|
|
||||||||


* Departments of Pulmonary and Critical Care Medicine, Cancer Biology and
Pathology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195, USA; and
Department of Pathology, Canisius Wilhelmina Hospital, NL 6500 GS Nijmegen, The Netherlands
1Correspondence: Department of Pulmonary and Critical Care Medicine, Cleveland Clinic Foundation, 9500 Euclid Ave./A90, Cleveland, OH 44195, USA. E-mail: erzurus{at}ccf.org
| ABSTRACT |
|---|
|
|
|---|
Key Words: reactive oxygen species asthma lung nitrotyrosine
| INTRODUCTION |
|---|
|
|
|---|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Isolation of bronchial epithelial cells
Individuals underwent bronchoscopy to obtain samples of
bronchial epithelial cells with cytology brushings from second- and
third-order bronchi with 1 mm cytology brush (Microvasive, Watertown,
Mass.) as described previously (1)
. The brush sample was
immediately placed in RPMI 1640 (GIBCO-BRL, Grand Island, N.Y.) and an
aliquot was taken for cytology and cell differential determination. RNA
was extracted from cells as described previously (1)
.
BAL fluid
Bronchoalveolar lavage (BAL) was performed using fiberoptic
bronchoscopy as described previously (4)
. Briefly, after
local anesthesia with 2% lidocaine, a bronchoscope was wedged in a
segmental bronchus of the right middle lobe or lingula. Three 50 ml
aliquots of warm physiological saline were infused and recovered with
manual suction. The BAL fluid was filtered through a Y blood filter
(Drip Chamber Pump Fhashball Divia, Baxter, Morton Grove, Ill.) and
cellular components were separated by centrifugation (700 x
g, 10 min). Cells were washed once with Hanks balanced salt
solution (Life Technologies, Inc., Grand Island, N.Y.) and counted with
a hemacytometer. Cell differential was performed after a Giemsa-type
staining (Diff-Quick, American Scientific products, Stone Mountain,
Calif.). Peripheral blood was obtained from study subjects on the same
day as BAL; serum was then extracted by centrifugation of the whole
blood (1430 x g, 10 min). Urea was determined in BAL
fluid and serum using the BUN (ENDPOINT) reaction (Sigma, St. Louis,
Mo.) as described previously (4)
. Relative levels of ELF
were estimated by using simple dilution principles of the urea
concentration in serum and BAL fluid. Because the number of sample
obtained in some individuals was limited, not all individuals were used
for every measurement. The number of samples evaluated for each
parameter is stated in the text.
eGPx
eGPx protein was measured by enzyme-linked immunosorbent assay
(Calbiochem, La Jolla, Calif.). This method is based on a sandwich-type
immunoassay, and is specific for eGPx. To determine the eGPx protein in
the overlying media of the BET1A cells, the media was first
concentrated 20 times by using 10,000 NMWL ultrafree MC filter unit
(Millipore, Bedford, Mass.). The eGPx protein concentration present in
the BAL fluid, BET1A cell lysates, and overlying media was based on
4-parameter curve fit generated from known standard concentrations of
eGPx.
Cell culture
BET1A, a human bronchial epithelial cell line transformed by the
SV40, was cultured in serum-free Lechner and LaVeck medium (LHC-8,
Biofluids, Inc., Rockville, Md.) with additives 0.33 nM retinoic acid,
2.75 mM epinephrine, and the antibiotic combination 1%
penicillin/streptomycin on plates precoated with coating media
containing 29 µg/ml collagen (Vitrogen: Collagen, Palo Alto, Calif.),
10 µg/ml bovine serum albumin (Biofluids), and 10 µg/ml fibronectin
(Calbiochem) for 5 min (24)
. Human airway epithelial cells
(HAEC) obtained by bronchial brushing were cultured in serum-free
Lechner and LaVeck media (LHC8) on plates precoated with coating media.
Primary HAEC cultures of passages 02 were used in experiments. To
evaluate the response to ROS, the cells were stimulated at 70%
confluence with the intracellular superoxide-producing agent pyrogallol
(25)
(J. T. Baker Inc., Phillipsburg, N.J.), hydrogen
peroxide (Sigma), and/or reduced and oxidized glutathione in a dose-
and time-dependent manner.
GSH/GSSG levels
GSH levels in cell lysate and media were measured by standard
methods as described previously (26)
. In brief, total
glutathione levels were determined by mixing equal amounts of cell
lysate or media with 10 mM 5,5'-dithiobis-2-nitrobenzoic acid (DTNB) in
100 mM potassium phosphate, pH 7.5, which contained 17.5 µM EDTA. An
aliquot (50 µl) of the solution was added to a cuvette containing 0.5
U of glutathione disulfide reductase (Sigma type III) in 100 mM
potassium phosphate and 5 mM EDTA, pH 7.5. After 1 min, the reaction
was initiated with 220 nmol of NADPH in a final reaction volume of 1
ml. The rate of reduction of DTNB was recorded continuously at 412 nm
by a spectrophotometer with a Kinetics/Time feature (Beckman DU-640,
Beckman Instruments, Fullerton, Calif.).
To assay GSSG, equal volumes of cell lysate or media and N-ethylmaleimide (NEM) were added. An aliquot (50 µl) of the solution was passed at one drop/sec through a C15 Sep-Pak cartridge (Walters Associates, Framingham, Mass.) that had been washed with methanol, followed by water. The cartridge was then washed with 1 ml of 100 mM potassium phosphate and 5 mM EDTA, pH 7.5. A 750 µl aliquot of the eluate was added to a cuvette with 250 nmol of DTNB and 0.5 U of GSSG reductase. The assay then proceeded as in the measurement of total GSH. The levels of GSH and GSSG were based on standard curves.
GPx activity
Total glutathione peroxidase activity was determined
spectrophotometrically in BET1A cell lysate (intracellular) and
overlying media (extracellular) after exposure to 100 µM pyrogallol
and/or 10 mM GSH for 24 and 48 h. The cell lysate or media were
incubated in the presence of 0.1 mM sodium azide, 1 U/ml glutathione
reductase, 0.1 mM glutathione, and 0.12 mM reduced ß-nicotinamide
adenine dinucleotide phosphate (ß-NADPH), 0.016 mM dithiothreitol,
0.38 mM EDTA, and 50 mM sodium phosphate (pH 7.0) for 2 min at 25°C.
The reaction was initiated by the addition of 0.2 mM hydrogen peroxide.
The decrease in absorbance at 340 nm over 3 min as NADPH is converted
to NADP is proportional to the GPx activity. One unit of activity is
defined as the activity that catalyzed the oxidation of 1 nmol
NADPH/min using an extinction molar coefficient of 6.22 x
106 M-1
cm-1 for NADPH (1)
.
Northern analysis of eGPx expression
Total RNA from BET1A cells or epithelial cells freshly obtained
by bronchoscopic brushing of control and asthmatic airways was
extracted by the GTC (4 M guanidium thiocyanate, 25 mM sodium citrate
pH 7.0), 0.5% sarkosyl, and 0.1 M ß-mercaptoethanol) -CsCl gradient
method and evaluated by Northern analysis using a
32P-labeled eGPx probe (pCCF33) or as control
GAPDH cDNA probe (27)
, and then subjected to
autoradiography. Expression of eGPx mRNA relative to GAPDH mRNA was
accomplished using a PhosphorImager (Molecular Dynamics, Sunnyvale,
Calif.) to quantitate relative units.
Infection of BET1A cells with adenoviral vectors containing human
Cu/ZnSOD (AdSOD) or catalase cDNA (AdCL)
BET1A cells at 50% confluence were infected with
adenovirus-expressing SOD (AdSOD), adenovirus expressing catalase
(AdCL), or AdNull at 10 multiplicity of infection (MOI) per cell, as
described previously (28)
, and exposed to 100 µM
pyrogallol and 10 mM GSH for 24 h.
eGPx mRNA half-life
To determine the half-life of eGPx mRNA, BET1A cells stimulated
with GSH/pyrogallol for 24 h or unstimulated were exposed to
actinomycin D to inhibit new RNA synthesis. The cells were subsequently
harvested at different time points to evaluate eGPx mRNA.
Characterization of the 5' flanking region of the human eGPx gene
A 1003 base pair eGPx promoter fragment was isolated from
human lung DNA by using polymerase chain reaction (PCR) with primers
based on the known sequence of eGPx (29)
, cloned into
enhancer pGL3 vector (Promega, Madison, Wis.), and sequenced using
Sequenase 2.0 (U.S. Biochemical, Cleveland) and/or 373 DNA sequencing
system (Applied Biosystems, Foster City, Calif.). To identify more of
the 5' flanking region of the gene, a rapid PCR-based human
GenomeWalker method (Clontech, Palo Alto, Calif.) was used. PCR was
performed using the following two nested reactions (F, forward primer;
R, reverse primer): R- adaptor primer (AP1) (Clontech) and F-eGPx1 (5'
ACTGAGTGGGAAACCCAGCAAGGC 3') for the first PCR, and R-AP2 (Clontech)
and F-eGPx2 (5' CTATCTGTGGCCAAACCACCTGGC 3') for the nested reaction.
The 2402 bp product was ligated to the known 1.2 kb eGPx promoter
fragment using an internal ApaI site. The resulting 3202 bp
fragment was cloned into the SmaI and the Mlu I site of the
enhancer pGL3 vector (Promega). Deletion constructs p-52, p-252, p-443,
and p-652 were made by PCR, using the same downstream primer R-eGPx-12
(5' ATTGCAAGCTTCCGCGGCCAAGCCGAGACC 3') with a
HindIII site incorporated (underlined). A XhoI
site (underlined) was included in each of the 5' primers.
p-52: 5' ATTCCTCGAGCCTTGCCCTGGCTGTAATGG 3'
p-252: 5' ATTCCTCGAGCCCAGGACACCCACTCTTTG 3'
p-443: 5' ATTCCTCGAGGTTTTCCTTGAGTCTTTGGG 3'
p-652: 5' ATTCCTCGAGGAGGCCCAGAGAGTAACTGC 3'.
Each truncated segment was cloned into the pGL3 enhancer reporter vector. This vector contains an SV40 minimal promoter that drives the expression of the luciferase reporter gene. Sequencing confirmed identity of all constructs.
DNA transfection
Transfections in BET1A cells were accomplished using Liposome
(DOTTY, from Boehringer Mannheim, Mannheim, Germany) and 2.5 µg
plasmid. To normalize transfection efficiencies, a plasmid expressing
renilla luciferase (Promega) was cotransfected with the test plasmid in
each experiment. The cell extracts were prepared and firefly luciferase
activity was measured. The luciferase assay was performed with
Dual-Luciferase Reporter Assay protocol provided by Promega and the
activity was normalized to renilla luficerase.
| RESULTS |
|---|
|
|
|---|
Recovery of BAL fluid and cells from asthmatic individuals were similar to controls (P>0.05). The predominant cells obtained by BAL were >96% macrophages, with the cell differentials and viability (>95%) similar for the two groups [control: macrophages, 96 ± 1; lymphocytes, 3 ± 1; neutrophils, 0.8 ± 0.5; eosinophils, 0.2 ± 0.2; and asthmatics: macrophages, 96 ± 1; lymphocytes, 3.3 ± 1; neutrophils, 0.7 ± 0.5; eosinophils, 0.1 ± 0.2; all comparisons P>0.05].
Increased eGPx in BAL fluid
The eGPx protein was increased in ELF of asthmatic individuals
[eGPx µg/ml ELF: controls, 6 ± 1 (n=6); asthma,
11 ± 1 (n=7); P=0.02; (Fig. 1A
)], although total protein levels were similar between the
groups (protein µg/ml ELF: controls, 69 ± 22; asthma, 76 ± 18; P=0.81).
|
Up-regulation of eGPx mRNA
To investigate the mechanisms leading to increased eGPx protein,
eGPx mRNA expression was evaluated by Northern analysis of total RNA
from airway epithelial cells freshly obtained by bronchoscopic brushing
of healthy controls and asthmatic individuals. The predominant cells
obtained by bronchial brushing were epithelial cells, with ciliated
cells comprising the majority of the epithelial cell type. eGPx mRNA
was present at the predicted size of 1.9 kb in all samples using a
32P-labeled eGPx probe (pCCF31). Asthmatic
individuals had levels of eGPx mRNA 2.4-fold higher than those of
controls [eGPx mRNA/GAPDH mRNA: controls, 6 ± 1
(n=17); asthmatic individuals, 14 ± 3
(n=6); P=0.009] (Fig. 1B
). Based on
these results, we reasoned that elevated eGPx protein in BAL fluid was
due to oxidant induction of eGPx gene expression.
Reactive oxygen species induce the eGPx expression
To investigate whether induction of eGPx was related to ROS, BET1A
cells or HAEC were exposed to various ROS in vitro. Northern
analysis showed that both BET1A and HAEC express the eGPx gene in
culture with higher eGPx mRNA levels in HAEC (eGPx mRNA/GAPDH mRNA:
cultured HAEC, 17 ± 4; BET1A, 1.3 ± 0.4). Furthermore, eGPx
mRNA transcripts increased after a minimum of 24 h exposure
(P<0.05) to the oxidative stress of pyrogallol (100 µM,
P<0.001) (Fig. 2
). Hydrogen peroxide modestly increased eGPx expression twofold at
48 h [eGPx mRNA/GAPDH mRNA relative to baseline; 10 µM
H2O2, 1 ± 0.08; 25
µM, 1.02 ± 0.09; 50 µM, 1.3 ± 0.2; 100 µM, 1.9 ± 0.2; (P=0.001)]. Similarly, primary HAEC from healthy
controls exposed to pyrogallol (24 h) have increased eGPx mRNA [eGPx
mRNA/GAPDH mRNA relative to basal expression: 0.1 µM, 1.2 ±
0.05; 1 µM, 2.6 ± 0.8; 10 µM, 1.7 ± 0.5;
(P=0.01)]. Thus, eGPx gene expression is increased in human
bronchial epithelial cells in response to ROS.
|
Effect of GSH and pyrogallol on the eGPx mRNA
Glutathione is an abundant antioxidant in the intracellular and
extracellular lung compartments and an essential cofactor for eGPx
reactions (5
, 6)
. The redox state of glutathione is one
indicator of the oxidizing state intracellularly and may play a role in
the regulation of eGPx expression. Pyrogallol (100 µM) rapidly
decreased intracellular GSH in BET1A, followed by a significant
increase in GSH at later time points (P=0.002) (Fig. 3
). Intracellular GSSG increased at 30 min, followed by a decrease to
baseline over 48 h (Fig. 3)
. In contrast, a significant increase
in GSSG occurred in the overlying culture media after 8 h of
pyrogallol, whereas GSH decreased in the overlying culture media after
8 h (P=0.02) (Fig. 3)
.
|
Levels of GSH in culture (µM) are several orders of magnitude lower
in comparison to physiological levels (mM) (4
, 5)
; thus,
we supplemented GSH in tissue culture media to investigate effects of
ROS in more physiological conditions. The 10 mM levels of GSH alone had
no effect on the eGPx gene expression. However, a combination of 100
µM pyrogallol with GSH for 24 h strikingly augmented gene
induction (P<0.001) (Fig. 4
), although 10 mM of GSSG did not affect pyrogallol induction of eGPx.
|
Increase in extracellular GPx protein and activity
To investigate whether the induction of eGPx mRNA leads to
increased eGPx protein and activity, BET1A cells were exposed to
pyrogallol, GSH, and a combination of pyrogallol and GSH for 24 and
48 h. The eGPx protein was not detectable intracellularly.
However, the overlying media had a significant increase of the eGPx
protein by pyrogallol or combination of GSH and pyrogallol [eGPx
protein (ng/106 cells) mean ±
SD: baseline <0.125; pyrogallol, 0.4 ± 0.17;
pyrogallol and GSH, 0.5 ± 0.2; P<0.05]. Furthermore,
the extracellular GPx activity increased after stimulation of
pyrogallol, and in combination with GSH led even to higher levels of
activity. However, the intracellular GPx activity was not induced by
ROS (Fig. 5
). Thus, the induction of the eGPx mRNA resulted in increased
extracellular activity and protein.
|
Overexpression of SOD abrogates eGPx mRNA induction
To determine the primary ROS (i.e., superoxide or hydrogen
peroxide involved in the induction of the eGPx gene), we infected the
BET1A cells with AdSOD and/or catalase (AdCL) (28)
, which
are known to induce the expression and activity of SOD more than
14-fold, and catalase more than 16-fold (28)
. Null virus
(AdNull) or AdCL did not prevent induction of eGPx in BET1A cells. In
contrast, the eGPx mRNA induction in cells was significantly inhibited
by AdSOD (P=0.02) (Fig. 6
). These data suggest that eGPx gene induction is dependent in part on
intracellular superoxide levels.
|
eGPx mRNA half-life
Increases in mRNA may occur at the level of transcription or RNA
stability, thus eGPx mRNA stability was evaluated in BET1A cells. An
inhibitor of RNA synthesis, actinomycin D (AD) prevented pyrogallol
induction of eGPx mRNA supporting a transcriptional mechanism [eGPx
mRNA/GAPDH relative to baseline eGPx expression (mean±SD):
pyrogallol, 2.7 ± 0.02; pyrogallol and AD, 0.8 ± 0.07;
P=0.001 (Fig. 7A
)]. The eGPx mRNA half-life determined in BET1A cells was
prolonged but not affected by ROS [half-life: unstimulated, 34 ±
8 h; GSH/pyrogallol stimulation, 32 ± 9 h (Fig. 7B
)]. Based on these results, we investigated the
regulation of eGPx transcription.
|
Analysis of 5' flanking sequence of the human eGPx gene defines
region of promoter responsible for gene activation
Comparison of the 5' flanking region of eGPx promoter with the
known sequence (10)
revealed 15 insertions, 7 deletions,
and 4 mismatches (Genbank accession #AF285633). To test whether the
eGPx promoter was responsible for ROS inducibility, a genomic fragment
of 3.2 kb, including 5' upstream sequences and part of the cDNA
sequence, was placed 5' to a firefly luciferase reporter gene, and its
capacity to direct firefly luciferase synthesis was compared to a
series of deletion mutant constructs in BET1A cells. Cells were
transfected and exposed to oxidant stress of GSH and pyrogallol
for 24 h. All constructs had low levels of promoter activity
in the absence of ROS. The region between -1003 bp and -652 bp led to
45-fold increase in the eGPx promoter activity with ROS (Fig. 8
).
|
| DISCUSSION |
|---|
|
|
|---|
Asthma is a condition characterized by chronic airway inflammation
(15
16
17
18
19
20
21)
. Inflammatory and epithelial cells in asthmatic
lungs generate increased amounts of ROS that correlate with disease
severity (15
16
17
18
19
20
21
, 35)
. Asthmatics also have increased
nitric oxide (NO) and RNS in the airway due to increased NO synthesis
by epithelial cells. NO and superoxide rapidly react to form RNS, which
modify tyrosine in proteins by numerous complex mechanisms to create
nitrotyrosine, allowing nitrotyrosine to be used as a collective marker
of RNS and ROS (15
, 22
, 36
, 37)
. Despite a clear increase
of oxidative and nitrosative stress in the asthmatic airway,
intracellular antioxidant enzymes are not increased (1
, 2
, 20)
. In fact, asthmatic lung cells have catalase and GPx levels
similar to controls and decreased levels of SOD (1
, 2)
.
Although eGPx protein is increased in asthmatic ELF in this study,
total glutathione peroxidase activity in asthmatic ELF previously has
not been different from controls (20)
. This may reflect
that eGPx accounts for only 57% of the total glutathione peroxidase
activity in ELF, with the remainder of activity derived from cellular
GPx (9)
. Furthermore, NO, which is increased in asthma, is
capable of inactivating GPx (38
, 39)
.
Expression of eGPx mRNA in bronchial epithelial cells in healthy
controls indicates that eGPx synthesis and secretion into ELF occur in
part by the bronchial epithelial cells. The eGPx protein in ELF may
also be due in part to eGPx expression by alveolar macrophages
(9)
. For example, eGPx is expressed in macrophages and is
increased with oxidant stress of cigarette smoke (40)
.
However, the striking increase of eGPx mRNA in asthmatic bronchial
epithelial cells provides clear evidence that these cells are also the
source of the increased eGPx in ELF. Parallel to in vivo
findings, bronchial epithelial cells significantly increase eGPx mRNA
expression in response to increased intracellular or extracellular ROS
in vitro. Rapid changes in GSH and GSSG in cells and in the
overlying supernatant occur after ROS exposure, verifying alterations
in the redox environment. Similarly, alterations of GSH and GSSG in
asthmatic airways have been reported by us and others in previous
studies (1
2
3
, 20
, 41)
. Rapid induction of intracellular
GSH is a known response to oxidative stress (42
, 43)
and a
critical determinant of cellular tolerance to oxidizing environments
(43)
. In the present study, exposure to pyrogallol caused
a transient depletion of GSH, followed later by a prolonged elevation
in intracellular GSH levels. Other protective responses to oxidative
stress include uptake of GSH into cells (45
, 46)
and
export of the oxidized form to overcome an accumulation of GSSG within
the cytosol. Studies have shown that a 24 h exposure to ROS
increases GSH through induction of
-glutamylcysteine synthetase
(
-GCS) (43
, 44)
.
Since glutathione is a critical cofactor for eGPx activity, coordinate
induction of this coupled system is likely necessary for efficient
antioxidant defense. For example, previous studies have shown a
positive correlation between the eGPx protein and GSH levels in ELF
from cigarette smokers (4)
. Based on this, and because
glutathione in cell culture media is more than 100-fold less than in
ELF, we tested whether augmentation of glutathione levels would
influence the ROS induction of eGPx. Physiological levels of GSH
potentiated the effect of ROS on eGPx expression. Overexpression of SOD
prevented the induction of eGPx, suggesting the importance of
superoxide in eGPx induction. Moreover, the lack of effect on eGPx
induction by catalase overexpression indicates that hydrogen peroxide
or RNS are less likely key mediators of eGPx induction.
Usually considered an antioxidant, physiological levels of GSH
potentiated the effect of ROS on eGPx expression, which may be due to
GSH participation in oxidative processes (47
48
49
50)
. In the
generation of ROS through autocatalytic processes (i.e., pyrogallol),
GSH does not inhibit production of superoxide, but rather promotes the
formation of oxidizing species by facilitating autoxidation. At low
levels of GSH, autoxidation of compounds is less rapid and initiated by
molecular oxygen, which leads to superoxide. However, GSH in the range
of 100-1000 µM leads to a dose-dependent increase in oxygen uptake
during autoxidation of alloxan, a pyrimidine compound
(48)
. GSH is oxidized to glutathionyl during autocatalytic
reactions, which subsequently generate superoxide:
![]() |
The regulation of genes in response to ROS may occur via
transcription and/or stabilization of mRNA (11
12
13
14
, 51
, 52)
. Our results show that eGPx mRNA stability is not affected
by ROS. In contrast, the 5' flanking region of the human eGPx gene,
which contains the consensus element for AP-1, is exquisitely ROS
inducible. Studies from a number of laboratories have demonstrated that
ROS induce transcription by the activation of redox-regulated
transcription factors, e.g., AP-1 (11
12
13
14)
. For example,
the transcriptional induction of
-GCS by ROS is related to
activation of AP-1 (44)
.
Together with the finding of increased ROS and eGPx expression in
asthmatic lungs, the eGPx induction in respiratory epithelial cells by
ROS in vitro provides strong support for an oxidative
mechanism of eGPx gene induction in the asthmatic airway epithelium.
Based on this, we propose the following molecular mechanism of eGPx
gene induction in asthma. Increased ROS formation by inflammatory and
epithelial cells in the lung leads to alterations in the intracellular
and extracellular reducing/oxidizing environment, i.e., GSH/GSSG
levels. Loss of SOD antioxidant activity is present in asthma and
favors increased superoxide and RNS formation. The high level of
oxidative and nitrosative stress leads subsequently to induction of
eGPx mRNA transcription, protein expression, and secretion into ELF.
Since susceptibility of cells to ROS depends largely on the ability to
up-regulate protective antioxidant systems (51)
, increased
eGPx is undoubtedly an important defense against oxidative injury to
the airway surface of asthmatic individuals.
| ACKNOWLEDGMENTS |
|---|
Received for publication March 6, 2000.
Revision received June 1, 2000.
| REFERENCES |
|---|
|
|
|---|
B, and glutathione S-transferase gene expression. J. Biol. Chem. 271,13422-13429
and dexamethasone in human alveolar epithelial cells. J. Biol. Chem. 274,5088-5096This article has been cited by other articles:
![]() |
C. Liu, D. Xu, L. Liu, F. Schain, A. Brunnstrom, M. Bjorkholm, H.-E. Claesson, and J. Sjoberg 15-Lipoxygenase-1 induces expression and release of chemokines in cultured human lung epithelial cells Am J Physiol Lung Cell Mol Physiol, July 1, 2009; 297(1): L196 - L203. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M Hassan Selenium status in patients with aspirin-induced asthma Ann Clin Biochem, September 1, 2008; 45(5): 508 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nadeem, A. Masood, and N. Siddiqui Review: Oxidant--antioxidant imbalance in asthma: scientific evidence, epidemiological data and possible therapeutic options Therapeutic Advances in Respiratory Disease, August 1, 2008; 2(4): 215 - 235. [Abstract] [PDF] |
||||
![]() |
H. Abdala-Valencia, J. Earwood, S. Bansal, M. Jansen, G. Babcock, B. Garvy, M. Wills-Karp, and J. M. Cook-Mills Nonhematopoietic NADPH oxidase regulation of lung eosinophilia and airway hyperresponsiveness in experimentally induced asthma Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1111 - L1125. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Reynaert, S. W. Aesif, T. McGovern, A. Brown, E. F. M. Wouters, C. G. Irvin, and Y. M. W. Janssen-Heininger Catalase Overexpression Fails to Attenuate Allergic Airways Disease in the Mouse J. Immunol., March 15, 2007; 178(6): 3814 - 3821. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Reynaert, E. F. M. Wouters, and Y. M. W. Janssen-Heininger Modulation of Glutaredoxin-1 Expression in a Mouse Model of Allergic Airway Disease Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 147 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chambellan, P. J. Cruickshank, P. McKenzie, S. B. Cannady, K. Szabo, S. A. A. Comhair, and S. C. Erzurum Gene Expression Profile of Human Airway Epithelium Induced by Hyperoxia In Vivo Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 424 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghosh, A. J. Janocha, M. A. Aronica, S. Swaidani, S. A. A. Comhair, W. Xu, L. Zheng, S. Kaveti, M. Kinter, S. L. Hazen, et al. Nitrotyrosine Proteome Survey in Asthma Identifies Oxidative Mechanism of Catalase Inactivation J. Immunol., May 1, 2006; 176(9): 5587 - 5597. [Abstract] [Full Text] [PDF] |
||||
![]() |
V L Kinnula Focus on antioxidant enzymes and antioxidant strategies in smoking related airway diseases Thorax, August 1, 2005; 60(8): 693 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. A. Comhair, K. S. Ricci, M. Arroliga, A. R. Lara, R. A. Dweik, W. Song, S. L. Hazen, E. R. Bleecker, W. W. Busse, K. F. Chung, et al. Correlation of Systemic Superoxide Dismutase Deficiency to Airflow Obstruction in Asthma Am. J. Respir. Crit. Care Med., August 1, 2005; 172(3): 306 - 313. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A.A. Comhair, W. Xu, S. Ghosh, F. B.J.M. Thunnissen, A. Almasan, W. J. Calhoun, A. J. Janocha, L. Zheng, S. L. Hazen, and S. C. Erzurum Superoxide Dismutase Inactivation in Pathophysiology of Asthmatic Airway Remodeling and Reactivity Am. J. Pathol., March 1, 2005; 166(3): 663 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bierl, B. Voetsch, R. C. Jin, D. E. Handy, and J. Loscalzo Determinants of Human Plasma Glutathione Peroxidase (GPx-3) Expression J. Biol. Chem., June 25, 2004; 279(26): 26839 - 26845. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Caramori and A Papi Oxidants and asthma Thorax, February 1, 2004; 59(2): 170 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. KUMAR, S. LNU, R. MALYA, D. BARRON, J. MOORE, D. B. CORRY, and A. M. BORIEK Mechanical stretch activates nuclear factor-kappaB, activator protein-1, and mitogen-activated protein kinases in lung parenchyma: implications in asthma FASEB J, October 1, 2003; 17(13): 1800 - 1811. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. El-Chemaly, M. Salathe, S. Baier, G. E. Conner, and R. Forteza Hydrogen Peroxide-Scavenging Properties of Normal Human Airway Secretions Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 425 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Harju, R. Kaarteenaho-Wiik, Y. Soini, R. Sormunen, and V. L. Kinnula Diminished Immunoreactivity of {gamma}-Glutamylcysteine Synthetase in the Airways of Smokers' Lung Am. J. Respir. Crit. Care Med., September 1, 2002; 166(5): 754 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. A. Comhair and S. C. Erzurum Antioxidant responses to oxidant-mediated lung diseases Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L246 - L255. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |