ml in 20 mM Tris-HCL and 1 mM EDTA, pH 7.2) for 30 min at 37°C.
The slides were prehybridized with 50% formamide, tRNA, Denhardts in
2x SSC for 15 min at 42°C. Hybridization was performed with
[
-35S] UTP-labeled riboprobes (either
antisense or sense) for 16 h at 42°C. Posthybridization washings
were done with SSC solutions (4x SSC and 0.1x SSC), followed by
ribonuclease A treatment to remove unhybridized single-stranded RNA.
The preparations were dehydrated, immersed in emulsion, and subjected
to autoradiography for 18 days. The slides were developed and
subsequently counterstained with hematoxylin. As negative control,
sections were hybridized with the sense probe or pretreated with RNAse
before hybridization with the antisense probe.
Flow cytometry analysis
Samples of 105 PMNs in 100 µl of PBS/5%
FCS were incubated for 30 min on ice with mAb151, CRA2, or mAb
control (final concentration 10 µg/ml) in the presence of 2 mg/ml of
affinity-purified human IgG to block the nonspecific Fc fragment
binding. The cells were washed twice with PBS/2% FCS and incubated in
the dark for 30 min on ice with goat FITC-conjugated anti-mouse IgG
(1:200). The cells were washed three times with PBS/2% FCS,
resuspended in 500 µl of PBS and analyzed on FACScan. FACS analysis
was done with Cellquest Software (Becton Dickinson, Rutherford, N.J.).
The results are presented as overlaid histograms and percentage of
positive cells or fold increase of the geometric mean fluorescence
intensity (MFI). The fold increase of Fc
RI
chain expression was
calculated by dividing the MFI units of mAb151 staining by the MFI
units of control mAb staining in each donor.
To inhibit anti-Fc
RI
chain mAb151 binding to the PMNs,
105 cells in 100 µl of PBS/5% FCS were
preincubated for 1 h at 4°C with IgE-Fc (10 µg/ml) with gentle
agitation. Cells were then washed and incubated with a saturating
concentration of mAb151 (10 µg/ml) for 1 h at 4°C. After
washing, cells were incubated with FITC-conjugated anti-mouse IgG for
30 min, washed, and analyzed as described above.
Inhibition of IgE-Fc fragment binding to PMNs by mAb151
To inhibit IgE-Fc Fragment binding to the PMNs,
105 cells in 100 µl of PBS/5% FCS were
preincubated for 1 h at 4°C with mAb151 or control mAb at (50
µg/ml) with gentle agitation. Cells were then washed and incubated
with a saturating concentration of biotin-conjugated IgE-Fc fragment
(BIgE-Fc, 10 µg/ml) for 1 h at 4°C. After wash, cells were
incubated with extravidin-FITC for 30 min, washed and analyzed as
described above.
Immunoprecipitation and Western blot analysis
For protein extraction, highly purified PMNs were lysed for 30
min at 4°C in Nonidet P-40 lysis buffer supplemented with a mixture
of protease inhibitors (2 mM sodium orthovanadate, 1 mM
phenyl-methylsulfonylfluoride, 10 µg/ml leupeptin, 0.15 units/ml
aprotinin, 1 µg/ml pepstatin A) and centrifuged for 20 min to remove
nuclei. Cell lysates were sequentially incubated with or without IgE Fc
fragment for 16 h at 4°C in a rotating mixer, followed by
protein G Sepharose-coated beads conjugated with goat anti-human IgE
for 2 h at 4°C. Beads were pelleted by centrifugation and washed
three times with the wash buffer (PBS/1%Nonidet P-40). For
immunoblotting, samples were separated on SDS-polyacrylamide gel (13%)
and electrotransferred onto polyvinylidene membrane (Millipore,
Missisauga, Ontario). The membrane was blocked at room temperature for
1 h in blocking solution (10 mM Tris-HCl, pH 7.5, 100 mM NaCl,
005% Tween-20, and 1% BSA). Membrane was incubated with
anti-Fc
RI
chain mAb151 (1 µg/ml) at room temperature for
2 h, followed by biotin-conjugated horse anti-mouse IgG and
streptavidin alkaline phosphatase. The blots were developed by enhanced
chemiluminescence as recommended by the supplier (Boehringer).
Immunocytochemistry
Cytopreparations of purified PMNs from asthmatic subjects or
normal controls were washed in TBS, saturated with blocking buffer
(10% human normal serum, 10% normal goat serum) for 15 min at room
temperature, and incubated with mAb151 or isotype control mAb both at
10 µg/ml overnight at 4°C. After washing three times with TBS, the
cytopreparations were incubated with rabbit anti-mouse IgG (1:60) for
45 min, followed by APAAP for 1 h at room temperature. After
washing with TBS, the slides were developed using fast red substrate,
followed by counterstaining in hematoxylin.
For ß chain immunodetection, cytopreparation slides were saturated
with blocking buffer for 15 min, washed, and incubated with
affinity-purified rabbit polyclonal anti-Fc
RIß chain (5 µg/ml)
or normal rabbit serum (1:200) overnight at 4°C. After washing,
biotinylated swine anti-rabbit IgG (1:200) was added for 30 min at
37°C, followed by incubation with streptavidin-conjugated alkaline
phosphatase (1:200) for 1 h at room temperature; then the slides
were developed using fast red substrate.
Double immunocytochemistry
To colocalize elastase and the Fc
RIß chain, double
immunohistochemistry was performed. After blocking steep, BAL slides
were preincubated simultaneously with affinity-purified rabbit
polyclonal anti Fc
RI ß chain (5 µg/ml) and anti-elastase mAb
(1:100) for 2 h at room temperature. After washing, slides were
incubated with biotin-labeled horse anti-mouse IgG (1:100) in the dark
for 1 h at room temperature, then with streptavidin-conjugated
alkaline phosphatase and FITC-conjugated F(ab)'2
swine anti-rabbit Ig (1:200) for 45 min at room temperature. After
visualization with fast red, the cytopreparations were washed and
counterstained with hematoxylin. Normal rabbit serum (1:200) and mouse
irrelevant IgG1 mAb (1:100) were used as negative controls. These
slides were visualized with a Zeiss Axiophot fluorescence microscope
(Carl Zeiss, Ltd., Welwyn Garden City, U.K).
PMNs stimulation
Freshly isolated PMNs (2x106/ml) were
incubated at 37°C in humidified 5% CO2 in RPMI
1640 medium supplemented with 10% heat-inactivated FCS and antibiotics
for 2 h at 37°C with either mAb151 or isotype control IgG1 mAb
at a final concentration of (10 µg/ml). Cross-linking was then
performed by adding goat anti-mouse IgG (Fab)'2
(20 µg/ml) and cells were incubated for another 16 h.
Experiments were also performed with mAb151, isotype control mAb, and
goat anti-mouse Ig (Fab)'2 alone as negative
controls. As positive control, the same PMN preparation were stimulated
for 18 h with recombinant GM-CSF at 10 ng/ml. After culture,
supernatants were removed, clarified by centrifugation, and stored at
-80°C until analysis.
IL-8 quantification
Immunoreactive IL-8 was quantitated using dual antibody
enzyme-linked immunosorbent assay kit obtained from R&D Systems
(Minneapolis, Minn.) according to the manufacturers protocol. The
sensitivity limit of these kits is 10 pg/ml.
Statistics
Data are presented as mean ± SD. Analysis of
difference between Fc
RI
chain expression in PMNs from asthmatic
subjects and normal controls was performed using the Mann Whitney
U test. All other differences were determined using analysis
of variance with post hoc Fishers least significant difference test.
| RESULTS |
|---|
|
|
|---|
RI
, ß, and
subunits
RI, the total
RNA extracted from PMNs of asthmatic subjects and controls was probed
with cDNA encoding for the Fc
RI
chain. A specific signal at 1.2
kb was detected in all PMNs RNA preparations from asthmatic subjects
with variable intensity according to individual donors (Fig. 1A
RI
chain
expression observed in monocytes (22)
RI
chain mRNA expression was also
detected in PMNs from asthmatic subjects and the eosinophil
differentiated HL-60 cells (Fig. 4B
|
|
To investigate the nature of the Fc
RI subunits in PMNs, the ß
chain mRNA expression in highly purified PMNs was analyzed by RT-PCR
and Southern blot analysis. A specific band of the expected size (446
bp) was detected in PMNs from asthmatic subjects and eosinophil
differentiated HL-60 cells (Fig. 1B
, lanes 24, 6). The
expression of
chain mRNA was detected by RT-PCR in all PMN
preparations from asthmatic subjects and in normal controls (Fig. 1C
). Two amplified products of Fc
RI
were detected: one
was of the predicted size at 338 bp and one was 100 bp smaller, which
may correspond to a splice variant lacking the second transmembrane
region coding exon (32)
.
Localization of Fc
RI
chain mRNA to PMNs by in
situ hybridization
To ascertain that PMNs could express the Fc
RI
chain, we
performed in situ hybridization on PMN preparations from
asthmatic subjects and normal controls. In Fig. 2A
, B
, PMNs from asthmatic subjects show a positive
signal with the 35S-labeled antisense Fc
RI
chain riboprobe. No cells were labeled when incubated with the sense
riboprobe (Fig. 2C
).
|
Surface expression of Fc
RI on human PMNs from asthmatic subjects
To determine whether peripheral blood PMNs express the Fc
RI
receptor on the cell surface, purified cells from 18 atopic asthmatic
subjects and 18 normal controls were analyzed by flow cytometry for the
expression of Fc
RI
chain. As shown in Fig. 3A
, CD16-positive PMNs from an asthmatic patient were
expressed on their surface Fc
RI
chain when assessed by mAb151
with mean percentage of positivity 88% (mean log fluorescence
intensities of 5.5-fold over control mAb). The surface Fc
RI
expression was confirmed in all subjects with asthma. In every case,
Fc
RI expression was detectable with a mean percentage of positive
cells 38 ± 30% (mean log fluorescence intensity 3.2±2-fold
greater than the negative control mAb, n=18, Fig. 3C
). However, Fc
RI surface expression was not observed in
freshly isolated PMNs from normal controls (n=18) as
described previously (16
; Fig. 3B
Fig. 3, C
). Surface
expression of the Fc
RI
chain was detected in the neutrophil
differentiated human cell line HL-60 (data not shown). Taken together,
these data indicate that human PMNs from asthmatic subjects but not
from normal controls express the mRNA and the membrane-bound Fc
RI
receptor.
|
Inhibition of IgE Fc fragments binding to PMNs by mAb151
We performed an inhibition binding study to determine whether
anti-Fc
RI
chain mAb151 could inhibit the binding of
biotin-labeled chimeric IgE Fc fragments (BIgE-Fc) to human PMNs. A
subpopulation of PMNs from an asthmatic patient expressing Fc
RI
receptor (60.7% positivity, Fig. 4A
), was also able to bind the BhIgE-Fc (78.3% positivity,
Fig. 4B
). The specificity of IgE binding was confirmed by
the fact that it could be inhibited by preincubation of PMNs with the
mAb151 (Fig. 4B
) or CRA-2 (data not shown). Similar
results were obtained in PMNs from additional subjects with a mean
percentage of inhibition 67 ± 5.9% (n=3). In contrast
to anti-Fc
RI
chain mAb151, IgG1 isotype control has no effect
on the binding of BIgE-Fc to PMNs (Fig. 4D
). Conversely, the
binding of mAb151 was significantly inhibited by preincubation with
unlabeled IgE-Fc (Fig. 4A
) but not with a high dose of human
IgG (2 mg/ml) (Fig. 4C
). These results demonstrate clearly
that human IgE binds mainly to the cell surface of human PMNs via the
Fc
RI.
To further support this notion, we identified the Fc
RI
chain from
PMNs total protein extracts using immunoprecipitation with IgE Fc
fragment and anti-IgE, followed by Western blot analysis using
mAb151. A band of the expected molecular size (
46 kDa)
corresponding to the Fc
RI
chain was detected on PMNs and
peripheral blood mononuclear cells used as positive control (Fig. 5
, lanes 13 and 4, respectively). No band could be detected in PMNs
from normal control or when the Western blot was performed with
mAb151 without prior IgE immunoprecipitation (Fig. 5
, lanes 5, 6).
|
Detection of Fc
RI
and ß subunits in peripheral blood and
BAL PMNs by immunocytochemistry
To investigate the protein expression of the Fc
RI subunits on
PMNs, immunocytochemistry was performed with anti-Fc
RI
chain
mAb151 and polyclonal anti-ß chain. Figure 6A
, C
shows a specific staining with mAb151 and polyclonal
anti-ß chain in peripheral blood PMNs from an asthmatic subject.
Substitution of the primary antibody with irrelevant mouse IgG1 or
normal rabbit serum eliminated the immunostaining confirming the
specificity of the reaction (Fig. 6B
Fig. 6, D
). In addition, the
expression of Fc
RI
chain immunoreactivity in blood PMNs was
significantly higher in asthmatic subjects compared to normal controls
(data not shown).
|
Bronchoalveolar lavage (BAL) cytospins from asthmatic subjects were
also analyzed using immunocytochemistry with anti-Fc
RI
and ß
chain antibodies. Cells with multilobed nuclei exhibit positive
immunoreactivity for the Fc
RI
and ß chains (red staining) (Fig. 6E
Fig. 6, G
). Other cell types in the BAL that show
immunoreactivity to mAb151 and polyclonal anti-ß chain include
macrophages, previously reported to express Fc
RI (26)
.
However, no signal was detected with isotype control (Fig. 6F
, H
). The neutrophil phenotype nature of the
positively stained BAL cells was confirmed by double
immunocytochemistry using anti-human elastase, a specific marker for
PMNs, and polyclonal anti-ß chain (Fig. 6I
, J
).
Fc
RI-mediated IL-8 release from human PMNs
IL-8 production and release is one feature of the allergic process
(33)
. To verify whether the engagement of Fc
RI
expressed in human PMNs induce the release of IL-8, peripheral blood
PMNs from asthmatic subjects were incubated with mAb151(10 µg/ml)
and cross-linked with anti-mouse IgG(Fab)'2. The IL-8
release was evaluated in culture medium after 18 h. As shown in
Fig. 7
, cross-linking of Fc
RI induced significant release of IL-8 compared
to mAb control. Indeed, the levels of IL-8 released in the external
milieu was almost 10-fold increased in mAb151-stimulated PMNs from
asthmatic subjects when compared with control mAb (493±87pg/ml vs.
47±18pg/ml, respectively, P<0.001, n=3).
Furthermore, a significant amount of IL-8 was detected in external
medium when the same preparation of PMNs was incubated with GM-CSF used
as positive control (data not shown). Therefore, these data indicate
that PMN activation via Fc
RI leads to the release of IL-8.
|
| DISCUSSION |
|---|
|
|
|---|
RI has been shown on inflammatory
cells, its expression on PMNs had not been reported before. In this
study, we have shown the surface expression of Fc
RI on peripheral
blood PMNs obtained from asthmatic subjects and demonstrated that these
cells express the mRNA for all three subunits. Most important, human
IgE mainly bind to the cell surface of PMNs from asthmatic subjects via
Fc
RI, and the engagement of this receptor is involved in the release
of IL-8 from PMNs. The finding that PMNs from asthmatic subjects can be
activated through Fc
RI engagement suggests that these cells may have
an effect at the site of inflammation through the release of
chemokines.
Here we provide several lines of evidence to indicate that PMNs from
asthmatic subjects express the Fc
RI receptor at the mRNA and protein
level, first by Northern blot and RT-PCR using highly purified PMN
preparations (purity more than 98%) and by using in situ
hybridization to rule out the possibility of contamination and to
colocalize the mRNA of Fc
RI
chain at the cellular level. We
showed clearly the presence of positive signal in a subpopulation of
PMN preparation from asthmatic subjects but not in normal controls.
This indicates that the expression of Fc
RI
mRNA is not
constitutive, but rather under regulatory control, and it is quite
possible that cellular microenvironment such as in allergic asthma may
induce Fc
RI expression. Second, FACS analysis using anti-Fc
RI
mAbs, mAb151, and CRA-2, reagents previously shown to bind
specifically to transfectants expressing Fc
RI receptor (20
, 27)
, bound in a similar fashion to PMNs. Short-term (1 h)
preincubation with mAb151 or CRA-2 significantly inhibited (
70%)
the IgE binding to PMNs, which is similar to what has been described
for eosinophils and platelets (23
, 34)
. Conversely, IgE Fc
fragment inhibited completely the binding of mAb151 to PMNs. Third,
immunoprecipitation and Western blot analysis confirmed the presence of
Fc
RI
chain on PMNs. Consistent with membrane surface expression
observed with FACS analysis, peripheral blood and BAL PMNs from
asthmatic subjects also exhibit positive immunoreactivity for the
and ß chains; double immunocytochemistry colocalized Fc
RIß chain
immunoreactivity to elastase-positive cells in BAL.
Although surface expression of Fc
RI
was detected on PMNs obtained
from the majority of asthmatic subjects, the expression was widely
heterogeneous among individual donors, as described previously on other
inflammatory cells (22
23
24
25)
. Moreover, a significant
difference was observed between the level of Fc
RI
surface
expression and Fc
RI immunopositive PMNs detected by
immunocytochemistry, which detect both the surface and intracellular
stored protein (data not shown). Similar observations have been
reported in epidermal Langerhans cells (35)
and
eosinophils (23
, 36)
. Furthermore, in contrast to
asthmatic patients, PMNs isolated from normal controls showed no
surface expression (16)
and immunoreactivity for
Fc
RI
. The lack of Fc
RI
chain surface expression on PMNs
from normal controls may be explained by several possibilities.
Previous in vivo and in vitro studies have shown
that surface expression of many Fc receptors on human PMNs are
up-regulated or induced after treatment with cytokines. In particular,
the Th-2 cytokines, GM-CSF, and IL-4 have been shown to induce the
surface expression of CD23/Fc
RII (16)
and CD11b/CD18
(37)
on human PMNs and to up-regulate the Fc
RI
chain
mRNA expression in human eosinophils (38)
. In accordance
with this, GM-CSF and IL-4 receptors have been demonstrated on human
PMNs (39
, 40)
. As such, one may speculate that factors
highly expressed in allergic asthma such as Th-2 cytokines may induce
the Fc
RI
chain receptor by, to be determined, mechanism(s).
Recently, lack of Fc
RI
surface expression has been also shown in
PMNs isolated from human Fc
RI
chain transgenic mice (41
, 42)
, which is in contrast to our observation in asthmatic
subjects but in accordance with normal controls. The basis for the
difference of expression between Fc
RI
transgenic mice and human
is not known, and it is quite possible that the cellular
microenvironment is one critical factor to explain this difference. To
address this issue, it will be worthwhile to investigate the Fc
RI
expression in PMNs in immunized and challenged human Fc
RI
transgenic mice that may mimic, in part, the atopic asthmatic state.
Further studies are under way to understand the mechanism underlying
the regulation of Fc
RI expression in PMNs.
Human Fc
RI expression on the cell surface is known to require at
least the
and
chains (43
, 44)
. The ability of the
chain to allow surface expression of the Fc
RI
chain is
analogous to the role of the
chains in the expression of the
TCR-CD3 complex, although the molecular mechanism of the Fc
RI
assembly is still unclear. Both the Fc
RI and
chains are highly
conserved at the transmembrane portions, which are suggested to be
important for proper assembly of the Fc
RI receptor complex
(43
, 44)
. We have demonstrated here the expression of mRNA
for all three Fc
RI chains, indicating that Fc
RI on PMNs may be a
multimeric complex composed of the same polypeptides as that of the
Fc
RI of mast cells and basophils (17)
. Furthermore, we
have showed
and ß immunoreactivity in blood and BAL PMNs. Since
we did not identify all three chains on individual cells, surface
expression of functional Fc
RI in the absence of the ß chain, as
reported for Langerhans cells, monocytes, and dendritic cells
(20
21
, 23)
, cannot be ruled out. The role of the ß
chain has been suggested by the finding that it is also associated with
the Fc
RIII, which like the Fc
RI contribute to the initiation of
allergic reactions (45)
. A correlation of mutations on the
Fc
RIß chain gene with atopic dermatitis has also been reported
(46
, 47)
. More recently, analysis of Fc
RI and
Fc
RIII-dependent responses in mouse models provides genetic evidence
that ß chain functions as an amplifier of early and late mast cell
responses and in vivo anaphylactic responses
(42)
.
Although PMNs have been largely neglected as immune cells due to their
apparent limited capacity to carry out immune functions, recent data
show that PMNs can express MHC class II molecules both in
vivo and in vitro (48
, 49)
and
produce cytokines that can stimulate both cellular and humoral immunity
(14)
. In allergic inflammation, the surface expression of
Fc
RI by human PMNs may be involved in IgE-dependent allergen
presentation similar to dendritic cells (23)
, the release
of neutrophil-specific chemoattractants such as LTB4 (13)
,
cytokines, and/or chemokines as reported in mast cells and basophils
(17
18
19)
. We found that Fc
RI engagement induces the
release of IL-8. IL-8 has been shown to have chemotactic activity for
activated T lymphocytes, eosinophils, and basophils and to enhance the
expression of integrins in monocytes as well their adherence to
endothelial cells (33)
. Our finding suggests that the
significant contribution of human PMNs via IgE-dependent activation of
Fc
RI may be in attracting other inflammatory cells that more
directly cause the airway responses. Enhancement of eosinophils and
monocytes accumulation are such examples, but it seems reasonable to
suggest that neutrophilic inflammation might contribute to the T
lymphocyte emigration (50)
. This indicates that PMNs may
fulfill immunoregulatory functions by contributing to the local
recruitment of inflammatory cells. Experiments are under way to fully
characterize the functions of Fc
RI on PMNs.
Neutrophilic airway inflammation has been described in subjects with
asthma exacerbation (51)
. PMNs recruitment may result from
an inflammatory cascade, which may include viral infection
(51)
. Moreover, PMNs are a potential source of variety of
proinflammatory mediators, proteases, and cytotoxic molecules that can
be toxic to bronchial structures (52
53
54)
. The activation
of PMNs could be a potentially relevant destructive mechanism of the
epithelial lining of the airway in asthma, possibly resulting in
increased bronchial hyperresponsiveness. It is tempting to speculate
that IgE-dependent activation of PMNs in some asthmatic subjects may
play a role in the exacerbation of asthma.
In conclusion, our study presents the first evidence that human PMNs
can express functional Fc
RI on their surface and raises the
possibility that these cells may play an important role in asthma via
an IgE-dependent mechanism.
| ACKNOWLEDGMENTS |
|---|
RI
(mAb151) and
anti Fc
RI ß chains, Dr. G. Delespesse for helpful discussions, and
Dr. L. Cameron for critical reading of the manuscript. The authors also
acknowledge Ms. Elsa Schotman for technical assistance. Supported by:
Medical Research Council (MRC) of Canada, MT13273 grant to H.Q., MT
14842 grant to P.M.R. S.G.A, was supported by a fellowship from
Medical Research Council, Canada. Received for publication June 5, 2000. Accepted for publication October 9, 2000.
| REFERENCES |
|---|
|
|
|---|
RII/CD23 expression on normal human polymorphonuclear neutrophils. Int. Immunol. 4,479-490
)/cachectin by mouse mast cells stimulated via the Fc
RI. A mechanism for the sustained action of mast cell derived TNF-
during IgE dependent biological responses. J. Exp. Med. 174,103-107
RI) on monocytes of atopic individuals. J. Exp. Med. 179,745-750
RI) in human platelets and its intracellular expression in human megakaryocytes. Blood 93,2543-2551
RII/CD23 expressed by human eosinophils. Int. Immunol. 10,395-404
RI
chain messenger RNA in eosinophils. J. Allergy Clin. Immunol. 96,1161-1169[Medline]
RI) and surface expression of chimeric receptors (rat-mouse-human) on transfected cells. J. Biol. Chem. 264,15323-15327
RI is associated with the Fc
RIII on mast cells. J. Exp. Med. 175,447-451This article has been cited by other articles:
![]() |
D. M. Cooper, S. Radom-Aizik, C. Schwindt, and F. Zaldivar Jr. Dangerous exercise: lessons learned from dysregulated inflammatory responses to physical activity J Appl Physiol, August 1, 2007; 103(2): 700 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vega, P. Chacon, J. Monteseirin, R. El Bekay, G. Alba, J. Martin-Nieto, and F. Sobrino Expression of the transcription factor NFAT2 in human neutrophils: IgE-dependent, Ca2+- and calcineurin-mediated NFAT2 activation J. Cell Sci., July 15, 2007; 120(14): 2328 - 2337. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Saffar, M. P. Alphonse, L. Shan, K. T. HayGlass, F. E. R. Simons, and A. S. Gounni IgE Modulates Neutrophil Survival in Asthma: Role of Mitochondrial Pathway J. Immunol., February 15, 2007; 178(4): 2535 - 2541. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, N. Hayashi, S. Kaminogawa, and C. Ra Molecular Mechanisms for Transcriptional Regulation of Human High-Affinity IgE Receptor beta-Chain Gene Induced by GM-CSF J. Immunol., October 1, 2006; 177(7): 4605 - 4611. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Gounni The high-affinity IgE receptor (Fc{epsilon}RI): a critical regulator of airway smooth muscle cells? Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L312 - L321. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vega, P. Chacon, G. Alba, R. El Bekay, J. Monteseirin, J. Martin-Nieto, and F. Sobrino Modulation of IgE-dependent COX-2 gene expression by reactive oxygen species in human neutrophils J. Leukoc. Biol., July 1, 2006; 80(1): 152 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Suzukawa, K. Hirai, M. Iikura, H. Nagase, A. Komiya, C. Yoshimura-Uchiyama, H. Yamada, C. Ra, K. Ohta, K. Yamamoto, et al. IgE- and Fc{varepsilon}RI-mediated migration of human basophils Int. Immunol., September 1, 2005; 17(9): 1249 - 1255. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Gueders, M. Balbin, N. Rocks, J.-M. Foidart, P. Gosset, R. Louis, S. Shapiro, C. Lopez-Otin, A. Noel, and D. D. Cataldo Matrix Metalloproteinase-8 Deficiency Promotes Granulocytic Allergen-Induced Airway Inflammation J. Immunol., August 15, 2005; 175(4): 2589 - 2597. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Gounni, V. Wellemans, J. Yang, F. Bellesort, K. Kassiri, S. Gangloff, M. Guenounou, A. J. Halayko, Q. Hamid, and B. Lamkhioued Human Airway Smooth Muscle Cells Express the High Affinity Receptor for IgE (Fc{epsilon}RI): A Critical Role of Fc{epsilon}RI in Human Airway Smooth Muscle Cell Function J. Immunol., August 15, 2005; 175(4): 2613 - 2621. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Monteseirin, P. Chacon, A. Vega, R. El Bekay, M. Alvarez, G. Alba, M. Conde, J. Jimenez, J. A. Asturias, A. Martinez, et al. Human neutrophils synthesize IL-8 in an IgE-mediated activation J. Leukoc. Biol., September 1, 2004; 76(3): 692 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Idzko, E. Panther, C. Stratz, T. Muller, H. Bayer, G. Zissel, T. Durk, S. Sorichter, F. Di Virgilio, M. Geissler, et al. The Serotoninergic Receptors of Human Dendritic Cells: Identification and Coupling to Cytokine Release J. Immunol., May 15, 2004; 172(10): 6011 - 6019. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, C. Nishiyama, M. Hasegawa, Y. Akizawa, and C. Ra Regulation of the Human High Affinity IgE Receptor {beta}-Chain Gene Expression Via an Intronic Element J. Immunol., September 1, 2003; 171(5): 2478 - 2484. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Taube, A. Dakhama, Y.-H. Rha, K. Takeda, A. Joetham, J.-W. Park, A. Balhorn, T. Takai, K. R. Poch, J. A. Nick, et al. Transient Neutrophil Infiltration After Allergen Challenge Is Dependent on Specific Antibodies and Fc{gamma}III Receptors J. Immunol., April 15, 2003; 170(8): 4301 - 4309. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Cataldo, J. Bettiol, A. Noel, P. Bartsch, J.-M. Foidart, and R. Louis Matrix Metalloproteinase-9, but Not Tissue Inhibitor of Matrix Metalloproteinase-1, Increases in the Sputum From Allergic Asthmatic Patients After Allergen Challenge Chest, November 1, 2002; 122(5): 1553 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dang, S. Wiehler, and K. D. Patel Increased PSGL-1 expression on granulocytes from allergic-asthmatic subjects results in enhanced leukocyte recruitment under flow conditions J. Leukoc. Biol., October 1, 2002; 72(4): 702 - 710. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Harris, R. S. Smith, and R. P. Phipps 15-Deoxy-{Delta}12,1412,14-PGJ2 Induces IL-8 Production in Human T Cells by a Mitogen-Activated Protein Kinase Pathway J. Immunol., February 1, 2002; 168(3): 1372 - 1379. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |