| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Toxicology, Oncology and Molecular Pathology Unit, University of Cagliari, Italy;
Department of Neurological Sciences, University of Verona, Italy; and
Department of Pathology, University of Pittsburgh, Pittsburgh, Pennsylvania, USA
1Correspondence: Dipartimento di Tossicologia, Sezione di Oncologia e Patologia Molecolare, Via Porcell 4, 09124 Cagliari, Italy. E-mail: columbano{at}unica.it
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
B, and STAT3 or changes in the mRNA levels of
the immediate early genes c-fos, c-jun, and c-myc. These
genes are considered to be essential for liver regeneration after
partial hepatectomy (PH). On the other hand, T3 treatment caused an
increase in cyclin D1 mRNA and protein levels that occurred much more
rapidly compared to liver regeneration after 2/3 PH. The early increase
in cyclin D1 expression was associated with accelerated onset of DNA
synthesis, as demonstrated by a 20-fold increase of
bromodeoxyuridine-positive hepatocytes at 12 h after T3 treatment
and by a 20-fold increase in mitotic activity at 18 h. An early
increase of cyclin D1 expression was also observed after treatment with
nafenopin, a ligand of a nuclear receptor (peroxisome
proliferator-activated receptor 
) of the same superfamily of
steroid/thyroid receptors. T3 treatment also resulted in increased
expression of cyclin E, E2F, and p107 and enhanced phosphorylation of
pRb, the ultimate substrate in the pathway leading to transition from
G1 to S phase. The results demonstrate that cyclin D1 induction is one
of the earlier events in hepatocyte proliferation induced by T3 and
suggest that this cyclin might be a common target responsible for the
mitogenic activity of ligands of nuclear receptors.—Pibiri, M.,
Ledda-Columbano, G. M., Cossu, C., Simbula, G., Menegazzi, M.,
Shinozuka, H., Columbano, A. Cyclin D1 is an early target in hepatocyte
proliferation induced by thyroid hormone (T3).
Key Words: nuclear receptor • cell cycle • liver
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. T3 has been shown to be a
powerful inducer of hepatocyte proliferation in rats
(2
3)
, and its mitogenic capacity has been used for
experiments on gene therapy and repopulation of hepatocytes (4
, 5)
. Most, if not all, of these actions are mediated by thyroid
hormone (L-triiodothyronine T3) nuclear receptors (TRs). The TRs are
encoded by two genes ( and ß) and are expressed as several
isoforms (6
, 7)
. The TRs are ligand-dependent
transcription factors that are members of the steroid hormone/retinoic
acid receptor family of nuclear hormone receptors, which includes the
retinoic acid receptor, the retinoid X receptors, the vitamin D
receptor, the peroxisome proliferator-activated receptors (PPARs), and
some orphan receptors (8)
. However, the exact mechanisms
by which TRs mediate hepatocyte proliferation remain elusive.
A key role in the control of the cell cycle is played by a complex
formation between cyclins and cyclin-dependent kinases (cdks).
Activation through phosphorylation of cyclin–cdk complexes leads to
progression into the cell cycle (9
, 10)
. With its cdk
partner, each cyclin acts at a different step of the cell cycle, the
D-type cyclins in association with its main partner cdk4 or cdk6 being
important in the early G1 phase and cyclin E, in
association with cdk2, acting in the late phase of G1
(11
12
13)
. The ultimate substrate in this pathway is pRb,
which is the major target of the cyclin D1/cdk4 complex
(14)
. Phosphorylation of pRb by the cyclin D1/cdk4 complex
frees the E2F transcription factors, enabling them to
trans-activate target genes responsible for the progression
from G1 to S phase of the cell cycle. The phosphorylation of pRb is
triggered initially by cyclin D1/cdk4, but is then accelerated by the
cyclin E/cdk2 complex (14)
. Synthesis of the various cell
cycle-regulatory proteins is believed to take place because of rapid
changes occurring immediately after the mitogenic stimulus. In the case
of compensatory regeneration such as after partial hepatectomy (PH),
hepatocyte proliferation is mediated by several growth factors
(hepatocyte growth factor and transforming growth factor ). After
binding to their cell surface receptors, these growth factors evoke a
cascade of signal transduction that leads to induction of immediate
early genes and activation of G1 cyclins (15
16
17)
.
However, hepatocytes in vivo have a low sensitivity to
growth factors and, to effectively respond to them, have to be modified
(primed) by cytokines such as tumor necrosis factor (TNF-) and
interleukin 6 (IL-6), which are known to activate several key
transcription factors such as NF-B and STAT3 (18
, 19)
.
These changes are considered essential for the transition of
hepatocytes from G0 to G1 in the model of liver regeneration after 2/3
surgical partial hepatectomy or after liver cell necrosis induced by
hepatotoxins (20
21
22)
. In the past few years, however, it
has become increasingly clear that hepatocytes can be induced to
proliferate after treatment with agents (primary mitogens) in the
absence of cell loss/death (23)
. Liver hyperplasia induced
by these agents is independent of changes in immediate early genes,
growth factors/cytokines, and transcription factors
(24
25
26
27)
. Agents that induce direct hyperplasia include
ligands of nuclear receptors (23)
.
To determine the pathways by which T3 promotes hepatocyte
proliferation, we examined changes in activation of transcription
factors, hepatic levels of immediate early genes mRNA, and induction of
G1 and S cyclins and their respective kinases partners after a single
dose of T3. Levels of the CDKs inhibitor p21 were also investigated.
Here we report that T3-induced hepatocyte proliferation is associated
with a rapid increase in cyclin D1 mRNA and protein levels that occurs
in the absence of significant changes in activation of the
transcription factors, NF-B and AP-1, or in the levels of c-fos,
c-jun, and c-myc mRNA. Increased levels of cyclin D1 were
accompanied by an increase in cyclin E and E2F content and by enhanced
phosphorylation of pRb and p107. The hepatomitogen nafenopin, a
peroxisome proliferator and a ligand of nuclear receptors (PPARs) of
the superfamily of steroid/thyroid receptors (28
29
30)
,
also caused a rapid increase in cyclin D1 expression. The results
suggest that T3-induced hepatocyte proliferation occurs through a
pathway different from that of compensatory regeneration and that
direct activation of cyclin D1 is a common event in nuclear
receptor-mediated liver cell proliferation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Immediately after death,
sections of the liver were fixed in 10% buffered formalin and
processed for staining with hematoxylin-eosin or immunohistochemistry.
The remaining liver was snap-frozen in liquid nitrogen and kept at
-80°C until use.
Northern blot analysis
For the extraction of RNA, at each time point frozen livers were
homogenized in 4 M guanidine thiocyanate buffer, layered over a 5.7 M
CsCl, 0.1 M NaAc cushion, and centrifuged for 18 h at 130,000
g. Thirty micrograms of heat-denatured total RNA per lane
was loaded on a 1% agarose/formaldehyde gel containing ethidium
bromide for RNA detection at a UV lamp and blotted on Hybond-N+
membrane (Amersham, Buckingamshire, U.K.). RNA concentration was
determined spectrophotometrically at 260 nm and by ethidium bromide
staining. No differences were recorded. The following
32P-labeled probes were used for hybridization:
c-fos and c-myc were purchased from Oncor Inc.
(Gaithersburg, Md.); the murine probe of c-jun was obtained from
Oncogene Sciences (Uniondale, N.Y.). For cyclin D1, pBluescript plasmid
containing a 900 bp EcoRI fragment was used. DNA probes were
labeled with (32P)dCTP by random priming
(Random Priming DNA labeling Kit, Boehringer Mannheim, Mannheim,
Germany). Membranes were exposed to radiographic film (Eastman Kodak,
Rochester, N.Y.).
Western blot analysis
Total cell extracts were prepared from frozen livers powdered in
liquid nitrogen cold mortar. Equal amounts of powder (
50 mg) from
three different animals were pooled per each sample point and
resuspended in 1 ml Triton lysis buffer (1% Triton X-100, 50 mM
Tris-HCl pH 7.4, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM
PMSF, 5 mM iodoacetic acid, 10 µg/ml each of aprotinin, pepstatin,
leupeptin). Several protease inhibitors were added to the isolation
buffer to minimize protein degradation during the isolation protocol.
After vortexing, extracts were incubated 30 min on ice, centrifuged at
12000 rpm at 4°C, and the supernatants were recovered. All inhibitors
used were purchased from Boehringer Mannheim except for PMSF, NaF, and
DTT, which were purchased from Sigma, and iodoacetic acid, which was
from ICN Biomedicals (Irvine, Calif.). For p21, E2F, Rb, p130, and
p107, nuclear extracts were prepared according to Timchenko et al.
(32)
. The protein concentration of the resulting total
extracts were determined according to the method of Bradford using
bovine serum albumin as standard (DC Protein Assay, Bio-Rad
Laboratories, Hercules, Calif.). For immunoblot analysis, equal amounts
(from 50 to 200 µg/lane) of proteins were electrophoresed on SDS-12%
or -8% polyacrylamide gels. Acrylamide and bis-acrylamide were
purchased from ICN Biomedicals. After gel electrotransfer onto
nitrocellulose membranes (MSI) at 300 mA overnight or 800 mA for 2–4 h
to ensure equivalent protein loading and transfer in all lanes, the
membranes and gels were stained with 0.5% (w/v) Ponceau S red (ICN
Biomedicals) in 1% acetic acid for 5 min, and with Coomassie blue (ICN
Biomedicals) in 10% acetic acid for 30 min, respectively. Before
staining, gels were fixed in 25% (v/v) isopropanol and 10% (v/v)
acetic acid (Sigma). After blocking in TBS containing 0.5% Tween 20
(Sigma) and 5% non-fat dry milk for 1 h at room temperature or
overnight at 4°C, membranes were washed in TBS-T and incubated with
appropriate primary antibodies diluted in blocking buffer. Whenever
possible, the same membrane was used to detect the expression of
different proteins. Depending on the origin of primary antibody,
filters were incubated with either anti-mouse or anti-rabbit
horseradish peroxidase-conjugated IgG (Santa Cruz Biotechnology, Santa
Cruz, Calif.). Immunoreactive bands were identified with
chemiluminescence detection system, as described by the manufacturer
(Supersignal Substrate, Pierce, Rockford, Ill.). When necessary,
antibodies were removed from filters by 30 min incubation at 60°C in
stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl
pH 7.6) and the membranes were reblotted as above.
Antibodies
For immunoblotting experiments, we used mouse monoclonal
antibodies directed against cyclin D1 (72–13 G) and CDK2 (D-12) (Santa
Cruz Biotechnology); pRb (Ser 795) (New England Biolabs, Beverly,
Mass.), p21 (Powerclonal, Upstate Biotech, Lake Placid, N.Y.). The goat
monoclonal antibody-directed anti-p107 (C-18) was purchased from Santa
Cruz Biotechnology. The following rabbit polyclonal antibodies were
from Santa Cruz: CDK4 (H-303), cyclin A (C-19), CDK6 (C-21), cyclin D3
(C-16), cyclin E (M-20), E2F-1 (C-20), and p130 (C-20).
Electrophoretic mobility shift assay
Nuclear extracts were prepared from 200 mg of liver tissue
according to Schreiber et al. (33)
in the presence of 10
µg/ml leupeptin, 5 µg/ml antipain and pepstatin, and 1 mM PMSF
(Sigma). Protein concentration in the nuclear extracts was determined
using the method of Bradford (34)
. Eight micrograms of
nuclear extracts were incubated at room temperature for 30 min with
(2–5x104) of the
[32P]-labeled double-stranded oligonucleotide
containing the consensus NF-B DNA binding site from the IL-6 gene
promoter (IL-6-B) (5' GATCATGTGGGATTTTCCCATGT 3'), the Sif binding
element of c-fos promoter (Sie-m67) (5'
GTCGACATTTCCCGTAAATCG 3'), or the AP-1 DNA binding site (5'
CTAGTGATGAGTCAGCCGGATC 3') in a 15 µl reaction mixture containing 20
mM HEPES, pH 7.9, 50 mM KCl, 10% glycerol, 0.5 mM DTT, 0.1 mM EDTA, 2
µg poly(dI-dC), and1 µg salmon sperm DNA. Products were
fractionated on a nondenaturing 5% polyacrylamide gel in TBE 0.5x
buffer. In competition assays, a 100x oligonucleotide competitor was
added 15 min before the labeled probe. The intensity of the retarded
bands was measured by PhosphorImager.
Immunohistochemistry
Rats treated with T3 or subjected to 2/3 PH were killed 12, 18,
24, or 30 h after treatment. Two hours before death, all rats
received an i.p. injection of BrdU (50 mg/kg, dissolved in distilled
water). We obtained mouse monoclonal anti-BrdU antibody from Becton
Dickinson (San Jose, Calif.) and used the peroxidase method to stain
BrdU-positive hepatocytes. Peroxidase goat anti-mouse immunoglobulin
was from Dako (Dako EnVision+TM Peroxidase Mouse,
Dako Corporation, Carpinteria, Calif.). Four micron-thick sections were
deparaffinized, treated with HCl 2N for 20 min, then with 0.1% trypsin
type II (crude from porcine pancreas, Sigma) for 20 min, and treated
sequentially with normal goat serum 1:10 (Dako), mouse anti-BrdU 1:200
for 1 h and 30' and Dako EnVision+TM
Peroxidase Mouse ready-to-use. The sites of peroxidase binding were
detected by 3,3'-diaminobenzidine. The labeling index (L.I.) was
expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei.
Mitotic activity was determined as a percentage of mitoses/1000
hepatocytes. Results are expressed as means ± SE of 3
to 4 rats per group. At least 2000 hepatocyte nuclei per liver were
scored.
Statistical analysis
Comparison between treated and control group was performed by
Student’s t test.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and Fig. 2A
show that although no hepatocytes entering S phase are
found 12 h after PH (L.I. of 0.3%), a significant number of
hepatocytes are BrdU positive at the same time point after T3
administration (L.I. of 7.1%), with a peak of DNA synthesis at 18 and
24 h after T3 and PH, respectively. A striking increase in mitotic
activity was observed 18 h after T3 (Fig. 2B
).
Quantitation of mitotic activity 18 h after T3 revealed a 20- and
25-fold increase over control and PH rats, respectively (Fig. 1B
); no mitoses were observed 18 h after PH (Fig. 1B
), indicating that T3-induced DNA synthesis did occur
faster than after PH. The accelerated entry of hepatocytes into DNA
synthesis after treatment with T3 was confirmed by the increase of the
levels of cyclin A, a marker of S phase, 18 h after treatment
(Fig. 3
).
|
|
|
To examine the molecular mechanisms responsible for mediating the
growth-promoting effect of T3, we measured changes in activation of the
transcription factor NF-B, a target of TNF- that recently has
been considered to be essential for liver regeneration after cell
loss/death (16
, 17)
. According to previously published
results, gel shift analysis revealed a rapid and transient increase in
binding activity of NF-B soon after PH (Fig. 4
). On the contrary, hepatocyte proliferation induced by T3 occurred in
the complete absence of modification in the binding capacity of this
transcription factor. Similarly, whereas activation of AP-1 occurred
after 2/3 PH, no change in binding activity of this transcription
factor was observed after T3 treatment (Fig. 4)
. Moreover, though the
hepatic levels of mRNA of the immediate early genes c-fos and
c-myc showed a rapid and transient increase after 2/3 PH, no
significant change was found after T3 administration (Fig. 5
). No change in the hepatic expression of c-jun was observed in T3
treated rats (data not shown).
|
|
Next we measured the mRNA levels of a key regulator of G1 to S phase
progression in mammalian cells, namely, cyclin D1. As shown in
Fig. 6A
, treatment with T3 led to an increase in cyclin D1 mRNA
levels that was evident as early as 2 h after treatment and
reached its maximum at 4 h; however, no change of cyclin D1 mRNA
could be observed in the liver of rats subjected to PH. Consistent with
the changes in mRNA levels, cyclin D1 protein content was found to be
increased soon after T3 treatment (4 h); its content was further
elevated at 12 h and was maintained for up to 24 h (Fig. 6B
). On the other hand, the increase in cyclin D1 protein
content after PH was much delayed, being evident only 12 h after
PH. A very rapid increase in cyclin D1 content by T3 was also observed
in a different rat strain: Fischer F-344 (data not shown).
|
To determine whether early induction of cyclin D1 is a specific effect
of T3 or could represent a common target for other liver growth
inducers, we examined cyclin D1 expression after administration of the
mitogen nafenopin, a peroxisome proliferator that, similar to T3, is a
ligand of a receptor (PPAR-) of the superfamily of steroid/thyroid
nuclear receptors (30)
. As shown in Fig. 6C
, a single treatment with nafenopin did cause a rapid enhancement in cyclin
D1 protein content, the increase being evident as early as 2 h
after treatment. Consistent with the results presented in Fig. 6B
, increased cyclin D1 content in PH animals was observed
only between 12 and 18 h after surgery, suggesting that cyclin D1
might be an early and common target of ligands of nuclear receptors
acting as liver mitogens.
T3 also caused increased expression of another member of cyclin D
family, D3, and of cyclin E, a G1 protein working downstream of D-type
cyclins. However, unlike cyclin D1, no major difference in the kinetics
of increase in the expression of cyclin D3 and cyclin E was observed
between T3 and PH rats (Fig. 7
). Protein content of cdks partner of G1 cyclins, cdk2, cdk4, and cdk6
was also examined. As shown in Fig. 7
, no major differences in cdk
content was observed between T3 and PH rats. During progression of the
G1 phase, the activation of cyclin D1–cdk4
complex is responsible for the phosphorylation of the retinoblastoma
protein (pRb) and other members of the pocket family (p107, p130).
Hyperphosphorylation of these proteins releases transcription factors
of the E2F family, which trans-activate the expression of S
phase genes. Therefore, we next examined whether the T3-induced
increase in cyclin D1 could lead to a change in the phosphorylation
state of pRb, as well as p107 and p130. As shown in Fig. 8
, treatment with T3 led to hyperphosphorylation of pRb, which was
evident as early as 12 h after treatment. T3 administration also
led to increased p107 content 12 h after treatment; on the other
hand, no significant change in pRb and p107 was observed in PH rats
until 24 h. No modification of p130 could be observed in the liver
from either T3- or PH-treated rats (Fig. 8)
. The increased
phosphorylation of pRb caused by T3 was also associated with a strong
increase in the expression of the transcription factor E2F-1 (Fig. 8)
.
|
|
Finally, to determine whether hyperphosphorylation of pRb could depend
entirely on enhanced cyclin-associated cdk activities or could also be
due to inhibition by T3 of the cdk inhibitor p21, we measured the level
of this protein in nuclear extracts from T3-treated PH animals and
control rat liver. As shown in Fig. 8
, p21 content strongly increases
concomitant with the peak in S phase (18 h after T3), still being
elevated at 24 h. Moreover, no change in the expression of another
cdk inhibitor, p27, could be observed in the liver from T3-treated and
PH rats (data not shown). These results suggest that T3-induced
modification of pRb and p107 is most likely due to an increase in
cyclin D1-associated kinase activities and not to a decrease in the
protein level of the cdk inhibitors p21 and p27.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. In many types of human tumors, the expression of
cyclin D1 is deregulated, favoring the phosphorylation of pRb, the
major target of this cyclin. Indeed, the cyclin D1 gene was originally
cloned as an oncogene, termed PRAD1, which was found to be activated by
chromosomal translocations present in the genomes of parathyroid
adenoma cells (36)
. Consistent with the oncogenic role of
cyclin D1 are observations that transgenic mice overexpressing this
cyclin in their breast tissue are prone to mammary adenocarcinomas
(37)
whereas coexpression of cyclin D1 and myc genes in
the lymphoid tissue of transgenic mice leads to rapid development of
lymphomas (38
, 39)
. Enhanced expression of cyclin D1
before the onset of DNA synthesis has been reported in the liver
regeneration after 2/3 PH; in this model, an increase in cyclin D1
expression occurs late in G1 (12 h in rat liver and 24–30 h in mouse
liver) (40
41
42)
and is preceded by a series of changes
involving activation of transcription factors. In turn, these factors
induce the expression of immediately early genes (22)
,
some of which (i.e., c-myc) transcriptionally regulate the
gene encoding cyclin D1 (43)
. Even though both
compensatory regeneration and mitogen-induced direct hyperplasia
activate cyclin D1, there were distinct differences in the patterns of
its induction between these two models of hepatocyte proliferation. As
shown in the present study, activation of cyclin D1 by T3 and nafenopin
was very rapid as compared to PH (Fig. 6)
, the onset of hepatocyte DNA
synthesis and the appearance of mitoses being greatly accelerated after
treatment with mitogens. Our results in rat liver agree with recent
in vitro studies showing that T3-induced cell proliferation
in GC cells is associated with a shortening of G1
phase of cell cycle, an early induction of cyclin D1 expression, and
hyperphosphorylation of pRb (44)
.
It is also clear from the present study that activation of cyclin D1
after T3 is not the result of induction of immediate early genes
expression (c-fos, c-jun, and c-myc) or activation of
transcription factors (AP-1 and NF-B), which are believed to be
critical for liver regeneration after PH. In vitro studies
have shown that TR transcriptionally decreases the expression of c-fos
proto-oncogene and AP-1 activity under conditions that stimulate cell
proliferation (45)
; more recent studies demonstrated that
the silencing mediator of retinoic and thyroid hormone receptors (SMRT)
represses trans-activation of AP-1 and NF-B
(46)
.
Based on these observations, it is tempting to suggest that the
activation of cyclin D1 by T3 may be a direct action of TRs on this
gene rather than the consequence of a series of gene activation as seen
in the model of PH; in addition, the early activation of cyclin D1 by
nafenopin, a ligand of the nuclear receptor PPAR shown to be an
essential mediator of PPs-induced hepatocyte proliferation
(47)
, also suggests a direct action of PPARs on cyclin D1
gene. More recently we demonstrated that in the mouse liver, TCPOBOP, a
putative ligand of the orphan nuclear receptor, CAR (48)
,
caused a rapid induction of cyclin D1 that was associated with an
accelerated entry of hepatocytes into S phase (42)
. Thus,
a unified concept is emerging regarding the possible mechanisms of
hepatocyte proliferation induced by several ligands of the nuclear
receptors. Further studies to characterize molecular interactions
between cyclin D1 gene and TRs, PPARs, CAR, and possibly other nuclear
hormone receptors may be critical to verify the validity of this
concept.
|
ACKNOWLEDGMENTS |
|---|
Received for publication July 12, 2000.
Revision received October 5, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
inhibit liver regeneration after partial hepatectomy. Am. J. Physiol. 263,G579-G585B and AP-1 or expression of tumor necrosis factor-. Hepatology 25,585-592[Medline]
(C/EBP) inhibits cell proliferation through the p21 (WAF-1/Cip-1/SDI-1) protein. Genes Dev 10,804-815B and serum response factor. J. Biol. Chem. 275,12470-12474This article has been cited by other articles:
|
|
 |
|
  A. Perra, G. Simbula, M. Simbula, M. Pibiri, M. A. Kowalik, P. Sulas, M. T. Cocco, G. M. Ledda-Columbano, and A. Columbano Thyroid hormone (T3) and TR{beta} agonist GC-1 inhibit/reverse nonalcoholic fatty liver in rats FASEB J, August 1, 2008; 22(8): 2981 - 2989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Fava, Y. Ueno, S. Glaser, H. Francis, S. DeMorrow, L. Marucci, M. Marzioni, A. Benedetti, J. Venter, B. Vaculin, et al. Thyroid hormone inhibits biliary growth in bile duct-ligated rats by PLC/IP3/Ca2+-dependent downregulation of SRC/ERK1/2 Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1467 - C1475. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Columbano, M. Pibiri, M. Deidda, C. Cossu, T. S. Scanlan, G. Chiellini, S. Muntoni, and G. M. Ledda-Columbano The Thyroid Hormone Receptor-{beta} Agonist GC-1 Induces Cell Proliferation in Rat Liver and Pancreas Endocrinology, July 1, 2006; 147(7): 3211 - 3218. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Franco, V. G. A. Arciuch, J. G. Peralta, S. Galli, D. Levisman, L. M. Lopez, L. Romorini, J. J. Poderoso, and M. C. Carreras Hypothyroid Phenotype Is Contributed by Mitochondrial Complex I Inactivation Due to Translocated Neuronal Nitric-oxide Synthase J. Biol. Chem., February 24, 2006; 281(8): 4779 - 4786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-C. Yen, Y.-H. Huang, C.-Y. Liao, C.-J. Liao, W.-L. Cheng, W.-J. Chen, and K.-H. Lin Mediation of the inhibitory effect of thyroid hormone on proliferation of hepatoma cells by transforming growth factor-beta J. Mol. Endocrinol., February 1, 2006; 36(1): 9 - 21. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Ledda-Columbano, F. Molotzu, M. Pibiri, C. Cossu, A. Perra, and A. Columbano Thyroid hormone induces cyclin D1 nuclear translocation and DNA synthesis in adult rat cardiomyocytes FASEB J, January 1, 2006; 20(1): 87 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. W. Woodmansee, J. M. Kerr, E. A. Tucker, J. R. Mitchell, D. J. Haakinson, D. F. Gordon, E. C. Ridgway, and W. M. Wood The Proliferative Status of Thyrotropes Is Dependent on Modulation of Specific Cell Cycle Regulators by Thyroid Hormone Endocrinology, January 1, 2006; 147(1): 272 - 282. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Xiao, D. Chinnappan, R. Pestell, C. Albanese, and H. C. Weber Bombesin Regulates Cyclin D1 Expression through the Early Growth Response Protein Egr-1 in Prostate Cancer Cells Cancer Res., November 1, 2005; 65(21): 9934 - 9942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G M Ledda-Columbano, A Perra, M Pibiri, F Molotzu, and A Columbano Induction of pancreatic acinar cell proliferation by thyroid hormone J. Endocrinol., June 1, 2005; 185(3): 393 - 399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hayashi, T. Tamura, J. Kuroda, H. Ohnota, N. Shibata, M. Akahane, Y. Kashida, and K. Mitsumori Different Inhibitory Effects in the Early and Late Phase of Treatment with KAT-681, a Liver-Selective Thyromimetic, on Rat Hepatocarcinogenesis Induced by 2-Acetylaminofluorene and Partial Hepatectomy after Diethylnitrosamine Initiation Toxicol. Sci., March 1, 2005; 84(1): 22 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.M. Ledda-Columbano, M. Pibiri, F. Molotzu, C. Cossu, L. Sanna, G. Simbula, A. Perra, and A. Columbano Induction of hepatocyte proliferation by retinoic acid Carcinogenesis, November 1, 2004; 25(11): 2061 - 2066. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Ledda-Columbano, M. Pibiri, D. Concas, F. Molotzu, G. Simbula, C. Cossu, and A. Columbano Sex difference in the proliferative response of mouse hepatocytes to treatment with the CAR ligand, TCPOBOP Carcinogenesis, June 1, 2003; 24(6): 1059 - 1065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Ledda-Columbano, A. Perra, D. Concas, C. Cossu, F. Molotzu, C. Sartori, H. Shinozuka, and A. Columbano Different Effects of the Liver Mitogens Triiodo-Thyronine and Ciprofibrate on the Development of Rat Hepatocellular Carcinoma Toxicol Pathol, January 1, 2003; 31(1): 113 - 120. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Flores-Morales, H. Gullberg, L. Fernandez, N. Stahlberg, N. H. Lee, B. Vennstrom, and G. Norstedt Patterns of Liver Gene Expression Governed by TR{beta} Mol. Endocrinol., June 1, 2002; 16(6): 1257 - 1268. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||
