FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by COMHAIR, S. A. A.
Right arrow Articles by ERZURUM, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by COMHAIR, S. A. A.
Right arrow Articles by ERZURUM, S. C.
(The FASEB Journal. 2001;15:70-78.)
© 2001 FASEB

Extracellular glutathione peroxidase induction in asthmatic lungs: evidence for redox regulation of expression in human airway epithelial cells

SUZY A. A. COMHAIR*, PERCY R. BHATHENA*, CAROL FARVER{dagger}, FREDERIK B. J. M. THUNNISSEN{ddagger} and SERPIL C. ERZURUM*1

* Departments of Pulmonary and Critical Care Medicine, Cancer Biology and
{dagger} Pathology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195, USA; and
{ddagger} Department of Pathology, Canisius Wilhelmina Hospital, NL 6500 GS Nijmegen, The Netherlands

1Correspondence: Department of Pulmonary and Critical Care Medicine, Cleveland Clinic Foundation, 9500 Euclid Ave./A90, Cleveland, OH 44195, USA. E-mail: erzurus{at}ccf.org


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
A critical first-line antioxidant defense on the airway epithelial surface against reactive oxygen and nitrogen species (ROS and RNS) is extracellular glutathione peroxidase (eGPx). Little is known about the regulation of eGPx or its role in ROS-mediated lung diseases such as asthma. Here we show that eGPx is increased in the asthmatic airway in comparison to healthy controls. Higher levels of eGPx mRNA in asthmatic airway epithelium verified bronchial epithelial cells as the source for the increased eGPx. The eGPx mRNA in bronchial epithelial cells in vitro increased eightfold after exposure to ROS and glutathione, an essential cofactor for eGPx activity. Alterations in intracellular and extracellular oxidized and reduced glutathione were temporally associated with eGPx induction, further supporting redox mechanisms in gene expression. Overexpression of superoxide dismutase, but not catalase, inhibited induction and identified superoxide as a key intermediary. The eGPx mRNA half-life was not affected by ROS, suggesting a transcriptional mechanism for eGPx regulation. Fusion genes of deletion fragments of the eGPx gene 5' flanking region driving a reporter gene conclusively identified the ROS-responsive region, which contained the consensus DNA binding site for the redox-regulated transcription factor, activator protein 1.—Comhair, S. A. A., Bhathena, P. R., Farver, C., Thunnissen, F. B. J. M., Erzurum, S. C. Extracellular glutathione peroxidase induction in asthmatic lungs: evidence for redox regulation of expression in human airway epithelial cells.


Key Words: reactive oxygen species • asthma • lung • nitrotyrosine


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE RESPIRATORY EPITHELIUM is frequently exposed to oxidants whether inhaled, as in cigarette smoke or air pollutants, or from reactive oxygen and nitrogen species (ROS, RNS) released from cells in the lungs during airway inflammation. Fortunately, the lung is endowed with an integrated defense system consisting of low molecular weight antioxidants such as glutathione and intracellular enzymes such as superoxide dismutase, catalase, and glutathione peroxidase to protect against the toxic effects of oxidants generated within cells (1 , 2) . However, a large portion of oxidative stress occurs on the extracellular surface of the lung epithelium. Thus, critical first-line antioxidant defenses are located in the epithelial lining fluid (ELF). The ELF contains the highest concentrations of reduced glutathione (GSH) found in the body and a specific secreted extracellular glutathione peroxidase (eGPx) (3 4 5) . Glutathione peroxidases (EC 1.11.1.9, GPx) are a family of antioxidant enzymes that reduce hydrogen peroxide and/or lipid hydrogen peroxides by the oxidation of reduced glutathione or S-nitrosoglutathione (6 7 8) . The eGPx is genetically distinct from the classical cellular GPx, membranous phospholipid hydroperoxidase GPx, or the gastrointestinal form of GPx (6) . Lung cells are able to synthesize and secrete eGPx (9) . However, little is known about the regulation of eGPx (10) . Based on the knowledge that ROS and RNS play a role in regulation of a number of important genes (11 12 13 14) , we hypothesized that increased oxidative stress leads to induction of eGPx in the lung. Studies show that increased generation of ROS and RNS occurs in asthmatic airways and plays a key role in the pathogenesis of asthma (15 16 17 18 19 20 21 22) . If eGPx expression is up-regulated by ROS, we reasoned that eGPx would be increased in asthmatic lungs. In the present study, we quantitate eGPx protein and mRNA in the human asthmatic airway in comparison to healthy controls in vivo. To define redox mechanisms of eGPx regulation in the lung, the effect of ROS and glutathione on eGPx expression in bronchial epithelial cells is defined in vitro and the 5' flanking region of the eGPx gene necessary for transcriptional activation is identified. The results show that eGPx is increased in asthma and provide clear evidence of transcriptional activation of the gene by superoxide, which is strikingly augmented by glutathione.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Study population
To evaluate eGPx in the respiratory system in vivo, the study population included 35 individuals: 22 healthy nonsmoking individuals and 13 asthmatic individuals. Exclusion criteria for the two groups included age under 18 years or over 65 years, pregnancy, human immunodeficiency virus infection, and history of respiratory infection in the previous 6 wk, current tobacco use, prolonged exposure to second hand smoke at home or at work, exposure to dusty environments or known pulmonary disease-producing agents. Asthma was defined by the American Thoracic Society guidelines, including episodic respiratory symptoms, reversible airflow obstruction, and/or a positive methacholine challenge test (a drop in FEV1 20% or greater at the highest concentration administered). None of the subjects had a recent asthma exacerbation, hospitalization, or change in medications for 6 wk prior to the study. Finally, no subjects received systemic corticosteroids during the previous 6 months or inhaled corticosteroid in the preceding 6 wk. Asthma severity and temporal course in volunteers included mild intermittent and persistent asthma (23) . Control individuals were nonsmokers, i.e., no cigarettes for > 5 years and < 5 pack years history. The Cleveland Clinic Foundation Institutional Review Board approved the study and written informed consent was obtained from all individuals.

Isolation of bronchial epithelial cells
Individuals underwent bronchoscopy to obtain samples of bronchial epithelial cells with cytology brushings from second- and third-order bronchi with 1 mm cytology brush (Microvasive, Watertown, Mass.) as described previously (1) . The brush sample was immediately placed in RPMI 1640 (GIBCO-BRL, Grand Island, N.Y.) and an aliquot was taken for cytology and cell differential determination. RNA was extracted from cells as described previously (1) .

BAL fluid
Bronchoalveolar lavage (BAL) was performed using fiberoptic bronchoscopy as described previously (4) . Briefly, after local anesthesia with 2% lidocaine, a bronchoscope was wedged in a segmental bronchus of the right middle lobe or lingula. Three 50 ml aliquots of warm physiological saline were infused and recovered with manual suction. The BAL fluid was filtered through a Y blood filter (Drip Chamber Pump Fhashball Divia, Baxter, Morton Grove, Ill.) and cellular components were separated by centrifugation (700 x g, 10 min). Cells were washed once with Hanks balanced salt solution (Life Technologies, Inc., Grand Island, N.Y.) and counted with a hemacytometer. Cell differential was performed after a Giemsa-type staining (Diff-Quick, American Scientific products, Stone Mountain, Calif.). Peripheral blood was obtained from study subjects on the same day as BAL; serum was then extracted by centrifugation of the whole blood (1430 x g, 10 min). Urea was determined in BAL fluid and serum using the BUN (ENDPOINT) reaction (Sigma, St. Louis, Mo.) as described previously (4) . Relative levels of ELF were estimated by using simple dilution principles of the urea concentration in serum and BAL fluid. Because the number of sample obtained in some individuals was limited, not all individuals were used for every measurement. The number of samples evaluated for each parameter is stated in the text.

eGPx
eGPx protein was measured by enzyme-linked immunosorbent assay (Calbiochem, La Jolla, Calif.). This method is based on a sandwich-type immunoassay, and is specific for eGPx. To determine the eGPx protein in the overlying media of the BET1A cells, the media was first concentrated 20 times by using 10,000 NMWL ultrafree MC filter unit (Millipore, Bedford, Mass.). The eGPx protein concentration present in the BAL fluid, BET1A cell lysates, and overlying media was based on 4-parameter curve fit generated from known standard concentrations of eGPx.

Cell culture
BET1A, a human bronchial epithelial cell line transformed by the SV40, was cultured in serum-free Lechner and LaVeck medium (LHC-8, Biofluids, Inc., Rockville, Md.) with additives 0.33 nM retinoic acid, 2.75 mM epinephrine, and the antibiotic combination 1% penicillin/streptomycin on plates precoated with coating media containing 29 µg/ml collagen (Vitrogen: Collagen, Palo Alto, Calif.), 10 µg/ml bovine serum albumin (Biofluids), and 10 µg/ml fibronectin (Calbiochem) for 5 min (24) . Human airway epithelial cells (HAEC) obtained by bronchial brushing were cultured in serum-free Lechner and LaVeck media (LHC8) on plates precoated with coating media. Primary HAEC cultures of passages 0–2 were used in experiments. To evaluate the response to ROS, the cells were stimulated at 70% confluence with the intracellular superoxide-producing agent pyrogallol (25) (J. T. Baker Inc., Phillipsburg, N.J.), hydrogen peroxide (Sigma), and/or reduced and oxidized glutathione in a dose- and time-dependent manner.

GSH/GSSG levels
GSH levels in cell lysate and media were measured by standard methods as described previously (26) . In brief, total glutathione levels were determined by mixing equal amounts of cell lysate or media with 10 mM 5,5'-dithiobis-2-nitrobenzoic acid (DTNB) in 100 mM potassium phosphate, pH 7.5, which contained 17.5 µM EDTA. An aliquot (50 µl) of the solution was added to a cuvette containing 0.5 U of glutathione disulfide reductase (Sigma type III) in 100 mM potassium phosphate and 5 mM EDTA, pH 7.5. After 1 min, the reaction was initiated with 220 nmol of NADPH in a final reaction volume of 1 ml. The rate of reduction of DTNB was recorded continuously at 412 nm by a spectrophotometer with a Kinetics/Time feature (Beckman DU-640, Beckman Instruments, Fullerton, Calif.).

To assay GSSG, equal volumes of cell lysate or media and N-ethylmaleimide (NEM) were added. An aliquot (50 µl) of the solution was passed at one drop/sec through a C15 Sep-Pak cartridge (Walters Associates, Framingham, Mass.) that had been washed with methanol, followed by water. The cartridge was then washed with 1 ml of 100 mM potassium phosphate and 5 mM EDTA, pH 7.5. A 750 µl aliquot of the eluate was added to a cuvette with 250 nmol of DTNB and 0.5 U of GSSG reductase. The assay then proceeded as in the measurement of total GSH. The levels of GSH and GSSG were based on standard curves.

GPx activity
Total glutathione peroxidase activity was determined spectrophotometrically in BET1A cell lysate (intracellular) and overlying media (extracellular) after exposure to 100 µM pyrogallol and/or 10 mM GSH for 24 and 48 h. The cell lysate or media were incubated in the presence of 0.1 mM sodium azide, 1 U/ml glutathione reductase, 0.1 mM glutathione, and 0.12 mM reduced ß-nicotinamide adenine dinucleotide phosphate (ß-NADPH), 0.016 mM dithiothreitol, 0.38 mM EDTA, and 50 mM sodium phosphate (pH 7.0) for 2 min at 25°C. The reaction was initiated by the addition of 0.2 mM hydrogen peroxide. The decrease in absorbance at 340 nm over 3 min as NADPH is converted to NADP is proportional to the GPx activity. One unit of activity is defined as the activity that catalyzed the oxidation of 1 nmol NADPH/min using an extinction molar coefficient of 6.22 x 106 M-1 cm-1 for NADPH (1) .

Northern analysis of eGPx expression
Total RNA from BET1A cells or epithelial cells freshly obtained by bronchoscopic brushing of control and asthmatic airways was extracted by the GTC (4 M guanidium thiocyanate, 25 mM sodium citrate pH 7.0), 0.5% sarkosyl, and 0.1 M ß-mercaptoethanol) -CsCl gradient method and evaluated by Northern analysis using a 32P-labeled eGPx probe (pCCF33) or as control GAPDH cDNA probe (27) , and then subjected to autoradiography. Expression of eGPx mRNA relative to GAPDH mRNA was accomplished using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.) to quantitate relative units.

Infection of BET1A cells with adenoviral vectors containing human Cu/ZnSOD (AdSOD) or catalase cDNA (AdCL)
BET1A cells at 50% confluence were infected with adenovirus-expressing SOD (AdSOD), adenovirus expressing catalase (AdCL), or AdNull at 10 multiplicity of infection (MOI) per cell, as described previously (28) , and exposed to 100 µM pyrogallol and 10 mM GSH for 24 h.

eGPx mRNA half-life
To determine the half-life of eGPx mRNA, BET1A cells stimulated with GSH/pyrogallol for 24 h or unstimulated were exposed to actinomycin D to inhibit new RNA synthesis. The cells were subsequently harvested at different time points to evaluate eGPx mRNA.

Characterization of the 5' flanking region of the human eGPx gene
A 1003 base pair eGPx promoter fragment was isolated from human lung DNA by using polymerase chain reaction (PCR) with primers based on the known sequence of eGPx (29) , cloned into enhancer pGL3 vector (Promega, Madison, Wis.), and sequenced using Sequenase 2.0 (U.S. Biochemical, Cleveland) and/or 373 DNA sequencing system (Applied Biosystems, Foster City, Calif.). To identify more of the 5' flanking region of the gene, a rapid PCR-based human GenomeWalker method (Clontech, Palo Alto, Calif.) was used. PCR was performed using the following two nested reactions (F, forward primer; R, reverse primer): R- adaptor primer (AP1) (Clontech) and F-eGPx1 (5' ACTGAGTGGGAAACCCAGCAAGGC 3') for the first PCR, and R-AP2 (Clontech) and F-eGPx2 (5' CTATCTGTGGCCAAACCACCTGGC 3') for the nested reaction. The 2402 bp product was ligated to the known 1.2 kb eGPx promoter fragment using an internal ApaI site. The resulting 3202 bp fragment was cloned into the SmaI and the Mlu I site of the enhancer pGL3 vector (Promega). Deletion constructs p-52, p-252, p-443, and p-652 were made by PCR, using the same downstream primer R-eGPx-12 (5' ATTGCAAGCTTCCGCGGCCAAGCCGAGACC 3') with a HindIII site incorporated (underlined). A XhoI site (underlined) was included in each of the 5' primers.

p-52: 5' ATTCCTCGAGCCTTGCCCTGGCTGTAATGG 3'

p-252: 5' ATTCCTCGAGCCCAGGACACCCACTCTTTG 3'

p-443: 5' ATTCCTCGAGGTTTTCCTTGAGTCTTTGGG 3'

p-652: 5' ATTCCTCGAGGAGGCCCAGAGAGTAACTGC 3'.

Each truncated segment was cloned into the pGL3 enhancer reporter vector. This vector contains an SV40 minimal promoter that drives the expression of the luciferase reporter gene. Sequencing confirmed identity of all constructs.

DNA transfection
Transfections in BET1A cells were accomplished using Liposome (DOTTY, from Boehringer Mannheim, Mannheim, Germany) and 2.5 µg plasmid. To normalize transfection efficiencies, a plasmid expressing renilla luciferase (Promega) was cotransfected with the test plasmid in each experiment. The cell extracts were prepared and firefly luciferase activity was measured. The luciferase assay was performed with Dual-Luciferase Reporter Assay protocol provided by Promega and the activity was normalized to renilla luficerase.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Clinical characteristics
Healthy control and asthmatic individuals were similar in terms of age (control 41±4 year; asthma 39±3 year: P>0.05). Pulmonary function testing showed no difference in airflow limitation between groups, although asthmatics had positive methacholine challenge and/or evidence of spontaneous airway reactivity [forced vital capacity (FVC % predicted) control 103 ± 6, asthma 97 ± 4; forced expiratory volume in 1 s (FEV1 % predicted) control 99 ± 6, asthma 93 ± 4; FEV1/FVC control 79 ± 2, asthma 78 ± 1; all P>0.05]. Bronchoscopy was performed in all individuals without complications.

Recovery of BAL fluid and cells from asthmatic individuals were similar to controls (P>0.05). The predominant cells obtained by BAL were >96% macrophages, with the cell differentials and viability (>95%) similar for the two groups [control: macrophages, 96 ± 1; lymphocytes, 3 ± 1; neutrophils, 0.8 ± 0.5; eosinophils, 0.2 ± 0.2; and asthmatics: macrophages, 96 ± 1; lymphocytes, 3.3 ± 1; neutrophils, 0.7 ± 0.5; eosinophils, 0.1 ± 0.2; all comparisons P>0.05].

Increased eGPx in BAL fluid
The eGPx protein was increased in ELF of asthmatic individuals [eGPx µg/ml ELF: controls, 6 ± 1 (n=6); asthma, 11 ± 1 (n=7); P=0.02; (Fig. 1A )], although total protein levels were similar between the groups (protein µg/ml ELF: controls, 69 ± 22; asthma, 76 ± 18; P=0.81).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. A) Increased eGPx in ELF of asthmatic individuals. eGPx is present in healthy control ELF, but is present at higher levels in ELF from asthmatic lungs (P=0.02). Each circle represents eGPx level of a single individual; mean and SE are also shown. Each value is derived from average of duplicate determinations. B) Increased eGPx mRNA expression in human airway epithelial cells of asthmatic individuals. Representative Northern analysis of total RNA (10 µg RNA/lane) from airway epithelial cells obtained by bronchial brushing from two healthy controls (lanes 1, 2) and two asthmatic individuals (lanes 3, 4) using a 32P-labeled eGPx cDNA reveals higher eGPx mRNA in asthmatic airway epithelium than controls. GAPDH is shown as control for RNA integrity and loading (lanes 5–8).

Up-regulation of eGPx mRNA
To investigate the mechanisms leading to increased eGPx protein, eGPx mRNA expression was evaluated by Northern analysis of total RNA from airway epithelial cells freshly obtained by bronchoscopic brushing of healthy controls and asthmatic individuals. The predominant cells obtained by bronchial brushing were epithelial cells, with ciliated cells comprising the majority of the epithelial cell type. eGPx mRNA was present at the predicted size of 1.9 kb in all samples using a 32P-labeled eGPx probe (pCCF31). Asthmatic individuals had levels of eGPx mRNA 2.4-fold higher than those of controls [eGPx mRNA/GAPDH mRNA: controls, 6 ± 1 (n=17); asthmatic individuals, 14 ± 3 (n=6); P=0.009] (Fig. 1B ). Based on these results, we reasoned that elevated eGPx protein in BAL fluid was due to oxidant induction of eGPx gene expression.

Reactive oxygen species induce the eGPx expression
To investigate whether induction of eGPx was related to ROS, BET1A cells or HAEC were exposed to various ROS in vitro. Northern analysis showed that both BET1A and HAEC express the eGPx gene in culture with higher eGPx mRNA levels in HAEC (eGPx mRNA/GAPDH mRNA: cultured HAEC, 17 ± 4; BET1A, 1.3 ± 0.4). Furthermore, eGPx mRNA transcripts increased after a minimum of 24 h exposure (P<0.05) to the oxidative stress of pyrogallol (100 µM, P<0.001) (Fig. 2 ). Hydrogen peroxide modestly increased eGPx expression twofold at 48 h [eGPx mRNA/GAPDH mRNA relative to baseline; 10 µM H2O2, 1 ± 0.08; 25 µM, 1.02 ± 0.09; 50 µM, 1.3 ± 0.2; 100 µM, 1.9 ± 0.2; (P=0.001)]. Similarly, primary HAEC from healthy controls exposed to pyrogallol (24 h) have increased eGPx mRNA [eGPx mRNA/GAPDH mRNA relative to basal expression: 0.1 µM, 1.2 ± 0.05; 1 µM, 2.6 ± 0.8; 10 µM, 1.7 ± 0.5; (P=0.01)]. Thus, eGPx gene expression is increased in human bronchial epithelial cells in response to ROS.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. Induction of eGPx mRNA in transformed bronchial epithelial cells (BET1A) by ROS. A) BET1A cells were exposed to the superoxide-generating compound pyrogallol (0–100 µM), for 48 h. Representative Northern analysis of total RNA (10 µg/lane) demonstrates increase of eGPx mRNA with 100 µM pyrogallol (lane 4). B) Time course of pyrogallol in BET1A cells. The representative Northern analysis of total RNA (10 µg/lane) demonstrates increase of eGPx mRNA with 100 µM pyrogallol at 24 and 48 h (lanes 4, 5). GAPDH is shown as control. Relative units of eGPx mRNA/GAPDH (means±SD) are summarized for a minimum of 3 experiments

Effect of GSH and pyrogallol on the eGPx mRNA
Glutathione is an abundant antioxidant in the intracellular and extracellular lung compartments and an essential cofactor for eGPx reactions (5 , 6) . The redox state of glutathione is one indicator of the oxidizing state intracellularly and may play a role in the regulation of eGPx expression. Pyrogallol (100 µM) rapidly decreased intracellular GSH in BET1A, followed by a significant increase in GSH at later time points (P=0.002) (Fig. 3 ). Intracellular GSSG increased at 30 min, followed by a decrease to baseline over 48 h (Fig. 3) . In contrast, a significant increase in GSSG occurred in the overlying culture media after 8 h of pyrogallol, whereas GSH decreased in the overlying culture media after 8 h (P=0.02) (Fig. 3) .



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Time course of changes in GSH and GSSG induced by pyrogallol in cultures of BET1A cells. BET1A cells were exposed to 100 µM of pyrogallol for varying times. Supernatant (upper panel) and cells (lower panel) were harvested simultaneously for determination of GSH and GSSG in the extracellular and intracellular compartments. Values are means and SD of a minimum of 3 experiments.

Levels of GSH in culture (µM) are several orders of magnitude lower in comparison to physiological levels (mM) (4 , 5) ; thus, we supplemented GSH in tissue culture media to investigate effects of ROS in more physiological conditions. The 10 mM levels of GSH alone had no effect on the eGPx gene expression. However, a combination of 100 µM pyrogallol with GSH for 24 h strikingly augmented gene induction (P<0.001) (Fig. 4 ), although 10 mM of GSSG did not affect pyrogallol induction of eGPx.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. Potentiation of ROS induction of eGPx by GSH. BET1A cells were cultured in the presence of combinations of pyrogallol, GSH, and GSSG for 24 h. Representative Northern analysis of total RNA (10 µg/lane) demonstrates that the combination GSH/pyrogallol significantly increased the eGPx mRNA expression (lane 6). Relative units of eGPx mRNA/GAPDH (means±SD) for 3 experiments are shown.

Increase in extracellular GPx protein and activity
To investigate whether the induction of eGPx mRNA leads to increased eGPx protein and activity, BET1A cells were exposed to pyrogallol, GSH, and a combination of pyrogallol and GSH for 24 and 48 h. The eGPx protein was not detectable intracellularly. However, the overlying media had a significant increase of the eGPx protein by pyrogallol or combination of GSH and pyrogallol [eGPx protein (ng/106 cells) mean ± SD: baseline <0.125; pyrogallol, 0.4 ± 0.17; pyrogallol and GSH, 0.5 ± 0.2; P<0.05]. Furthermore, the extracellular GPx activity increased after stimulation of pyrogallol, and in combination with GSH led even to higher levels of activity. However, the intracellular GPx activity was not induced by ROS (Fig. 5 ). Thus, the induction of the eGPx mRNA resulted in increased extracellular activity and protein.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. : Increase of extracellular GPx activity by ROS. BET1A cells were exposed to 100 µM pyrogallol or combination of pyrogallol and GSH (10 mM) for various times. Supernatant and the cells were harvested simultaneously for determination of GPx activity in the extracellular and intracellular compartments. A) Increased GPx activity in the extracellular compartment is noted at 24 h (P<0.001) and 48 h (P=0.001). B) In contrast to extracellular Gpx, intracellular GPx activity at 48 h did not increase (P>0.2). Values are means and SD of 3 experiments.

Overexpression of SOD abrogates eGPx mRNA induction
To determine the primary ROS (i.e., superoxide or hydrogen peroxide involved in the induction of the eGPx gene), we infected the BET1A cells with AdSOD and/or catalase (AdCL) (28) , which are known to induce the expression and activity of SOD more than 14-fold, and catalase more than 16-fold (28) . Null virus (AdNull) or AdCL did not prevent induction of eGPx in BET1A cells. In contrast, the eGPx mRNA induction in cells was significantly inhibited by AdSOD (P=0.02) (Fig. 6 ). These data suggest that eGPx gene induction is dependent in part on intracellular superoxide levels.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. Inhibition of eGPx mRNA induction by adenovirus-mediated transfer of Cu, ZnSOD. Cells were incubated with the control adenovirus (AdNull), vector encoding the human catalase cDNA (AdCL), or vector encoding the human Cu,Zn-SOD cDNA (AdSOD) at MOI of 10/cell in the presence or absence of GSH and pyrogallol for 24 h. eGPx expression was evaluated by Northern analysis (10 µg/lane). The eGPx mRNA normalized to GAPDH is summarized relative to maximal induction by GSH and pyrogallol. Means and SD of a minimum of 3 experiments are shown.

eGPx mRNA half-life
Increases in mRNA may occur at the level of transcription or RNA stability, thus eGPx mRNA stability was evaluated in BET1A cells. An inhibitor of RNA synthesis, actinomycin D (AD) prevented pyrogallol induction of eGPx mRNA supporting a transcriptional mechanism [eGPx mRNA/GAPDH relative to baseline eGPx expression (mean±SD): pyrogallol, 2.7 ± 0.02; pyrogallol and AD, 0.8 ± 0.07; P=0.001 (Fig. 7A )]. The eGPx mRNA half-life determined in BET1A cells was prolonged but not affected by ROS [half-life: unstimulated, 34 ± 8 h; GSH/pyrogallol stimulation, 32 ± 9 h (Fig. 7B )]. Based on these results, we investigated the regulation of eGPx transcription.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Half-life of eGPx mRNA in BET1A cells. A) BET1A cells were cultured in the presence and absence of actinomycin D (3 µg/ml) and stimulated with 100 µM pyrogallol for 24 h. Total RNA (10 µg/lane) was subjected to Northern analysis with 32P-labeled eGPx cDNA and GAPDH cDNA as control for RNA loading (lanes 4–6). Exposure to pyrogallol with AD (lane 2) shows no induction of the eGPx gene, whereas pyrogallol (lane 3) alone induces eGPx mRNA. B) BET1A cells cultured in the absence (open circles) and in the presence of GSH (10 mM) and pyrogallol (100 µM) (filled circles) for 24 h. Cells were collected at the times (h) indicated after addition of actinomycin D (3 µg/ml) to block new mRNA synthesis and determine mRNA half-life. Values are means and SD of a minimum of 3 experiments.

Analysis of 5' flanking sequence of the human eGPx gene defines region of promoter responsible for gene activation
Comparison of the 5' flanking region of eGPx promoter with the known sequence (10) revealed 15 insertions, 7 deletions, and 4 mismatches (Genbank accession #AF285633). To test whether the eGPx promoter was responsible for ROS inducibility, a genomic fragment of 3.2 kb, including 5' upstream sequences and part of the cDNA sequence, was placed 5' to a firefly luciferase reporter gene, and its capacity to direct firefly luciferase synthesis was compared to a series of deletion mutant constructs in BET1A cells. Cells were transfected and exposed to oxidant stress of GSH and pyrogallol for 24 h. All constructs had low levels of promoter activity in the absence of ROS. The region between -1003 bp and -652 bp led to 45-fold increase in the eGPx promoter activity with ROS (Fig. 8 ).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. Promoter activity of the eGPx gene 5' flanking region. Levels of firefly luciferase expression by fusion gene constructs of eGPx 5' flanking region and a luciferase reporter gene are shown relative to the expression of the renilla luciferase reporter gene. Each point is the average of 3 independent transfection experiments. Promoter function analyses were carried out with BET1A cells incubated with and without GSH/pyrogallol stimulus. Normalized luciferase activity is summarized in the graph, with means and SD of a minimum of 3 experiments shown.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The airway epithelium is an important cellular barrier between the lung parenchyma and the surface epithelial lining fluid. Therefore, these cells are immediately and directly exposed to any change in the redox environment on the airway surface, which makes them especially susceptible to environmental oxidative damage. The presence of eGPx and other extracellular antioxidants on the airway surface undoubtedly protects the lung from external oxidizing damage. Similarly, eGPx serves an important antioxidant role in many other extracellular surfaces and spaces (9 , 30 31 32 33 34 35 36) . Specifically, eGPx transcripts have been demonstrated in epithelial cells with well-developed brush borders, e.g., visceral yolk sac, the intestine, and the S1 and S2 segments of the renal tubules (9 , 10 , 31) . The human airway epithelium expresses and secretes eGPx into the apical surface lining fluid (9) . We have recently shown that eGPx in ELF obtained from lungs of cigarette smoking individuals is higher than in nonsmoking controls, which suggests that the airway has the capacity to increase eGPx in response to inhalation of exogenous ROS (4) . Here, increases of eGPx are demonstrated in asthmatic airways that have increased endogenous generation of ROS.

Asthma is a condition characterized by chronic airway inflammation (15 16 17 18 19 20 21) . Inflammatory and epithelial cells in asthmatic lungs generate increased amounts of ROS that correlate with disease severity (15 16 17 18 19 20 21 , 35) . Asthmatics also have increased nitric oxide (NO) and RNS in the airway due to increased NO synthesis by epithelial cells. NO and superoxide rapidly react to form RNS, which modify tyrosine in proteins by numerous complex mechanisms to create nitrotyrosine, allowing nitrotyrosine to be used as a collective marker of RNS and ROS (15 , 22 , 36 , 37) . Despite a clear increase of oxidative and nitrosative stress in the asthmatic airway, intracellular antioxidant enzymes are not increased (1 , 2 , 20) . In fact, asthmatic lung cells have catalase and GPx levels similar to controls and decreased levels of SOD (1 , 2) . Although eGPx protein is increased in asthmatic ELF in this study, total glutathione peroxidase activity in asthmatic ELF previously has not been different from controls (20) . This may reflect that eGPx accounts for only 57% of the total glutathione peroxidase activity in ELF, with the remainder of activity derived from cellular GPx (9) . Furthermore, NO, which is increased in asthma, is capable of inactivating GPx (38 , 39) .

Expression of eGPx mRNA in bronchial epithelial cells in healthy controls indicates that eGPx synthesis and secretion into ELF occur in part by the bronchial epithelial cells. The eGPx protein in ELF may also be due in part to eGPx expression by alveolar macrophages (9) . For example, eGPx is expressed in macrophages and is increased with oxidant stress of cigarette smoke (40) . However, the striking increase of eGPx mRNA in asthmatic bronchial epithelial cells provides clear evidence that these cells are also the source of the increased eGPx in ELF. Parallel to in vivo findings, bronchial epithelial cells significantly increase eGPx mRNA expression in response to increased intracellular or extracellular ROS in vitro. Rapid changes in GSH and GSSG in cells and in the overlying supernatant occur after ROS exposure, verifying alterations in the redox environment. Similarly, alterations of GSH and GSSG in asthmatic airways have been reported by us and others in previous studies (1 2 3 , 20 , 41) . Rapid induction of intracellular GSH is a known response to oxidative stress (42 , 43) and a critical determinant of cellular tolerance to oxidizing environments (43) . In the present study, exposure to pyrogallol caused a transient depletion of GSH, followed later by a prolonged elevation in intracellular GSH levels. Other protective responses to oxidative stress include uptake of GSH into cells (45 , 46) and export of the oxidized form to overcome an accumulation of GSSG within the cytosol. Studies have shown that a 24 h exposure to ROS increases GSH through induction of {gamma}-glutamylcysteine synthetase ({gamma}-GCS) (43 , 44) .

Since glutathione is a critical cofactor for eGPx activity, coordinate induction of this coupled system is likely necessary for efficient antioxidant defense. For example, previous studies have shown a positive correlation between the eGPx protein and GSH levels in ELF from cigarette smokers (4) . Based on this, and because glutathione in cell culture media is more than 100-fold less than in ELF, we tested whether augmentation of glutathione levels would influence the ROS induction of eGPx. Physiological levels of GSH potentiated the effect of ROS on eGPx expression. Overexpression of SOD prevented the induction of eGPx, suggesting the importance of superoxide in eGPx induction. Moreover, the lack of effect on eGPx induction by catalase overexpression indicates that hydrogen peroxide or RNS are less likely key mediators of eGPx induction.

Usually considered an antioxidant, physiological levels of GSH potentiated the effect of ROS on eGPx expression, which may be due to GSH participation in oxidative processes (47 48 49 50) . In the generation of ROS through autocatalytic processes (i.e., pyrogallol), GSH does not inhibit production of superoxide, but rather promotes the formation of oxidizing species by facilitating autoxidation. At low levels of GSH, autoxidation of compounds is less rapid and initiated by molecular oxygen, which leads to superoxide. However, GSH in the range of 100-1000 µM leads to a dose-dependent increase in oxygen uptake during autoxidation of alloxan, a pyrimidine compound (48) . GSH is oxidized to glutathionyl during autocatalytic reactions, which subsequently generate superoxide:

In support of this reaction mechanism, SOD inhibits oxygen uptake and GSH oxidation by alloxan (48) . Similarly, GSH may interact in the cyclic process that leads to pyrogallol autoxidation, accelerates free radical production, and subsequently potentiates the oxidant induction of eGPx. Alternatively, recent work suggests that GSH is essential to efficiently transduce oxidative stress into a functional response at the transcriptional level by S-glutathiolation of redox-sensitive transcription factors (51) . For example, the oxidant-sensitive cysteine in the DNA binding site of c-Jun, a component of the activator protein 1 (AP-1) transcription factor, undergoes reversible S-glutathiolation during oxidative stress in the presence of physiological levels of GSH. Thus, GSH may potentiate the transcriptional response to oxidative processes inside the cell through several mechanisms.

The regulation of genes in response to ROS may occur via transcription and/or stabilization of mRNA (11 12 13 14 , 51 , 52) . Our results show that eGPx mRNA stability is not affected by ROS. In contrast, the 5' flanking region of the human eGPx gene, which contains the consensus element for AP-1, is exquisitely ROS inducible. Studies from a number of laboratories have demonstrated that ROS induce transcription by the activation of redox-regulated transcription factors, e.g., AP-1 (11 12 13 14) . For example, the transcriptional induction of {gamma}-GCS by ROS is related to activation of AP-1 (44) .

Together with the finding of increased ROS and eGPx expression in asthmatic lungs, the eGPx induction in respiratory epithelial cells by ROS in vitro provides strong support for an oxidative mechanism of eGPx gene induction in the asthmatic airway epithelium. Based on this, we propose the following molecular mechanism of eGPx gene induction in asthma. Increased ROS formation by inflammatory and epithelial cells in the lung leads to alterations in the intracellular and extracellular reducing/oxidizing environment, i.e., GSH/GSSG levels. Loss of SOD antioxidant activity is present in asthma and favors increased superoxide and RNS formation. The high level of oxidative and nitrosative stress leads subsequently to induction of eGPx mRNA transcription, protein expression, and secretion into ELF. Since susceptibility of cells to ROS depends largely on the ability to up-regulate protective antioxidant systems (51) , increased eGPx is undoubtedly an important defense against oxidative injury to the airway surface of asthmatic individuals.


   ACKNOWLEDGMENTS
 
The authors thank R. Dweik and R. Piccin for clinical assistance, H. DeRaeve and M. Lewis for technical assistance, C. Harris for BET1A, and J. Lang for artwork. This work was supported by National Institutes of Health grant #HL 60917.

Received for publication March 6, 2000. Revision received June 1, 2000.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. De Raeve, H. R., Thunnissen, F. B. J. M., Kaneko, F. T., Guo, F. H., Lewis, M., Kavuru, M. S., Secic, M., Thomassen, M. J., Erzurum, S. C. (1997) Decreased of Cu,Zn-SOD activity in asthmatic airway epithelium: correction by inhaled corticosteroid in vivo. Am. J. Physiol. 272,L148-L154[Abstract/Free Full Text]
  2. Smith, L. J., Shamsuddin, M., Sporn, P. H. S., Denenberg, M., Anderson, J. (1996) Reduced superoxide dismutase in lung cells of patients with asthma. Free Radic. Biol. Med 95,1301-1308
  3. Smith, L. J., Houston, M., Anderson, J. (1993) Increased levels of glutathione in bronchoalveolar lavage fluid form patients with asthma. Am. Rev. Resp. Dis. 147,1461-1464[Medline]
  4. Comhair, S. A. A., Lewis, M. J., Bhathena, P. R., Hammel, J. P., Erzurum, S. C. (1999) Increased glutathione and glutathione peroxidase in lung of individuals with chronic beryllium disease. Am. J. Crit. Care Med. 159,1824-1829[Abstract/Free Full Text]
  5. Cantin, A. M., North, S. L., Hubbard, R. C., Crystal, R. G. (1987) Normal alveolar epithelial lining fluid contains high levels of glutathione. J. Cell. Physiol. 63,152-157
  6. Ren, B., Huang, W., Ajesson, B., Ladenstein, R. (1997) The crystal structure of seleno-glutathione peroxidase from human plasma at 2.9 A resolution. J. Mol. Biol. 268,869-885[Medline]
  7. Hou, Y., Guo, R., Li, J., Wang, P. G. (1996) Seleno compounds and glutathione peroxidase catalyzed decomposition of S-nitrosothiols. Biochem. Biophys. Res. Commun. 228,88-93[Medline]
  8. Siest, J., Sharov, V. S., Klots, L., Briviba, K. (1997) Glutathione peroxidase protects against peroxynitrite-mediated oxidations. J. Biol. Chem. 44,278145-227817
  9. Avissar, N., Finkelstein, J. N., Horowits, S., Willey, J. C., Coy, E., Frampton, M. W., Watkins, R. H., Khullar, P., Xu, Y., Cohen, H. J. (1996) Extracellular glutathione peroxidase in human lung epithelial lining fluid and in lung cells. Am. J. Physiol. 270,L173-L182[Abstract/Free Full Text]
  10. Kingsley, P. D., Whitin, J. C., Cohen, H. J., Palis, J. (1998) Development expression of extracellular glutathione peroxidase suggests antioxidant roles in deciduum, visceral yolk sac, and skin. Mol. Reprod. Dev. 49,343-355[Medline]
  11. Pinkus, R., Weiner, L. M., Daniel, V. (1996) Role of oxidants and antioxidants in the induction of AP-1, NF-{kappa}B, and glutathione S-transferase gene expression. J. Biol. Chem. 271,13422-13429[Abstract/Free Full Text]
  12. Sen, C. K., Packer, L. (1996) Antioxidant and redox regulation of gene transcription. FASEB J 10,709-720[Abstract]
  13. Klatt, P., Molina, E. P., Garcia de Lacobra, M., Padilla, C. A., Martinez-Galisteo, E., Barcena, J. A., Lamas, S. (1999) Redox regulation of c-jun DNA binding by reversible S-glutathiolation. FASEB J 13,1481-1490[Abstract/Free Full Text]
  14. Sun, Y., Oberley, L. W. (1996) Redox regulation of transcriptional activators. Free Radic. Biol. Med. 21,335-348[Medline]
  15. Saleh, D., Ernest, P., Lim, S., Barnes, P. J., Giaid, A. (1998) Increased formation of the potent oxidant peroxynitrite in the airways of asthmatic patients is with induction of nitric oxide synthase: effect of inhaled glucocorticoid. FASEB J 12,929-937[Abstract/Free Full Text]
  16. Kanazawa, H., Kurihara, N., Hirata, K., Takeda, T. (1991) The role of free radicals in airway obstruction in asthmatic patients. Chest 100,1319-1322[Abstract/Free Full Text]
  17. Hamid, Q., Springall, D., Riveros-Moreno, V., Chanez, P., Hawrth, P., Redington, A., Bousquet, J., Godard, P., Holgate, S., Polak, J. M. (1993) Induction of nitric oxide synthase in asthma. Lancet 342,1510-1513[Medline]
  18. Jobsis, Q., Raatgeep, H. C., Hermans, P. W. M., de Jongste, J. C. (1997) Hydrogen peroxide in exhaled air is increased in stable asthmatic children. Eur. Resp. J. 10,519-521[Abstract]
  19. Kharitinov, S. A., Yates, D., Robbins, R. A., Logen-Sinclair, R., Shinebourne, E. A., Barnes, P. J. (1994) Increased nitric oxide in exhaled air of asthmatic patients. Lancet 343,133-135[Medline]
  20. Comhair, S. A. A., Bhatena, P., Dweik, R., Kavuru, M., Erurum, S. C. (2000) Rapid loss of superoxide dismutase activity during antigen-induced asthmatic response. Lancet 355,624[Medline]
  21. Calhoun, W. J., Reed, H. E., Moest, D. R., Stevens, C. A. (1992) Enhanced superoxide production by alveolar macrophages density and air-space cells, airway inflammation, and alveolar macrophages density changes after segmental antigen bronchoprovocation in allergic subjects. Am. Rev. Resp. Dis. 145,317,325
  22. Van der Vliet, A., Eiserich, J. P., Shigenaga, M. K., Cross, C. E. (1999) Reactive nitrogen species and tyrosine nitration in the respiratory tract. Am. J. Resp. Crit. Care Med. 160,1-9[Free Full Text]
  23. . National Asthma Education and Prevention Program (1997) Guidelines for the diagnosis and the Management of Asthma, Expert Panel Report II. National Asthma Education and Prevention Program. National Institutes of Health, Bethesda, Md., Publication 97,7809
  24. Guo, F. H., Uetani, K., Haque, S. J., Williams, B. R. G., Dweik, R. A., Thunissen, F. B. J. M., Calhoun, W., Erzurum, S. C. (1997) Interferon gamma and interleukin 4 stimulate prolonged expression of inducible nitric oxide synthase in human airway epithelium though synthesis of soluble mediators. J. Clin. Invest. 100,829-839[Medline]
  25. Marklund, S. L., Marklund, G. (1974) Involvement of the superoxide anion radical in the autotoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47,469-474[Medline]
  26. Adams, J. D., Lauterburg, B. H., Mitchell, J. R. (1983) Plasma glutathione and glutathione disulfide in the rat: regulation and response to oxidative stress. J. Pharmacol. Exp. Ther. 227,749-754[Abstract/Free Full Text]
  27. Pietarinen-Runtii, P., Raivio, K. O., Saksela, M., Asikainen, T. M., Kinnula, V. L. (1998) Antigen enzyme regulation and resistance to oxidants of human bronchial epithelial cells cultured under hyperoxia conditions. Am. J. Resp. Cell. Mol. Biol. 19,286-292[Abstract/Free Full Text]
  28. Danel, C., Erzurum, S. C., Prayssac, P., Eissa, N. T., Crystal, R. G., Herve, P., Baudet, B., Mazmanian, M., Lemarchand, P. (1998) Gene therapy for oxidant injury-related diseases: Adenovirus-Mediated transfer of superoxide dismutase and catalase cDNAs protects against hyperoxia but not against ischemia-reperfusion lung injury. Human Gene Ther 9,1487-1496[Medline]
  29. Yoshimura, S., Suemizu, H., Taniguchi, Y., Arimori, K., Kawabe, N., Moriuchi, T. (1994) The human plasma glutathione peroxidase-encoding gene: organization, sequence and localization to chromosome 5q32. Gene 145,293-297[Medline]
  30. Avisser, N., Slemmin, J. R., Palmer, I. S., Cohen, H. J. (1991) Partial sequence of human plasma glutathione peroxidase and immunologic identification of milk glutathione peroxidase as the plasma enzyme. J. Nutr. 121,1243-1249
  31. Chu, F., Esworthy, R. S., Doroshow, J. H., Doan, K., Liu, X. (1992) Expression of plasma glutathione peroxidase in human liver in addition to kidney, heart, lung and breast in humans and rodents. Blood 79,3233-3238[Abstract/Free Full Text]
  32. Howie, A. F., Walker, S. W., Akesson, B., Arthur, J. R., Beckett, G. J. (1995) Thyroidal extracellular glutathione peroxidase: a potential regulator of thyroid-hormone synthesis. Biochem. J. 308,713-717
  33. Avisser, N., Ornt, D. B., Yagil, Y., Horowitz, S., Watkins, R. H., Kerl, E. A., Takahashi, K., Palmer, I. S., Cohen, H. J. (1994) Human kidney proximal tubulus are the main source of plasma glutathione peroxidase. Am. J. Physiol. 266,C367-C375[Abstract/Free Full Text]
  34. Tham, D. M., Whitin, J. C., Kim, K. K., Zhu, S. X., Cohen, H. J. (1998) Expression of extracellular glutathione peroxidase in human and mouse gastrointestinal tract. Am. J. Physiol. 275,G1463-G1473[Abstract/Free Full Text]
  35. Polito, A. J., Proud, D. (1998) Epithelial cells as regulators of airway inflammation. J. Allergy Clin. Immunol. 102,714-718[Medline]
  36. Arteel, G. E., Briviba, K., Sies, H. (1999) Protection against peroxynitrite. FEBS Lett 445,226-230[Medline]
  37. Kaminsky, D. A., Mitchell, J., Carroll, N., James, A., Soultanakis, R., Janssen, Y. (1999) Nitrotyrosine formation in the airways and lung parenchyma of patients with asthma. J. Allergy Clin. Immunol. 104,747-754[Medline]
  38. Asahi, M., Fujii, J., Suzuki, K., Seo, H. G., Kuzuya, T., Hori, M., Tada, M., Fujii, S., Taniguchi, N. (1995) Inactivation of Glutathione peroxidase by nitric oxide. J. Biol. Chem. 36,21035-21039
  39. Asahi, M., Fujii, J., Takao, T., kuzuya, T., Hori, M., Shimonishi, Y., Taniguchi, N. (1997) The oxidation of selenocysteine in involved in the inactivation of glutathione peroxidase by nitric oxide donor. J. Biol. Chem. 272,19152-19157[Abstract/Free Full Text]
  40. Comhair, S. A. A., Thomassen, M. J., Erzurum, S. C. (2000) Differential Induction of extracellular glutathione peroxidase and nitric oxide synthase 2 in airways of healthy individuals exposed to 100% O2 or cigarette smoke. Resp. Cell. Mol. Biol. 23,350-354
  41. Kelly, F. J., Mudway, I., Blomberg, A., Frew, A., Sandstrom, T. (1999) Altered lung antioxidant status in patients with mild asthma. Lancet 354,9177
  42. Rahman, I., Bel, A., Mulier, B., Donaldson, K., MacNee, W. (1998) Differential regulation of glutathione by oxidants and dexamethasone in alveolar epithelial cells. Am. J. Physiol. 275,L80-L86[Abstract/Free Full Text]
  43. Rahman, I., Antonicelli, F., MacNee, W. (1999) Molecular mechanisms of the regulation of glutathione synthesis by tumor necrosis factor-{alpha} and dexamethasone in human alveolar epithelial cells. J. Biol. Chem. 274,5088-5096[Abstract/Free Full Text]
  44. Rahman, I., Smith, C. A. D., Lawson, M. F., Harrison, D. J., MacNee, W. (1996) Induction of gamma glutamylcysteine synthetase by cigarette smoke is associated with AP1 in human alveolar epithelial cells. FEBS Lett 393,21-25
  45. Deneke, S. M., Fanburg, B. L. (1989) Regulation of cellular glutathione. Am. J. Physiol. 257,L163-L173[Abstract/Free Full Text]
  46. Meister, A., Anderson, M. E. (1983) Glutathione. Annu. Rev. Biochem. 52,711-760[Medline]
  47. Winterbourn, C. C. (1993) Superoxide as an intracellular radical sink. Free Radic. Biol. Med. 14,85-90[Medline]
  48. Winterbourn, C. C., Munday, R. (1989) Glutathione-mediated redox cycling of alloxan. Biochem. Pharm. 38,271-277[Medline]
  49. Thomas, E. L., Learn, D. B., Jefferson, M. M., Weatherred, W. (1988) Superoxide-dependent oxidation of extracellular reducing agents by isolated Neutrophils. J. Biol. Chem. 263,2178-2186[Abstract/Free Full Text]
  50. Misso, N. L. A., Peacock, C. D., Watkin, N., Thompson, P. J. (2000) Nitrite generation and antioxidant effects during neutrophil apoptosis. Free Radic. Biol. Med. 28,934-943[Medline]
  51. Cheng, W. H., Fu, Y. X., Porres, J. M., Ross, D. A., Lei, X. G. (1999) Selenium-dependent cellular glutathione peroxidase protects mice against a pro-oxidant-induced oxidation of NADPH, NADH, lipids, and protein. FASEB J 13,1467-1475[Abstract/Free Full Text]
  52. Malter, J. S., Hong, Y. (1991) A redox switch and phosphorylation are involved in the posttranslational up-regulation of the adenosine-uridine binding factor by phorbol ester and ionophore. J. Biol. Chem. 266,3167-3171[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Liu, D. Xu, L. Liu, F. Schain, A. Brunnstrom, M. Bjorkholm, H.-E. Claesson, and J. Sjoberg
15-Lipoxygenase-1 induces expression and release of chemokines in cultured human lung epithelial cells
Am J Physiol Lung Cell Mol Physiol, July 1, 2009; 297(1): L196 - L203.
[Abstract] [Full Text] [PDF]


Home page
Ann Clin BiochemHome page
A. M Hassan
Selenium status in patients with aspirin-induced asthma
Ann Clin Biochem, September 1, 2008; 45(5): 508 - 512.
[Abstract] [Full Text] [PDF]


Home page
Ther Adv Respir DisHome page
A. Nadeem, A. Masood, and N. Siddiqui
Review: Oxidant--antioxidant imbalance in asthma: scientific evidence, epidemiological data and possible therapeutic options
Therapeutic Advances in Respiratory Disease, August 1, 2008; 2(4): 215 - 235.
[Abstract] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Abdala-Valencia, J. Earwood, S. Bansal, M. Jansen, G. Babcock, B. Garvy, M. Wills-Karp, and J. M. Cook-Mills
Nonhematopoietic NADPH oxidase regulation of lung eosinophilia and airway hyperresponsiveness in experimentally induced asthma
Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1111 - L1125.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. L. Reynaert, S. W. Aesif, T. McGovern, A. Brown, E. F. M. Wouters, C. G. Irvin, and Y. M. W. Janssen-Heininger
Catalase Overexpression Fails to Attenuate Allergic Airways Disease in the Mouse
J. Immunol., March 15, 2007; 178(6): 3814 - 3821.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
N. L. Reynaert, E. F. M. Wouters, and Y. M. W. Janssen-Heininger
Modulation of Glutaredoxin-1 Expression in a Mouse Model of Allergic Airway Disease
Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 147 - 151.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Chambellan, P. J. Cruickshank, P. McKenzie, S. B. Cannady, K. Szabo, S. A. A. Comhair, and S. C. Erzurum
Gene Expression Profile of Human Airway Epithelium Induced by Hyperoxia In Vivo
Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 424 - 435.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Ghosh, A. J. Janocha, M. A. Aronica, S. Swaidani, S. A. A. Comhair, W. Xu, L. Zheng, S. Kaveti, M. Kinter, S. L. Hazen, et al.
Nitrotyrosine Proteome Survey in Asthma Identifies Oxidative Mechanism of Catalase Inactivation
J. Immunol., May 1, 2006; 176(9): 5587 - 5597.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
V L Kinnula
Focus on antioxidant enzymes and antioxidant strategies in smoking related airway diseases
Thorax, August 1, 2005; 60(8): 693 - 700.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. A. A. Comhair, K. S. Ricci, M. Arroliga, A. R. Lara, R. A. Dweik, W. Song, S. L. Hazen, E. R. Bleecker, W. W. Busse, K. F. Chung, et al.
Correlation of Systemic Superoxide Dismutase Deficiency to Airflow Obstruction in Asthma
Am. J. Respir. Crit. Care Med., August 1, 2005; 172(3): 306 - 313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. A.A. Comhair, W. Xu, S. Ghosh, F. B.J.M. Thunnissen, A. Almasan, W. J. Calhoun, A. J. Janocha, L. Zheng, S. L. Hazen, and S. C. Erzurum
Superoxide Dismutase Inactivation in Pathophysiology of Asthmatic Airway Remodeling and Reactivity
Am. J. Pathol., March 1, 2005; 166(3): 663 - 674.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Bierl, B. Voetsch, R. C. Jin, D. E. Handy, and J. Loscalzo
Determinants of Human Plasma Glutathione Peroxidase (GPx-3) Expression
J. Biol. Chem., June 25, 2004; 279(26): 26839 - 26845.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
G Caramori and A Papi
Oxidants and asthma
Thorax, February 1, 2004; 59(2): 170 - 173.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. KUMAR, S. LNU, R. MALYA, D. BARRON, J. MOORE, D. B. CORRY, and A. M. BORIEK
Mechanical stretch activates nuclear factor-kappaB, activator protein-1, and mitogen-activated protein kinases in lung parenchyma: implications in asthma
FASEB J, October 1, 2003; 17(13): 1800 - 1811.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. El-Chemaly, M. Salathe, S. Baier, G. E. Conner, and R. Forteza
Hydrogen Peroxide-Scavenging Properties of Normal Human Airway Secretions
Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 425 - 430.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
T. Harju, R. Kaarteenaho-Wiik, Y. Soini, R. Sormunen, and V. L. Kinnula
Diminished Immunoreactivity of {gamma}-Glutamylcysteine Synthetase in the Airways of Smokers' Lung
Am. J. Respir. Crit. Care Med., September 1, 2002; 166(5): 754 - 759.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. A. A. Comhair and S. C. Erzurum
Antioxidant responses to oxidant-mediated lung diseases
Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L246 - L255.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by COMHAIR, S. A. A.
Right arrow Articles by ERZURUM, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by COMHAIR, S. A. A.
Right arrow Articles by ERZURUM, S. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS