FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DÉBAT, H.
Right arrow Articles by THOMAS, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DÉBAT, H.
Right arrow Articles by THOMAS, D.
(The FASEB Journal. 2001;15:815-822.)
© 2001 FASEB

Overpassing an aberrant V{kappa} gene to sequence an anti-idiotypic abzyme with ß-lactamase-like activity that could have a linkage with autoimmune diseases

HÉLÈNE DÉBAT1, BÉRANGÈRE AVALLE, OLIVIER CHOSE, CLAUDE-OLIVIER SARDE, ALAIN FRIBOULET and DANIEL THOMAS

UPRES A 6022 Génie enzymatique et cellulaire, Université de Technologie de Compiègne, BP 20529, 60205 Compiegne Cedex, France

1Correspondence: UPRES A 6022 Génie enzymatique et cellulaire, Université de Technologie de Compiègne, BP 20529, 60205 Compiegne Cedex, France. E-mail: lndebat{at}belgacom.net


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
A monoclonal antibody 9G4H9 that exhibits a ß-lactamase-like activity was previously obtained in accordance with the idiotypic network theory. This abzyme presents the most catalytic efficiency in amidase activity described in literature (kcat = 0.9 min-1). Some reports have demonstrated that functionality as complex as catalysis may be mimicked in this way. Comparison of the catalytic properties of both enzyme and abzyme previously allowed us to obtain better knowledge about 9G4H9 abzymatic machinery. In attempt to characterize this abzyme, the variable regions of kappa and heavy chain were cloned. We present a ‘universal’ method to clone the correct V{kappa} gene to bypass aberrant V{kappa} (abV{kappa}) produced by MOPC-21-derived hybridomas. Sequences obtained are compared in the GenBank database. The VH and V{kappa} genes present some important sequence homology with autoantibodies suggesting a direct relationship between catalytic anti-idiotypic antibody and autoimmunity.—Débat, H., Avalle, B, Chose, O., Sarde, C.-O., Friboulet, A., Thomas, D. Overpassing an aberrant V{kappa} gene to sequence an anti-idiotypic abzyme with ß-lactamase-like activity that could have a linkage with autoimmune diseases.


Key Words: catalytic antibody • autoantibody • aberrant kappa chain


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
CATALYTIC ANTIBODIES PROVIDE a means for generating new catalysts for reactions or specificities difficult to achieve by existing enzymatic or chemical methods. In addition, antibody catalysis provides a tool to attain increased insight into the mechanisms of biological catalysis and evolution of the catalytic function. This is facilitated by the availability of 3-dimensional structures of antibody active sites in molecular modeling and crystallographic studies (1 2 3 4 5 6 7 8 9 10) .

We have developed a strategy aiming at eliciting antibodies that mimic the active sites of enzymes. As proposed by Jerne (11) , anti-idiotypic antibodies can recognize some determinants of the combining site of an antibody (Ab1) contacting the original antigen. This concept was successfully applied from enzymatic active sites in order to obtain anti-idiotypic antibodies mimicking the enzymatic function of acetylcholinesterase (12 , 13) and beta-lactamase (14) .

We report the universal cloning of antibody 9G4H9 displaying a beta-lactamase-like activity, bypassing an aberrant {kappa} transcript (abV{kappa}) first described by Carroll et al. (15) . The cloning presented some difficulties inherent in the procedure used to obtain monoclonal antibodies (mAb). Indeed, almost all mAb are isolated from hybridomas (16) . This method for producing antibodies has many advantages, especially the ability to produce large amounts of pure antibody from ascitic fluids. However, the hybridoma technology cannot be used directly to prepare mutants in experiments designed to improve the catalytic activity of the abzyme or to probe its mechanism (17) . The presence of aberrant transcript mRNA is also a major problem. In this report, we present a strategy to bypass the abV{kappa} gene by taking advantage of specific immunoglobulin leader sequence and framework 1 region information. These sequences are sufficiently variable and homogeneous to take some primer sets to amplify the immunoglobulin {kappa} light chain of interest secreted by the hybridoma cells.

The nucleotide sequence of the variable domain of the heavy and the light chain gene of the 9G4H9 mAb was obtained and compared to database sequence. A tight homology with autoantibodies involved in autoimmune disease was observed. The possible link between autoimmunity and the appearance of catalytic anti-idiotypic antibodies are discussed.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell cultures and preparation of RNA poly(A)+
Hybridoma cell lines were grown in DMEM medium supplemented by 10% fetal calf serum with 2 mM L-glutamine and 1 mM pyruvate. Total RNA was extracted using guanidinium isothiocyanate and cesium chloride (18 , 19) . All material used was incubated for 4 h in a 4N NaOH solution, rinsed with deionized water, and autoclaved. 5 to 10 x 108 cells were thus pelleted by centrifugation at 1500 rpm for 5 min at 4°C and washed with 50 ml of cold phosphate-buffered saline solution at pH 7.4. Cell pellets were resuspended in 12.5 ml of a solution containing 4M guanidinium isothiocyanate, 25 mM sodium citrate, 0.5% N-lauryl sarcosinate, and 100 mM ß-mercaptoethanol. After homogenization, 5 g of CsCl was added and the mix was vortexed for 5 min to completely disrupt the cells and shear DNA; 2 ml cell lysates were layered over 1.2 ml of a 5.7M CsCl solution in 0.1M EDTA pH 8 in a Beckman ultracentrifuge tube and the samples were centrifuged at 29,500 rpm for 16 h in a SW41Ti rotor. After centrifugation all supernatants were sucked up without dislodging the pellet. The RNA pellet was resuspended in 200 µl NET buffer (5 M NaCl, 1 M Tris-HCl pH 5, 0.5 M EDTA pH 7.4, 10% sodium dodecyl sulfate) and transferred in a centrifuged tube. RNA was precipitated with 450 µM of 99% ethanol at -80°C for 30 min and centrifuged at 14,000 rpm at 4°C for 45 min. The pellets were washed with 75% ethanol, then vacuum-spin dried and resuspended in 2 µl sterile deionized water with 5 U of RNase inhibitor. The entirety, purity, and quantification of RNA were checked by electrophoresis using the formaldehyde gel technique (20) and by spectrophotometry at 260 and 280 nm. PolyA+ RNA was selected by chromatography on oligo(dT) cellulose (21) .

DNA manipulations
Restriction enzymes (2 U/reaction) and ligation enzyme (5 U/reaction) were purchased from Eurogentec (Brussels, Belgium). Plasmid DNA isolation was performed from overnight cultures with a QIAprep Spin Plasmid Kit (Qiagen S.A., Courtaboeuf Cedex, France). DNA fragments were purified by using the Geneclean III kit (BIO 101, Ozyme, Paris, France) according to the manufacturer’s instructions.

First-strand cDNA synthesis of variable heavy (VH) and light (V{kappa}) chain genes
In preparing polymerase chain reaction (PCR) amplification, the cDNA synthesis reaction was performed with the SuperScriptTMII RNAseH- Reverse Transcriptase (Gibco BRL, Grand Island, N.Y.) using a specific primer for the heavy chain of immunoglobulin G2b or kappa light chain. In a typical 20 µl transcription reaction mixture, 1 µg of mRNA in water was first annealed with 2 pmol of the 3'VH primer (primer 15, Table 1 ) or the 3' V{kappa} primer (primer 1, Table 1 ) at 70°C for 5 min in two different tubes. The mixture was adjusted at room temperature with 50 mM Tris-HCl pH 8.3 containing 75 mM KCl, 3 mM MgCl2, 1 mM DTT, and 500 µM each deoxyribonucleoside triphosphate (dNTP) at neutral pH. The mixture is incubated at 42°C for 2 min and 200 U of SuperScriptTMII was added. The reaction was incubated 50 min at 42°C and inactivated by heating at 70°C for 15 min. cDNA was purified to be used as a template to the 5' RACE procedure or PCR amplification.


View this table:
[in this window]
[in a new window]
 
Table 1.

Amplification of the VH and light chain (V{kappa}) genes using the 5' RACE-PCR method
The method used was first described by Frohman et al. (22) . Terminal deoxynucleotidyl transferase (TdT; Amersham, Little Chalfont, U.K.) was first used to add a poly(dG) tail to the 3' end to the first-strand cDNA. To a microcentrifuge tube on ice, 20 µl of cDNA template was added to 10 µl of 5x TdT reaction buffer (5 mM 2-mercaptoethanol, 500 mM of sodium cacodylate pH 7.2, 40 mM MgCl2, 0.125% BSA, and 850 µg/ml activated calf thymus DNA), 5 µl of a 10x MnCl2 buffer (1 M sodium cacodylate, pH 7.2, 20 mM MnCl2, and 1 mM DTT), 0.8 µl of a solution of dGTP 25 mM, 14.2 µl of water and 20 U of TdT. The tube was incubated for 10 min at 37°C and the reaction was terminated by adding 10 µl of 0.2 M EDTA.

The homopolymeric tailing cDNA (5 µl) was purified and amplified using one primer specific for framework 4 domain of the heavy IgG2b gene studied (primer 17, Table 1 ) or for framework 4 domain of the {kappa} light chain gene (primer 3, Table 1 ) and one specific to the homopolymeric tail (primer 2, Table 1 ). Amplification was carried out in 10 mM Tris-HCl buffer pH 8.3 containing 50 mM KCl; 2 mM MgCl2, 200 µM each dNTP, 100 pmol of primer (primer 2, Table 1 ) that anneals to the poly(dG) tail, 100 pmol of primer 3 (Table 1) specific to the {kappa} light chain, or primer 17 (Table 1) specific to the IgG2b heavy chain genes, and the cDNA template in a total volume of 100 µl. Reaction mixture were overlaid with mineral oil (Sigma Chemical, St. Louis, Mo.) and heated at 94°C for 6 min before addition of 2.5 units of the AmpliTaq Gold DNA polymerase (Perkin Elmer, Norwalk, Conn.). The PCR products were then cycled 30 times as follows: denatured for 1 min at 94°C, annealed for 1 min at 58°C, and extended for 1 min at 72°C in a Thermocycler (Perkin Elmer). An additional 6 min extension at 72°C was performed and then reactions were held at 4°C. Reaction products were electrophoresed through 1% agarose gels (Eurogentec) and visualized with ethidium bromide (Sigma Chemical). The DNA band of interest was excised and purified.

Cloning and sequencing of the VH and V{kappa} genes
PCR products were digested with the corresponding restriction enzyme, purified, cloned into pBluescript II KS (+) (Stratagene, San Diego, Calif.; Ozyme), and transformed into competents Escherichia coli JM109 cells according to the method described by Sambrook et al. (19) . Transformants were selected on solid Luria-Bertani medium containing 50 µg ml-1 ampicillin. Sequencing of the cDNA was performed by GenomeExpress (CEA Grenoble, France). The numbering of residues and determination of the complementary defining region (CDR) position was according to Kabat et al. (23) .

Sequence alignments
Sequence alignment analysis was carried out using the French Server BISANCE. The homologies between our sequences and the database sequences in EMBL/GenBank/DDBJ were determined by CLUSTAL W program (24) .

Nucleotide sequence accession numbers
The nucleotide sequences of the variable regions V{kappa} and VH of the 9G4H9 catalytic antibody presented in this study have been assigned accession numbers aj277812 and aj277813, respectively, by EMBL.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cloning and sequencing of the V{kappa} chain gene of 9G4H9
With a specific primer for the first-strand synthesis (primer 1, Table 1 ) of the {kappa} light chain, we first used the 5'RACE-PCR strategy to clone the gene. Among the 27 clones sequenced, we obtained only the aberrant {kappa} light chain (abV{kappa}). This abV{kappa} was previously described by Carroll et al. (15) (GenBank accession number: M35669); it takes a nonfunctional VJ recombination with a deletion of four nucleotides that results in a premature termination codon. The authors demonstrated that this abV{kappa} was derived from the fusion partner SP2/0 used to make hybridoma with splenocytes from mice immunized. Indeed, SP2/0 was used in the case of the generation of Ab2, the 9G4H9 catalytic antibody with a beta-lactamase activity (14) . They also demonstrated that the expression of this {kappa} transcript is variable and may exceed levels of the productive light chain mRNA.

This problem was solved by using the same 3' end toward primer of the antibody V{kappa} domain (primer 3, Table 1 ) and the collection of 5' end toward primers that hybridize to the leader sequences of mouse {kappa} light chains (primers 10 to 14, Table 1 ) (25) . Results obtained were approved using a unique set of VL gene family-specific primers described by Nicholls et al. (26) (primer 4 to 9, Table 1 ) that hybridize to the framework 1. These primers were chosen because they were different enough from the 5' end of the abV{kappa} to obtain 9G4H9 cDNA light chain. Results of PCR amplification are shown in Fig. 1 . Figure 1A shows amplification with the primers that hybridize to the leader sequences of mouse {kappa} chain (25) . Five primers were tested: MKVP2, the control that hybridizes with the leader sequence of the aberrant {kappa} light chain, and four primers (MKVP1, 6, 8, 11) different enough from the MKVP2 leader sequence. The results show a sharp DNA band at the predicted size of 400 ± 20 pb with MKVP2 and a good amplification with MKVP6. No amplification with the others primers (MKVP1, 8, 11) was obtained. MKVP6 was largely different from MKVP2 and thus might have amplified the 9G4H9 mRNA. This result demonstrates that the level of abV{kappa} mRNA is clearly higher than 9G4H9 mRNA in the hybridoma cells as demonstrated by Carroll et al. (15) . MKVP6 amplified fragment was purified and cloned in pBluescript II SK (+), sequenced, and analyzed. The sequence is presented in Fig. 2 and corresponds to a functional {kappa} light chain. To confirm that this sequence amplification is the only sequence expressed corresponding to 9G4H9 catalytic antibody, we consecutively tested 6 primers to the framework 1 previously described by Nicholls et al. (26) (primers 4 to 9, Table 1 ) paired with the same primer to the toward 3' end (primer 3, Table 1 ). The results in Fig. 1B show different levels of amplification according to the primer used. The primers in lane 1, 3, 4, and 5 (VL-I/III, VL-IIb, VL-Va, and VL-5b), which hybridize with abV{kappa} sequence, show a high level of amplification with a DNA band at the predicted size of 350 ± 20 pb. The amplification level in lane 2 and 6 is low. These amplification fragments were purified, restricted, and cloned into pBluescript II SK (+) and the sequences were analyzed. Of all the sequences analyzed, only the sequence obtained by amplification with the primer VL-IIb was different from abV{kappa}. This sequence corresponds to the same sequence previously obtained with primer MKVP6 and is shown in Fig. 2 (accession number aj277812 in EMBL/GeneBank/DDJB databases).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Agarose gels electrophoresis of fragments obtained from PCR amplification of variable {kappa} light chain of the catalytic antibody 9G4H9. A) PCR amplification with the primer 2 in 3' end toward (see Table 1 ) and the primer set in 5' end toward that hybridize with the leader sequence (primers 10 to 14 Table 1B) ). PCR amplification results with the primer 2 in 3' end toward (see Table 1 ) and the primer set in 5' end toward, which hybridize with the framework 1 of the {kappa} chain gene.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Nucleotide sequence and the deduced amino acid of the variable {kappa} light chain of the catalytic antibody 9G4H9 (accession number in EMBL: aj277812). The leader sequence is noted in boldface and corresponds to the first 20 amino acid residues. The complementary determining region residues according to the hypervariable sequence definition of Kabat et al. (23) are underlined. The targeted sequences of immunoglobulin gene used for PCR amplification on the leader sequence, framework 1 (for the 5' end toward) and the framework 4 (for the 3' end toward) are shown by a dotted line.

Cloning and sequencing of the VH gene of 9G4H9
The variable domain of the heavy chain VH was cloned after first-strand cDNA synthesis (primer 15, Table 1 ) and 5'RACE-PCR amplification from a total mRNA preparation of hybridoma cells. PCR was performed with a 5' end toward primer (primer 16, Table 1 ) and a 3' end toward primer (primer 17, Table 1 ). Unique amplification products were obtained (Fig. 3 ) at the predicted size of 400 ± 40 pb modulated by the size of the homopolymeric tail and the hybridization site of the corresponding primer (primer 16, Table 1 ) used to perform the PCR amplification. Each PCR product was inserted into the pBluescript II SK (+) plasmid and DNA sequencing was performed. The nucleotide sequence of the VH domain of the 9G4H9 antibody was obtained, and the deduced amino acid sequence is given in Fig. 4 . The corresponding accession number to EMBL/GenBank/DDBJ is aj277813.



View larger version (77K):
[in this window]
[in a new window]
 
Figure 3. Agarose gel electrophoresis of 5'RACE-PCR amplification of the variable domain of the heavy IgG2b chain corresponding to 9G4H9 catalytic antibody.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Nucleotide sequence and the deduced amino acid of the variable domain VH of the heavy IgG2b chain corresponding to 9G4H9 catalytic antibody (accession number in EMBL/GenBank/DDBJ database: aj277813). The leader sequence is noted in boldface and corresponds to the first 19 amino acid residues. The complementary determining region residues according to the hypervariable sequence definition of Kabat et al. (23) are underlined. The corresponding nucleotide sequence used to perform the PCR amplification to the 3' end toward is noted by a dotted line.

Sequence alignment of VH and V{kappa} gene of 9G4H9 to database sequences
The VH and V{kappa} sequences were compared with other sequences in the data bank. The best homology sequences are shown in Fig. 5 . All the mouse origin sequences present an important homology with our heavy (at least 86%) or light (at least 92%) variable chains and are involved in a catalytic or anti-idiotypic mechanism.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 5. Multiple sequence alignment of VH domain (A) and V{kappa} domain (B) of 9G4H9 catalytic antibody with database sequences by using the CLUSTAL W program (24) . The kappa 9G4H9 and heavy 9G4H9 sequences are given in boldface, with the accession number in EMBL/GenBank/DDBJ database, respectively, aj277812 and aj277813. The homologous sequences are noted by their accession number assigned in database. Sequences with ‘#’ as references were taken from GenBank database lacking references. Variant amino acids in the CDR regions are boxed. Some gaps are introduced for the optimization of alignments.

The VH sequences noted by the accession numbers musikcls, mmu6946, and u00940 correspond to antibodies that are involved in autoimmune diseases (27 28 29) . The first VH sequence was described in mice that spontaneously develop a systemic lupus erythematous-like disease. The second sequence mmu6946 was previously described in spontaneous murine B cell tumors, and the authors have demonstrated that the sequence is closely similar to antibodies found in corresponding human diseases. The third homologous sequence u00940 corresponds to a nucleic acid binding antibody from autoimmune mice-derived, bacteriophage-displayed libraries. Among the other sequences that present a high level of similarity with the VH domain of 9G4H9 sequence aj277813, the VH sequence musig4c11a corresponds to a stimulatory anti-idiotypic antibody that induces different anti-phosphorylcholine responses (30) . The musigaza sequence corresponds to the gamma chain mRNA V region of a catalytic antibody with chorismate mutase activity (31) and the a27941 sequence corresponds to humanized and chimeric monoclonal antibodies from a patent (no reference).

When the V{kappa} domain of 9G4H9 is compared to the GenBank database sequences, we also obtain an important homology with the V{kappa} gene indirectly [(af087033 (32) ] or directly involved in natural autoimmune processes [af045515, no reference; mmu92070 (33) ; af045509, no reference; musigkcsc (34) ; and af057543 (35) ].


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Bypassing an aberrant V{kappa} mRNA and cloning a functional antibody light chain
The numerous methods to clone immunoglobulin genes described in the literature attest to the difficulties encountered, especially when the 5' end sequence of genes is unknown. An interesting method was described by Jovelin et al. (36) that combines different gene amplifications with 5'RACE-PCR. The 5' RACE-PCR method presents several advantages, the most important of which is the keeping of the right 5' end sequence of the immunoglobulin gene. On the other hand, this method creates significant difficulties for the cloning of mouse immunoglobulin {kappa} chain cDNA sequences from hybridoma cells having SP2/O as a parent cell. This cell line has been selected from MOPC-21 myeloma for its nonexpression of the normal {kappa} by different mutation and rearrangement chains (37) . However, the 5' RACE-PCR did not allow us to clone the right V{kappa} sequence of 9G4H9 catalytic antibody, but only an aberrant transcript abV{kappa} that had an aberrant VJ recombination site (15 , 38) with a deletion of four nucleotides and a consequent translation termination codon. SP2/O cells vastly overexpress endogenous aberrant {kappa} chains and have a wild-type leader signal sequence and FR-1. Many groups reported its preferential amplification by RT-PCR when attempting to clone the light chain of hybridomas derived from B cells fused to this fusion partner (26 , 39 40 41 42 43 44) . A rapid method was described by Ostermeier and Michel (41) to overcome this problem of abV{kappa}. They used a specific RNase H digestion of this V{kappa} pseudogene mRNA. The specific digestion was directed by an antisense oligonucleotide (5' GTAAGCTCCCTAATGTGCTG 3'), which can only bind to the abV{kappa} mRNA and not to the unknown sequence of the V{kappa} domain of the clone of interest. RNase H can then specifically digest the abV{kappa} mRNA in the resulting double-stranded RNA-DNA hybrid (45) . This method was used to obtain the 9G4H9 V{kappa} domain sequence, but 45% of homology between this antisense oligonucleotide and the right V{kappa} sequence of kappa light V{kappa} of 9G4H9 was sufficient to destroy all mRNA (data not shown). The trouble arises from the temperature of 42°C used for the specific digestion by RNase H. This temperature is too low to permit a specific annealing.

Therefore, the successful and general application of PCR to the rapid cloning of variable regions of rearranged immunoglobulin genes requires a careful design of ‘universal’ primers. This system functions by taking advantage of the finding that mammalian light and heavy chains of immunoglobulins contain conserved regions, adjacent to the hypervariable CDR. Thus, appropriately designed oligonucleotide degenerated primer sets allow these regions to be specifically amplified by PCR (25 , 46 47 48) . To develop a set of compatible primers for mouse antibodies, several laboratories pooled and aligned the murine antibody sequences collected in the Kabat database (23) . These primers can be based on either the immunoglobulin leader region (amino acids -20 to -13) or the framework region 1 (FR-1) (amino acids 1–7 or 8). Similar sequences were grouped, and putative primer sequences were then compared to the pooled sequences, and the ‘best fit’ primer sequence was selected. This process was repeated until all the sequences were evaluated. This allowed optimization of the degenerate primers to cover 5' end immunoglobulin DNA sequences as much as possible for PCR amplification. In attempt to solve the problems outlined above, we have used a simple PCR-based technique for cloning and sequencing the V{kappa} sequence of 9G4H9 catalytic antibody by using two steps of PCR amplification to confirm the rightness of the sequence cloned. The first step uses a degenerated oligonucleotide primers set described by Jones and Bendig (25) that hybridizes to the mouse immunoglobulin leader sequences of {kappa} light chain (primers 10 to 14, Table 1 ), paired with a primer that hybridizes to the framework 4 to performed a PCR amplification. The second step confirms the first results by using the degenerated primers covering the framework 1 region.

Analysis of the V{kappa} and the VH genes of the catalytic antibody 9G4H9 displaying a beta-lactamase activity: a possible relationship with autoimmune disease
Generation of antibodies that catalyze the opening of the beta-lactam ring of antibiotics, naturally performed by microbial beta-lactamases, appears to be an appropriate model to demonstrate the relevance of the anti-idiotypic mimicry scheme. A monoclonal anti-idiotypic antibody 9G4H9 (Ab2) was elicited by using a monoclonal antibody 7AF9 (Ab1) specific for the beta-lactamase active site and its catalytic activity was characterized (14) . Analysis of the primary sequence of the {kappa} light chain and the heavy chain fragments did not show any significant homology with the primary structure of the model enzyme. Thus, the anti-idiotypic abzyme active center probably does not possess a direct imprint of its enzyme ancestor at the primary structure level. The catalytic antibody active site seems to be a 3-dimensional copy of the beta-lactamase active site. As the catalytic properties are different, we create in the antibody a replica of the enzyme-active site with ‘errors’. The topological information is conserved enough to induce Ab3 (14) , which recognize beta-lactamase, and to preserve the expression of catalytic residues in a correct position and orientation necessary for functioning of the hydrolytic machinery. As a first approach, identification of potential residues involved in catalytic activities of 9G4H9 was performed, which suggests that an acidic residue and a nucleophilic group are present in 9G4H9 (49) . The molecular modeling of this 9G4H9 antibody constructed with the Swiss-Pdb Viewer program using a homologous antibody of known structure for the input coordinates confirms this hypothesis (50) . In this model, four residues in the {kappa} light chain were found correctly positioned to be involved in a possible beta-lactam hydrolysis mechanism: Ser26, Ser28, Lys27 in CDRL1, and Glu98 in CDRL3. This hypothesis was recently demonstrated by Western blot and ELISA experiments, which indicate the {kappa} light chain forms a covalent complex with the penicillin substrate (51) . Prior to the design and construction of the 9G4H9 scFv fragment, it was important to carefully analyze the amino acid sequence of variable domains to determine the germline and compare it with another antibody in the immunoglobulin database. The results show a sequence homology with antibodies involved in catalytic process and related in autoimmune disease. The germline of all the sequences is the same: V{kappa}-II for light chain and VH-II for heavy chain. Somatic mutations are observed in VH domain and V{kappa} domain by a comparison with the germline. This indicates evidence for antigen selection—clustering of replacement mutations in regions like that observed in the literature (52 53 54) . The germline mutations observed in the 9G4H9 CDRL3 showing Ser96, Tyr55, and Glu98 seem to be crucial for inducing beta-lactamase affinity and activity. These acidic and nucleophilic residues could have an important role in catalytic activity. Several roles of hydrogen bonds are assigned to Tyr residues in catalytic antibodies with esterase activity (5) . Three important roles in catalytic mechanisms are described: stabilization of complex, orientation of two faces of ester carbonyl, and interaction with water molecules, which gives rise to the attacking hydroxide ion. In addition to the residues described in a molecular model like Glu98 (50) , Ser96 is very important to the affinity of substrate and catalytic mechanism of opening of the beta-lactam ring. The hypothesis that the {kappa} light chain is involved in catalytic process agrees with some reports (55 56 57 58) . The light chain alone can also be involved in binding a substrate in autoimmune disease (59 60 61 62) . Mimicry of enzymatic sites by anti-idiotypic antibodies resulting from immune regulation dysfunction has been proposed several times to explain the appearance of abzymes in autoimmune disorders (63 64 65 66) or discuss a possible role in metabolism (67) . Moreover, Tawfik et al. (68) and Takahashi et al. (69) reported an unexpectedly high occurrence of autoimmune mice to elicit catalytic antibodies. In this report, we show a direct sequence homology between a catalytic antibody and other autoantibodies. Thus, our results present evidence for a correlation between the catalytic anti-idiotypic antibodies created in laboratory made by mimic concept and natural autoantibodies.


   ACKNOWLEDGMENTS
 
This work was supported by the Ministère de la Recherche et de l’Enseignement Supérieur and the CNRS. We wish to thank Dr. Jean Luc Teillaud and Dr. Frédéric Ducancel for fruitful scientific discussions.

Received for publication June 23, 2000. Accepted for publication August 18, 2000.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Zhou, G. W., Guo, J., Huang, W., Fletterick, R. J., Scanlan, T. S. (1994) Crystal structure of a catalytic antibody with a serine protease active site. Science 265,1059-1064[Abstract/Free Full Text]
  2. Haynes, M. R., Stura, E. A., Hilvert, D., Wilson, I. A. (1994) Routes to catalysis: structure of a catalytic antibody and comparison with its natural counterpart. Science 263,646-652[Abstract/Free Full Text]
  3. Patten, P. A., Gray, N. S., Yang, P. L., Marks, C. B., Wedemayer, G. J., Boniface, J. J., Stevens, R. C., Schultz, P. G. (1996) The immunological evolution of catalysis. Science 271,1086-1091[Abstract]
  4. Charbonnier, J. B., Golinelli-Pimpaneau, B., Gigant, B., Tawfik, D. S., Chap, R., Schindler, D. G., Kim, S. H., Green, B. S., Eshhar, Z., Knossow, M. (1997) Structural convergence in the active sites of a family of catalytic antibodies. Science 275,1140-1142[Abstract/Free Full Text]
  5. Gigant, B., Charbonnier, J. B., Golinelli-Pimpaneau, B., Zemel, R. R., Eshhar, Z., Green, B. S., Knossow, M. (1997) Mechanism of inactivation of a catalytic antibody by p-nitrophenyl esters. Eur. J. Biochem. 246,471-476[Medline]
  6. Barbas, C. F., 3rd, Heine, A., Zhong, G., Hoffmann, T., Gramatikova, S., Bjornestedt, R., List, B., Anderson, J., Stura, E. A., Wilson, I. A., Lerner, R. A. (1997) Immune versus natural selection: antibody aldolases with enzymic rates but broader scope. Science 278,2085-2092[Abstract/Free Full Text]
  7. Romesberg, F. E., Spiller, B., Schultz, P. G., Stevens, R. C. (1998) Immunological origins of binding and catalysis in a Diels-Alderase antibody. Science 279,1929-1933[Abstract/Free Full Text]
  8. Heine, A., Stura, E. A., Yli-Kauhaluoma, J. T., Gao, C., Deng, Q., Beno, B. R., Houk, K. N., Janda, K. D., Wilson, I. A. (1998) An antibody exo Diels-Alderase inhibitor complex at 1.95 angstrom resolution. Science 279,1934-1940[Abstract/Free Full Text]
  9. Buchbinder, J. L., Stephenson, R. C., Scanlan, T. S., Fletterick, R. J. (1998) A comparison of the crystallographic structures of two catalytic antibodies with esterase activity. J. Mol. Biol. 282,1033-1041[Medline]
  10. Thayer, M. M., Olender, E. H., Arvai, A. S., Koike, C. K., Canestrelli, I. L., Stewart, J. D., Benkovic, S. J., Getzoff, E. D., Roberts, V. A. (1999) Structural basis for amide hydrolysis catalyzed by the 43C9 antibody. J. Mol. Biol. 291,329-335[Medline]
  11. Jerne, N. (1974) Toward a network theory of the immune system. Ann. Immunol. 125c,373-389
  12. Izadyar, L., Friboulet, A., Remy, M. H., Roseto, A., Thomas, D. (1993) Monoclonal anti-idiotypic antibodies as functional internal images of enzyme active sites: production of a catalytic antibody with a cholinesterase activity. Proc. Natl. Acad. Sci. USA 90,8876-8880[Abstract/Free Full Text]
  13. Kolesnikov, A. V., Kozyr, A. V., Alexandrova, E. S., Koralewski, F., Demin, A. V., Titov, M. I., Avalle, B., Tramontano, A., Paul, S., Thomas, D., Gabibov, A. G., Friboulet, A. (2000) Enzyme mimicry by the anti-idiotypic antibody approach. Proc. Natl. Acad. Sci. USA 97,13526-13531[Abstract/Free Full Text]
  14. Avalle, B., Thomas, D., Friboulet, A. (1998) Functional mimicry: elicitation of a monoclonal anti-idiotypic antibody hydrolizing beta-lactams. FASEB J 12,1055-1060[Abstract/Free Full Text]
  15. Carroll, W. L., Mendel, E., Levy, S. (1988) Hybridoma fusion cell lines contain an aberrant kappa transcript. Mol. Immunol. 25,991-995[Medline]
  16. Kohler, G., Milstein, C. (1976) Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion. Eur. J. Immunol. 6,511-519[Medline]
  17. Stewart, J. D., Lee, I., Posner, B. A., Benkovic, S. J. (1995) Expression of properly folded catalytic antibodies in Escherichia coli. Methods Enzymol 249,507-519[Medline]
  18. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  19. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual 2nd Ed Cold Spring Harbor Laboratory Press Cold Spring Harbor, New York.
  20. Lehrach, H., Diamond, D., Wozney, J. M., Boedtker, H. (1977) RNA molecular weight determinations by gel electrophoresis under denaturing conditions, a critical reexamination. Biochemistry 16,4743-4751[Medline]
  21. Aviv, H., Leder, P. (1972) Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. USA 69,1408-1412[Abstract/Free Full Text]
  22. Frohman, M. A., Dush, M. K., Martin, G. R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85,8998-9002[Abstract/Free Full Text]
  23. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesman, K. S., Foeller, C. (1991) Sequences of Proteins of Immunological Interest 5th Ed U.S. Department of Health and Human Services Bethesda, Maryland.
  24. Thompson, J. D., Higgins, D. G., Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22,4673-4680[Abstract/Free Full Text]
  25. Jones, S. T., Bendig, M. M. (1991) Rapid PCR-cloning of full-length mouse immunoglobulin variable regions. Bio/Technology 9,88-89[published erratum appears in Bio/Technology p. 579][Medline]
  26. Nicholls, P. J., Johnson, V. G., Blanford, M. D., Andrew, S. M. (1993) An improved method for generating single-chain antibodies from hybridomas. J. Immunol. Methods 165,81-91[Medline]
  27. Kofler, R., Strohal, R., Balderas, R. S., Johnson, M. E., Noonan, D. J., Duchosal, M. A., Dixon, F. J., Theofilopoulos, A. N. (1988) Immunoglobulin kappa light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice. J. Clin. Invest. 82,852-860
  28. Zhu, D., van Arkel, C., King, C. A., Meirvenne, S. V., de Greef, C., Thielemans, K., Radl, J., Stevenson, F. K. (1998) Immunoglobulin VH gene sequence analysis of spontaneous murine immunoglobulin-secreting B-cell tumours with clinical features of human disease. Immunology 93,162-170[Medline]
  29. Calcutt, M. J., Kremer, M. T., Giblin, M. F., Quinn, T. P., Deutscher, S. L. (1993) Isolation and characterization of nucleic acid binding antibody fragments from autoimmune mice-derived bacteriophage display libraries. Gene 137,77-83[Medline]
  30. Cheng, H.-L., Sood, A. K., Ward, R. E., Kieber-Emmons, T., Kholer, H. (1988) Structural basis of stimulatory anti-idiotypic antibodies. Mol. Immunol. 25,33-40[Medline]
  31. Bowdish, K., Tang, Y., Hicks, J. B., Hilvert, D. (1991) Yeast expression of a catalytic antibody with chorismate mutase activity. J. Biol. Chem. 266,11901-11908[Abstract/Free Full Text]
  32. Retter, M. W., Nemazee, D. (1998) Receptor editing occurs frequently during normal B cell development. J. Exp. Med. 188,1231-1238[Abstract/Free Full Text]
  33. Asakura, K., Rodriguez, M. (1998) A unique population of circulating autoantibodies promotes central nervous system remyelination. Mult. Scler. 4,217-221[Abstract/Free Full Text]
  34. Shlomchik, M. J., Marshak-Rothstein, A., Wolfowicz, C. B., Rothstein, T. L., Weigert, M. G. (1987) The role of clonal selection and somatic mutation in autoimmunity. Nature (London) 328,805-811[Medline]
  35. Fitzsimons, M. M., Chen, H., Kim, S., Foster, M. H. (1997) Diverse lupus-like autoantibodies recovered from non autoimmune Ig-transgenic mice. J. Am. Soc. Nephrol. 8,A2112(abstr.)
  36. Jovelin, F., Gilbert, D., Brard, F., Bernardi, T., Marche, P., Frebourg, T., Tron, F. (1995) Simple protocol for rapid, direct sequencing of immunoglobulin variable-region genes. BioTechniques 19,378-380[Medline]
  37. Kearney, J. F., Radbruch, A., Liesegang, B., Rajewsky, K. (1979) A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J. Immunol. 123,1548-1550[Abstract/Free Full Text]
  38. Cabilly, S., Riggs, A. D. (1985) Immunoglobulin transcripts and molecular history of a hybridoma that produces antibody to carcinoembryonic antigen. Gene 40,157-161[Medline]
  39. Leung, S. O., Dion, A. S., Pellegrini, M. C., Goldenberg, D. M., Hansen, H. J. (1993) An extended primer set for PCR amplification of murine kappa variable regions. BioTechniques 15,286-292[Medline]
  40. Duan, L., Pomerantz, R. J. (1994) Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections. Nucleic Acids Res 22,5433-5438[Abstract/Free Full Text]
  41. Ostermeier, C., Michel, H. (1996) Improved cloning of antibody variable regions from hybridomas by an antisense-directed RNase H digestion of the P3–X63-Ag8.653 derived pseudogene mRNA. Nucleic Acids Res. 24,1979-1980[Free Full Text]
  42. Jovelin, F., Brard, F., Raux, G., Tron, F., Gilbert, D. (1996) Immunoglobulin variable-region mRNA direct sequencing: a method to bypass aberrant myeloma light-chain transcripts. BioTechniques 21,576-578[Medline]
  43. Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., Pluckthun, A. (1997) Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Methods 201,35-55[Medline]
  44. Cochet, O., Martin, E., Fridman, W. H., Teillaud, J. L. (1999) Selective PCR amplification of functional immunoglobulin light chain from hybridoma containing the aberrant MOPC 21-derived V kappa by PNA-mediated PCR clamping. BioTechniques 26,818-822[Medline]
  45. Donis-Keller, H. (1979) Site specific enzymatic cleavage of RNA. Nucleic Acids Res 7,179-192[Abstract/Free Full Text]
  46. Orlandi, R., Gussow, D. H., Jones, P. T., Winter, G. (1989) Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86,3833-3837[Abstract/Free Full Text]
  47. Larrick, J. W., Danielsson, L., Brenner, C. A., Abrahamson, M., Fry, K. E., Borrebaeck, C. A. (1989) Rapid cloning of rearranged immunoglobulin genes from human hybridoma cells using mixed primers and the polymerase chain reaction. Biochem. Biophys. Res. Commun. 160,1250-1256[Medline]
  48. Coloma, M. J., Larrick, J. W., Ayala, M., Gavilondo-Cowley, J. V. (1991) Primer design for the cloning of immunoglobulin heavy-chain leader-variable regions from mouse hybridoma cells using the PCR. BioTechniques 11,152-154[Medline]
  49. Avalle, B., Débat, H., Friboulet, A., Thomas, D. (2000) Catalytic mechanism of abzyme displaying a beta-lactamase activity. Appl. Biochem. Biotechnol. 83,163-171[Medline]
  50. Débat, H., Avalle, B., Friboulet, A., Thomas, D. (2000) Structure-function studies of a new generation of catalytic protein: an abzyme with a beta-lactamase activity. Int. J. BioChromatogr. 5,91-96
  51. Lefèvre, S., Débat, H., Thomas, D., Friboulet, A., and Avalle, B. (2001) A suicide-substrate mechanism for hydrolysis of beta-lactams by an anti-idiotypic catalytic antibody. FEBS Letters In press
  52. Bakkus, M. H., Heirman, C., Van Riet, I., Van Camp, B., Thielemans, K. (1992) Evidence that multiple myeloma Ig heavy chain VDJ genes contain somatic mutations but show no intraclonal variation. Blood 80,2326-2335[Abstract/Free Full Text]
  53. Sahota, S. S., Leo, R., Hamblin, T. J., Stevenson, F. K. (1996) Ig VH gene mutational patterns indicate different tumor cell status in human myeloma and monoclonal gammopathy of undetermined significance. Blood 87,746-755[Abstract/Free Full Text]
  54. Sahota, S. S., Leo, R., Hamblin, T. J., Stevenson, F. K. (1997) Myeloma VL and VH gene sequences reveal a complementary imprint of antigen selection in tumor cells. Blood 89,219-226[Abstract/Free Full Text]
  55. Mei, S., Mody, B., Eklund, S. H., Paul, S. (1991) Vasoactive intestinal peptide hydrolysis by antibody light chains. J. Biol. Chem. 266,15571-15574[Abstract/Free Full Text]
  56. Wade, W. S., Koh, J. S., Han, N., Hoekstra, D. M., Lerner, R. A. (1993) Engineering metal coordination sites into the antibody light chain. J. Am. Chem. Soc. 115,4906-4907
  57. Gao, Q. S., Sun, M., Tyutyulkova, S., Webster, D., Rees, A., Tramontano, A., Massey, R. J., Paul, S. (1994) Molecular cloning of a proteolytic antibody light chain. J. Biol. Chem. 269,32389-32393[published erratum appears in J. Biol. Chem., 1995, vol. 270, p. 20870][Abstract/Free Full Text]
  58. Paul, S., Li, L., Kalaga, R., Wilkins-Stevens, P., Stevens, F. J., Solomon, A. (1995) Natural catalytic antibodies: peptide-hydrolyzing activities of Bence Jones proteins and VL fragment. J. Biol. Chem. 270,15257-15261[Abstract/Free Full Text]
  59. Song, K., Chen, Y., Goke, R., Wilmen, A., Seidel, C., Goke, A., Hilliard, B. (2000) Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an inhibitor of autoimmune inflammation and cell cycle progression. J. Exp. Med. 191,1095-1104[Abstract/Free Full Text]
  60. Czerwinski, M., Blackall, D. P., Abrams, W. R., Rubocki, R. J., Spitalnik, S. L. (1994) Restricted VH gene usage by murine hybridomas directed against the human N, but not M, blood group antigen. Mol. Immunol. 31,279-288[Medline]
  61. Jaume, J. C., Costante, G., Portolano, S., McLachlan, S. M., Rapoport, B. (1994) Recombinant thyroid peroxidase-specific autoantibodies. I. How diverse is the pool of heavy and light chains in immunoglobulin gene libraries constructed from thyroid tissue-infiltrating plasma cells. Endocrinology 135,16-24[Abstract]
  62. Brigido, M. M., Polymenis, M., Stollar, B. D. (1993) Role of mouse VH10 and VL gene segments in the specific binding of antibody to Z-DNA, analyzed with recombinant single chain Fv molecules. J. Immunol. 150,469-479[Abstract]
  63. Paul, S., Volle, D. J., Beach, C. M., Johnson, D. R., Powell, M. J., Massey, R. J. (1989) Catalytic hydrolysis of vasoactive intestinal peptide by human autoantibody. Science 244,1158-1162[Abstract/Free Full Text]
  64. Bronshtein, I. B., Shuster, A. M., Gololobov, G. V., Gromova, I. I., Kvashuk, O. A., Belostotskaya, K. M., Alekberova, Z. S., Prokaeva, T. B., Gabibov, A. G. (1992) DNA-specific antiidiotypic antibodies in the sera of patients with autoimmune diseases. FEBS Lett 314,259-263[Medline]
  65. Bronshtein, I. B., Vorobyev, S., Timofeev, A., Jolles, C. J., Alder, S. L., Holden, J. A. (1996) Elevations of DNA topoisomerase I catalytic activity and immunoprotein in human malignancies. Oncol. Res. 8,17-25[Medline]
  66. Tyutyulkova, S., Gao, Q. S., Thompson, A., Rennard, S., Paul, S. (1996) Efficient vasoactive intestinal polypeptide hydrolyzing autoantibody light chains selected by phage display. Biochim. Biophys. Acta 1316,217-223[Medline]
  67. Friboulet, A., Avalle, B., Débat, H., Thomas, D. (1999) A possible role of catalytic antibodies in metabolism. Immunol. Today 20,474-475[Medline]
  68. Tawfik, D. S., Chap, R., Green, B. S., Sela, M., Eshhar, Z. (1995) Unexpectedly high occurrence of catalytic antibodies in MRL/lpr and SJL mice immunized with a transition-state analog: is there a linkage to autoimmunity?. Proc. Natl. Acad. Sci. USA 92,2145-2149[Abstract/Free Full Text]
  69. Takahashi, N., Kakinuma, H., Hamada, K., Shimazaki, K., Yamasaki, Y., Matsushita, H., Nishi, Y. (2000) Improved generation of catalytic antibodies by MRL/MPJ-lpr/lpr autoimmune mice. J. Immunol. Methods 235,113-120[Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
M. A. Krasnorutskii, V. N. Buneva, and G. A. Nevinsky
Immunization of rabbits with DNase II leads to formation of polyclonal antibodies with DNase and RNase activities
Int. Immunol., April 1, 2009; 21(4): 349 - 360.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. A. Krasnorutskii, V. N. Buneva, and G. A. Nevinsky
Antibodies against pancreatic ribonuclease A hydrolyze RNA and DNA
Int. Immunol., August 1, 2008; 20(8): 1031 - 1040.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by DÉBAT, H.
Right arrow Articles by THOMAS, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by DÉBAT, H.
Right arrow Articles by THOMAS, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS