HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by SMITH, U. Articles by SVALSTEDT, B. Search for Related Content PubMed PubMed Citation Articles by SMITH, U. Articles by SVALSTEDT, B.

Thiazolidinediones (PPAR agonists) but not PPAR agonists increase IRS-2 gene expression in 3T3-L1 and human adipocytes¹

The Lundberg Laboratory for Diabetes Research, Department of Internal Medicine, Goteborg University, Sahlgrenska University Hospital, S-413 45 Goteborg, Sweden

²Correspondence: The Lundberg Laboratory for Diabetes Research, Department of Internal Medicine, Sahlgrenska University Hospital, Guldhetsgatan, Gothenburg S-413 45 Goteborg, Sweden. E-mail. ulf.smith{at}medic.gu.se

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Thiazolidinediones (TZD) improve insulin sensitivity in human as well as in different animal models of insulin resistance and Type 2 diabetes. However, no clear link to the insulin signaling events has been identified. Using differentiated 3T3-L1 adipocytes, we found that TZD rapidly and markedly increased IRS-2 gene expression. This effect was specific for PPAR agonists and was not seen with PPAR agonists. It was rapidly induced (within 4 h) and maintained throughout the observation period of 48 h. It was also concentration dependent (EC₅₀ 50 nM) and not inhibited by cycloheximide, suggesting a direct effect on the IRS-2 promoter. There was no evidence that TZD altered IRS-2 mRNA stability, supporting that the increased mRNA levels were due to an increased gene transcription. IRS-2 protein expression was increased 30% after 48 h and 50% after 96 h. No effects of TZD were seen on IRS-1, PKB/Akt, or GLUT4 gene expression. TZD also increased IRS-2 mRNA levels in cultured human adipose tissue. These data show the first direct link between TZD and a critical molecule in insulin’s signaling cascade in both 3T3-L1 and human adipocytes, and indicate a novel mode of action of these compounds.—Smith, U., Gogg, S., Johansson, A., Olausson, T., Rotter, V., Svalstedt, B. Thiazolidinediones (PPAR agonists) but not PPAR agonists increase IRS-2 gene expression in 3T3-L1 and human adipocytes.

Key Words: insulin signaling • insulin action • gene transcription • IRS-2 • PPAR

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
THIAZOLIDINEDIONES (TZD) ARE a recently identified class of antidiabetic agents that act by improving insulin sensitivity in various animal models of obesity and diabetes (1 2 3) as well as in humans (4 , 5) . In addition to improving glucose and insulin levels, the circulating free fatty acids (FFA) and triglycerides are also lowered.

TZD promote fat cell differentiation and activate several adipocyte-specific genes such as the fatty acid binding protein aP2 as well as the lipoprotein lipase (6 , 7) . There is much recent evidence that TZD induce their diverse effects by binding to and activating the peroxisome proliferator activated receptor (PPAR) (reviewed in ref 7 ). PPAR is mainly expressed in the adipose tissue and exists as two isoforms: PPAR1 and 2. PPAR1 is the major isoform and accounts for around 85% of that in the adipose tissue. The isoforms differ in their NH₂-terminal end, with PPAR2 having an additional 30 amino acids, and are generated from the same gene by mRNA splicing (8) .

It is currently unclear how TZD improve insulin sensitivity since known PPAR-regulated genes mainly involve adipocyte differentiation, lipid storage, and metabolism (reviewed in ref 7 ).

Current hypotheses of the mechanisms for the direct insulin-sensitizing effect of TZD include the formation of new, small, and insulin-sensitive fat cells (9) ; the inhibition of TNF- production and, hence, its negative effects on insulin signaling (10) ; or, as found in some experiments, increased GLUT4 expression in adipocytes (11) , although this requires activation of C/EBP as well (12) . However, no clear and reproducible link to the intracellular signaling molecules for insulin has been found. Ribon et al. (13) reported a potential link in that TZD were found to increase the gene and protein expression of CAP, a c-Cbl-associated protein that may be involved in the regulation of the tyrosine phosphorylation of c-Cbl by the insulin receptor. c-Cbl, in turn, can interact with the kinase fyn to initiate phosphorylation of caveolin and other sequestered proteins (14) .

In the present study, we examined in differentiated 3T3-L1 adipocytes the effect of PPAR and ligands on the expression of several key molecules for insulin signaling and action: IRS-1, IRS-2, PKB/Akt, and GLUT4. The only gene that was rapidly and reproducibly increased was IRS-2, which was associated with increased protein expression. We also found an increased IRS-2 mRNA expression in human adipose tissue cultured for 24 h with TZD.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell cultures
3T3-L1 fibroblasts were grown and differentiated into adipocytes as described (15) . At least 90% of the cells had acquired the adipocyte phenotype 6 days after initiating differentiation. Eight days after differentiation, medium was changed and the various agents were added for the times indicated in Results. To study the acute effect of insulin, the cells were serum-deprived for 3 h before adding 100 nM insulin for 15 min. Cell lysates were made using previously described procedures (16) .

To examine whether protein synthesis was required for the effect of TZD on gene transcription, 40 µM cycloheximide was present for 8 and 24 h prior to harvesting cells. Furthermore, RNA stability was examined by treating differentiated 3T3-L1 cells with 4 µM actinomycin D, with or without 10 µM pioglitazone, for up to 24 h. Cells were harvested after 2, 4, 6, 12, and 24 h, RNA was extracted, and mRNA for IRS-2 was measured.

In three experiments, small explants (20 mg each) of human subcutaneous adipose tissue (total amount 1 g) were cultured for 24 h in medium 199 containing 5.6 mM glucose, 4% human serum albumin, with or without 10 µM pioglitazone. The tissue culture procedure used has been described in detail (17 18 19) . Two of the subjects were healthy and one individual had Type 2 diabetes treated with an oral sulfonylurea (glibenclamide).

Analyses of RNA
Total cellular RNA was isolated from cells with guanidinium thiocyanate, as described (20) . Northern blot analyses were performed on total cellular RNA (30 µg) with labeled cDNA probes made against ß-actin as housekeeping gene, mouse IRS-1 (bp 1333–2335), mouse IRS-2 (bp 2987–3325) (kindly provided by Drs. J. Pierce and L.-M Wang, NCI, NIH), rodent GLUT4 (bp 121-2128, accession no. NM 001042, kindly provided by Dr. Sam W. Cushman, NIDDK, NIH), and PKB/Akt using a polymerase chain reaction (PCR) fragment against PKBß (bp 282-1130, accession no. M95936) in a common sequence for PKB, PKBß, and PKB. 5' Sequence CGAGAGGCCGCGACCCAACAC and 3' sequence AGGCGGCCGCACATCATCTCGTA were used as PCR primers.

Immunoprecipitations and immunoblotting
Cell lysates were prepared as described (16) . Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred, and immunoblotted with appropriate antibodies against the specific proteins. Phosphotyrosines were immunoblotted with antibody PY99 (Transduction Laboratories, Lexington, Ky.), GLUT4 with an antibody kindly provided by Dr. Sam W. Cushman (NIDDK, NIH), IRS-1 and IRS-2 with antibodies from Upstate Biotechnology (Lake Placid, N.Y.), and PKB/Akt with antibodies from Biolab (Boston, Mass.).

Immunoprecipitations were performed as described (16) ; individual proteins were detected by blotting with horseradish peroxidase-linked secondary antibodies and using enhanced chemiluminescence (Amersham, Amersham, U.K.).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Effects of PPAR agonists and/or insulin on IRS-1/2, PKB/Akt, and GLUT4 gene and IRS-2 protein expression
The expression of several genes involved in insulin signaling and action was examined after 4–48 h exposure to different concentrations of pioglitazone (pio). However, only the IRS-2 gene expression was consistently increased. The IRS-2 mRNA included a major 7.2 kb band, but a minor band at 8.2 kb was seen frequently. It is not clear whether this represents alternative splicing of the same gene.

Figure 1A (top) shows that insulin alone did not change IRS-2 gene expression whereas the addition of pioglitazone increased IRS-2 mRNA fourfold. This was due to an effect of pioglitazone alone, and no further increase was seen by the addition of insulin (Fig. 1A , bottom). After 48 h, the IRS-2 mRNA levels were consistently increased three- to fivefold relative to ß-actin mRNA (Fig. 1B , top). IRS-2 protein expression was also increased by pio but not changed by insulin (Fig. 1B , bottom). The average increase seen after 48 h with pio was 30% (n=3) whereas IRS-2 was increased 50% after 96 h. Figure 1B (bottom) also shows the mobility shift in IRS-2 after acute stimulation (10 min) with 100 nM insulin of cells that had been serum-starved for 3 h.

View larger version (69K): [in this window] [in a new window]   Figure 1. A) Top: IRS-2 mRNA expression (Northern blots) in differentiated 3T3-L1 adipocytes cultured for 48 h with no additions (bas), 100 nM insulin (ins), or 10 µM pioglitazone (pio) in combination with 100 nM insulin. ß-actin mRNA is also shown for the same cells. Bottom: IRS-2 mRNA levels from cells cultured for 48 h with no additions (bas), with 10 µM pioglitazone (pio) with or without 100 nM insulin (pio + ins). B) Top: Individual data from 5 experiments where IRS-2 mRNA was related to ß-actin gene expression in the same cells (arbitrary units). Bars represent mean values. Bottom: IRS-2 protein expression in differentiated 3T3-L1 cells cultured for 48 h (middle) with no additions (bas), with 100 nM insulin (ins), or with 10 µM pioglitazone (pio) or for 96 h (bottom) with no additions (bas) or with 10 µM pioglitazone. The cells were then serum-starved for 3 h before insulin (ins) was added at 100 nM for 10 min. C) Time course for IRS-2 mRNA expression in differentiated 3T3-L1 adipocytes cultured with 10 µM pioglitazone for the indicated times. The values represent % increase over unstimulated control cells and are the means of two experiments.

Time course experiments showed that the gene expression was already increased after 4 h, peaked after 24 h, but remained elevated throughout the 48 h observation time (Fig. 1C ). This increase was specific for IRS-2 and remained whether the IRS-2 expression was related to ß-actin, IRS-1, or PKB mRNA levels (data not shown). We also examined whether the rapid effect of pio was direct or required protein synthesis by adding cycloheximide (40 µM) to the incubation medium for 8 and 24 h. However, pio also increased IRS-2 mRNA expression in the presence of cycloheximide, suggesting a direct effect of pio on the IRS-2 gene (not shown). We also verified that IRS-2 mRNA stability was not altered by TZD, since incubating the cultured cells with 4 µM actinomycin D for different time periods up to 24 h did not prolong IRS-2 mRNA half-life whether or not 10 µM pio was present (data not shown). IRS-2 mRNA expression was also increased fivefold in human adipose tissue by pio (10 µM) after 24 h (Fig. 2 ).

View larger version (45K): [in this window] [in a new window]   Figure 2. Explants of abdominal s.c. adipose tissue were cultured for 24 h with no additions (bas) or with 10 µM pioglitazone (pio). IRS-2 and ß-actin mRNA were then measured.

We also examined whether a lower pio concentration increased IRS-2 mRNA expression in 3T3-L1 adipocytes. A similar effect was seen with 1 µM pio (average increase 230%, n=2) as with 10 µM in the same experiments (average increase 292%, n=2), and detailed analysis showed that EC₅₀ was 50 nM. Darglitazone, another PPAR ligand, induced a similar increase as pioglitazone (Fig. 3 , top) whereas a specific PPAR ligand (WY14643) was completely without effect (average increase 9%, n=2), even at a high concentration (10 µM) and when insulin was added (Fig. 3 , middle). Thus, these data show that PPAR, but not PPAR, ligands increase IRS-2 gene expression in 3T3-L1 adipocytes. We also tested whether progesterone or 8-BrcAMP, which have been shown to increase IRS-2 gene expression in HeLa cells (21) , also altered the expression in 3T3-L1 cells. However, no effects were seen even with high concentrations of these agents. When combined, however, the stimulating effect of pio was again shown (Fig. 3 , bottom).

View larger version (76K): [in this window] [in a new window]   Figure 3. Top: IRS-2 mRNA in differentiated 3T3-L1 adipocytes cultured for 48 h with 100 nM insulin (ins) alone or with 10 µM darglitazone (dar). Middle: IRS-2 mRNA in cells cultured with 100 nM insulin (ins),10 µM of the PPAR agonist WY14643 (WY), with or without 100 nM insulin, and 10 µM pioglitazone (pio). Bottom: IRS-2 mRNA from differentiated cells that had been cultured for 48 h with no additions (bas), 100 nM progesterone (prog) with or without 10 µM pioglitazone (pio), or 200 µM 8-BrcAMP with or without pioglitazone.

Neither insulin alone or when combined with the PPAR ligands pioglitazone or darglitazone (not shown) altered the gene expression of IRS-1 or of PKB/Akt (Fig. 4A ) in the same experiments. Similarly, no effect was seen with the PPAR agonist (data not shown). The PCR fragment used for PKB hybridization gave two major bands (3.2 and 2.8 kb), probably reflecting both the PKBß/Akt 2 gene as well as the expression of another isoform. Individual results of IRS-1 mRNA expression from five experiments are shown in Fig. 4B .

View larger version (25K): [in this window] [in a new window]   Figure 4. A) IRS-1 and PKB/Akt mRNA in differentiated 3T3-L1 adipocytes cultured for 48 h with no additions (bas), 100 nM insulin (ins), or 10 µM pioglitazone (pio) with insulin. B) Top: individual data from 5 experiments (same as shown in Fig. 1B ) where IRS-1 mRNA was related to ß-actin gene expression in the same cells (arbitrary units). Bars represent mean values. Bottom: IRS-1 protein expression in differentiated 3T3-L1 cells cultured for 48 h with no addition (bas), 100 nM insulin, 10 µM pioglitazone (pio) with or without 100 nM insulin. The scanned data are also shown below (arbitrary units).

Similar to IRS-1, there was no consistent increase in GLUT4 mRNA expression by pioglitazone after 48 h incubation (data not shown).

Effect of TZD and/or insulin on IRS-1 and PKB/Akt protein expression
Figure. 4B (bottom) shows the chronic effects of pio and/or insulin on IRS-1 protein expression after 48 h. Pio alone did not change IRS-1 protein expression. However, in contrast to IRS-2 (Fig. 1B , bottom), IRS-1 protein expression was reduced by chronic stimulation with the high insulin concentration, and this was not altered by the presence of pio (Fig. 4B , bottom). In three experiments, insulin decreased IRS-1 protein expression by 33% (range 25–39%); this decrease remained unchanged when insulin and pio were combined (-31%, range 18–39%) whereas pio alone was without effect (+7%).

Similar to the gene (Fig. 3A ), PKB/Akt protein expression was also not changed by the presence of either pio and/or insulin for 48 h (not shown).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In the present study, we demonstrate for the first time that PPAR activation, but not PPAR, rapidly turns on the gene of the key signaling molecule IRS-2. This effect was initiated within 4 h, peaked after 24 h, and remained elevated throughout the 48 h study. Furthermore, this effect appeared specific since, under the same conditions and in the same cells, we saw no effects on IRS-1, PKB/Akt or GLUT4. Thus, it was not related to a general effect on cell differentiation by the PPAR ligands. In addition, IRS-2 protein expression was also increased after both 48 and 96 h. Since the IRS-2 gene activation was rapid and seen in the presence of the protein synthesis inhibitor cycloheximide, the data suggest a direct effect of PPAR activation on the IRS-2 promoter. This possibility was also supported by the finding that pio did not alter IRS-2 mRNA half-life. Furthermore, EC₅₀ was 50 nM and maximal effect was seen at 1 µM, which is within the therapeutic plasma level (unpublished observations). However, definitive proof requires direct testing in appropriate reporter assays and such work is currently in progress.

The (partial?) human IRS-2 gene and promoter were recently cloned and sequenced (22) , but the complete murine promoter has not been reported. Progesterone and cAMP were found to increase the expression of the IRS-2 gene in HeLa cells but GRE/PRE were not identified in the promoter. Sequencing the promoter identified multiple binding sites for several transcription factors such as Sp1, AP2, and CCAAT box binding factor (22) . However, the identified sequence in the human IRS-2 promoter does not contain the typical AGGTCA binding sites for PPAR (23) . Studies with appropriate reporter systems are necessary to clarify whether PPAR ligands directly activate the IRS-2 gene. Pioglitazone also increased IRS-2 gene expression in human primary adipocytes cultured for 24 h. This finding shows that TZD increase IRS-2 mRNA expression in both murine and human adipocytes and that this effect is unrelated to any action on adipocyte differentiation.

Insulin alone did not change the IRS-2 gene expression and there was no synergistic effect between TZD and insulin. These latter data must be interpreted with some caution since the serum in the culture medium contains insulin. We saw no effect of either progesterone or cAMP on IRS-2 gene expression in 3T3-L1 cells. This is in contrast to recent data in HeLa cells where these agents increased IRS-2 mRNA levels (21) , but this may be an indirect effect (22) and not seen in all cells.

Similar to IRS-2, chronic exposure to insulin did not change PKB/Akt or IRS-1 gene expression. However, in contrast to IRS-2, IRS-1 protein expression was reduced after chronic insulin stimulation in the 3T3-L1 cells, as also reported by others (24 , 25) . This effect of chronic marked hyperinsulinemia is therefore probably due to an increased protein degradation. Recent studies have shown that chronic exposure to insulin leads to an increased serine/threonine phosphorylation through the PI3-kinase and PKB/Akt pathway (24 25 26) . IRS-1 is then degraded through the proteasomal pathway probably as a result of ubiquination (25) . The addition of pioglitazone did not alter this effect of insulin.

In summary, the present data show for the first time a clear link between PPAR ligands and the insulin signaling cascade in that TZD increase IRS-2 gene (and protein) expression in both 3T3-L1 cells and human primary adipocytes. Since low IRS-2 appears to play a profound role in the development of diabetes (27) , these data suggest that the antidiabetic effect of TZD may be mediated at least in part through this effect. It will also be of great interest to see whether TZD can influence ß cell growth and/or apoptosis, since a stunning effect of IRS-2 gene disruption is seen in pancreatic ß cell development (27) . Thus, although IRS-2 can also be used by insulin as a docking protein for PI3-kinase activation, it may play an even more profound role in the signaling and effect of cytokines and growth factors.

	ACKNOWLEDGMENTS

 
This study was supported by grants from the Swedish Medical Research council (project B-3506), the Swedish Diabetes Foundation, the European Union (project QLG1-CT-1999–00674), and the IngaBritt and Arne Lundberg Foundation. Skillful secretarial aid was provided by Gunilla Lindell.

	FOOTNOTES

 
¹ Some of these data were presented at the 60th annual meeting of the American Diabetes Association, San Antonio, June 9–13, 2000, and have appeared in abstract form (Diabetes Suppl. 1, A41, 2000).

Received for publication February 3, 2000. Revision received June 29, 2000.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Fujiwara, T., Yoshioka, S., Yoshioka, T., Ushiyama, I., Horikoshi, H. (1988) Characterization of new oral antidiabetic agent CS-045. Diabetes 37,1549-1558[Abstract]
2. Bowen, L., Stein, P. P., Stevenson, R., Shulman, G. I. (1991) The effect of CP 68,722, a thiazolidinedione derivative, on insulin sensitivity in lean and obese Zucker rats. Metabolism 40,1025-1030[Medline]
3. Zierath, J. R., Ryder, J. W., Doebber, T., Woods, J., Wu, M., Ventre, J., Li, Z., McCrary, C., Berger, J., Zhang, B., Moller, D. E. (1998) Role of skeletal muscle in thiazolidinedione insulin sensitizer (PPAR agonist) action. Endocrinology 139,5034-5041[Abstract/Free Full Text]
4. Nolan, J. J., Ludvik, B., Beerdsen, P., Joyce, M., Olefsky, J. (1994) Improvement in glucose tolerance and insulin resistance in obese subjects treated with troglitazone. N. Engl. J. Med. 331,1188-1193[Abstract/Free Full Text]
5. Chaiken, R. L., Eckert-Norton, M., Pasmantier, R., Boden, G., Ryan, I., Gelfand, R. A., Lebovitz, H. E. (1995) Metabolic effects of darglitazone, an insulin sensitizer, in NIDDM subjects. Diabetologia 38,1307-1312[Medline]
6. Lefebvre, A. M., Peinado-Onsurbe, J., Leitersdorf, I., Briggs, M. R., Paterniti, J. R., Fruchart, J. C., Fievet, C., Auwerx, J., Staels, B. (1997) Regulation of lipoprotein metabolism by thiazolidinediones occurs through a distinct but complementary mechanism relative to fibrates. Arterioscler. Thromb. Vasc. Biol. 17,1756-1764[Abstract/Free Full Text]
7. Spiegelman, B. M. (1998) PPAR: adipogenic regulator and thiazolidinedione receptor. Diabetes 47,507-514[Abstract]
8. Fajas, L., Auboeuf, D., Raspe, E., Schoonjans, K., Lefebvre, A. M., Saladin, R., Najib, J., Laville, M., Fruchart, J. C., Deeb, S., Vidal-Puig, A., Flier, J., Briggs, M. R., Staels, B., Vidal, H., Auwerx, J. (1997) The organization, promoter analysis, and expression of the human PPAR gene. J. Biol. Chem. 272,18779-18789[Abstract/Free Full Text]
9. Okuno, A., Tamemoto, H., Tobe, K., Ueki, K., Mori, Y., Iwamoto, K., Umesono, K., Akanuma, Y., Fujiwara, T., Horikoshi, H., Yazaki, Y., Kadowaki, T. (1998) Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J. Clin. Invest. 101,1354-1361[Medline]
10. Peraldi, P., Xu, M., Spiegelman, B. M. (1997) Thiazolidinediones block tumor necrosis factor-alpha-induced inhibition of insulin signaling. J. Clin. Invest. 100,1863-1869[Medline]
11. Wu, Z., Xie, Y., Morrison, R. F., Bucher, N. L., Farmer, S. R. (1998) PPAR induces the insulin-dependent glucose transporter GLUT4 in the absence of C/EBP during the conversion of 3T3 fibroblasts into adipocytes. J. Clin. Invest. 101,22-32[Medline]
12. El-Jack, A. K., Hamm, J. K., Pilch, P. F., Farmer, S. R. (1999) Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPAR and C/EBP. J. Biol. Chem. 274,7946-7951[Abstract/Free Full Text]
13. Ribon, V., Johnson, J. H., Camp, H. S., Saltiel, A. R. (1998) Thiazolidinediones and insulin resistance: peroxisome proliferator activated receptor gamma activation stimulates expression of the CAP gene. Proc. Natl. Acad. Sci. USA 95,14751-14756[Abstract/Free Full Text]
14. Mastick, C. C., Saltiel, A. R. (1997) Insulin-stimulated tyrosine phosphorylation of caveolin is specific for the differentiated adipocyte phenotype in 3T3–L1 cells. J. Biol. Chem. 272,20706-20714[Abstract/Free Full Text]
15. Rubin, C. S., Lai, E., Rosen, O. M. (1977) Acquisition of increased hormone sensitivity during in vitro adipocyte development. J. Biol. Chem. 252,3554-3557[Abstract/Free Full Text]
16. Rondinone, C. M., Wang, L. M., Lonnroth, P., Wesslau, C., Pierce, J. H., Smith, U. (1997) Insulin receptor substrate (IRS) 1 is reduced and IRS-2 is the main docking protein for phosphatidylinositol 3-kinase in adipocytes from subjects with non-insulin-dependent diabetes mellitus. Proc. Natl. Acad. Sci. USA 94,4171-4175[Abstract/Free Full Text]
17. Smith, U. (1974) Studies of human adipose tissue in culture III. Influence of insulin and medium glucose concentration on cellular metabolism. J. Clin. Invest. 54,91-98
18. Smith, U., Bostrom, S., Johansson, R., Nyberg, G. (1976) Human adipose tissue in culture. V. Studies on the metabolic effects of insulin. Diabetologia 12,137-143[Medline]
19. Cigolini, M., Smith, U. (1979) Human adipose tissue in culture. VIII. Studies on the insulin-antagonistic effect of glucocorticoids. Metabolism 28,502-510[Medline]
20. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18,5294-5299[Medline]
21. Vassen, L., Wegrzyn, W., Klein-Hitpass, L. (1999) Human insulin receptor substrate-2 (IRS-2) is a primary progesterone response gene. Mol. Endocrinol. 13,485-494[Abstract/Free Full Text]
22. Vassen, L., Wegrzyn, W., Klein-Hitpass, L. (1999) Human insulin receptor substrate-2: gene organization and promoter characterization. Diabetes 48,1877-1880[Abstract]
23. Mangelsdorf, D. J., Evans, R. M. (1995) The RXR heterodimers and orphan receptors. Cell 83,841-850[Medline]
24. Ricort, J. M., Tanti, J. F., Van Obberghen, E., Le Marchand-Brustel, Y. (1995) Alterations in insulin signalling pathway induced by prolonged insulin treatment of 3T3–L1 adipocytes. Diabetologia 38,1148-1156[Medline]
25. Sun, X. J., Goldberg, J. L., Qiao, L. Y., Mitchell, J. J. (1999) Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 48,1359-1364[Abstract]
26. Li, J., DeFea, K., Roth, R. A. (1999) Modulation of insulin receptor substrate-1 tyrosine phosphorylation by an Akt/phosphatidylinositol 3-kinase pathway. J. Biol. Chem. 274,9351-9356[Abstract/Free Full Text]
27. Withers, D. J., Burks, D. J., Towery, H. H., Altamuro, S. L., Flint, C. L., White, M. F. (1999) Irs-2 coordinates Igf-1 receptor-mediated beta-cell development and peripheral insulin signalling. Nat. Genet. 23,32-40[Medline]

This article has been cited by other articles:

				J. Sevillano, J. de Castro, C. Bocos, E. Herrera, and M. P. Ramos Role of Insulin Receptor Substrate-1 Serine 307 Phosphorylation and Adiponectin in Adipose Tissue Insulin Resistance in Late Pregnancy Endocrinology, December 1, 2007; 148(12): 5933 - 5942. [Abstract] [Full Text] [PDF]

				G. Murdolo, A. Hammarstedt, M. Sandqvist, M. Schmelz, C. Herder, U. Smith, and P.-A. Jansson Monocyte Chemoattractant Protein-1 in Subcutaneous Abdominal Adipose Tissue: Characterization of Interstitial Concentration and Regulation of Gene Expression by Insulin J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2688 - 2695. [Abstract] [Full Text] [PDF]

				R. C. Reddy, Y. Hao, S.-H. Lee, S. R. Gangireddy, C. Owyang, and M. J. DiMagno Pioglitazone reverses insulin resistance and impaired CCK-stimulated pancreatic secretion in eNOS(-/-) mice: therapy for exocrine pancreatic disorders? Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G112 - G120. [Abstract] [Full Text] [PDF]

				F Sentinelli, E Filippi, M G Cavallo, S Romeo, M Fanelli, and M G Baroni The G972R variant of the insulin receptor substrate-1 gene impairs insulin signaling and cell differentiation in 3T3L1 adipocytes; treatment with a PPAR{gamma} agonist restores normal cell signaling and differentiation J. Endocrinol., February 1, 2006; 188(2): 271 - 285. [Abstract] [Full Text] [PDF]

				O. S. Gardner, B. J. Dewar, and L. M. Graves Activation of Mitogen-Activated Protein Kinases by Peroxisome Proliferator-Activated Receptor Ligands: An Example of Nongenomic Signaling Mol. Pharmacol., October 1, 2005; 68(4): 933 - 941. [Abstract] [Full Text] [PDF]

				H. K.R. Karlsson, K. Hallsten, M. Bjornholm, H. Tsuchida, A. V. Chibalin, K. A. Virtanen, O. J. Heinonen, F. Lonnqvist, P. Nuutila, and J. R. Zierath Effects of Metformin and Rosiglitazone Treatment on Insulin Signaling and Glucose Uptake in Patients With Newly Diagnosed Type 2 Diabetes: A Randomized Controlled Study Diabetes, May 1, 2005; 54(5): 1459 - 1467. [Abstract] [Full Text] [PDF]

				U. Kintscher and R. E. Law PPAR{gamma}-mediated insulin sensitization: the importance of fat versus muscle Am J Physiol Endocrinol Metab, February 1, 2005; 288(2): E287 - E291. [Abstract] [Full Text] [PDF]

				H. Yki-Jarvinen Thiazolidinediones N. Engl. J. Med., September 9, 2004; 351(11): 1106 - 1118. [Full Text] [PDF]

				S. C. Benson, H. A. Pershadsingh, C. I. Ho, A. Chittiboyina, P. Desai, M. Pravenec, N. Qi, J. Wang, M. A. Avery, and T. W. Kurtz Identification of Telmisartan as a Unique Angiotensin II Receptor Antagonist With Selective PPAR{gamma}-Modulating Activity Hypertension, May 1, 2004; 43(5): 993 - 1002. [Abstract] [Full Text] [PDF]

				H.-i. Kim and Y.-h. Ahn Role of Peroxisome Proliferator-Activated Receptor-{gamma} in the Glucose-Sensing Apparatus of Liver and {beta}-Cells Diabetes, February 1, 2004; 53(90001): S60 - 65. [Abstract] [Full Text]

				V. Rotter, I. Nagaev, and U. Smith Interleukin-6 (IL-6) Induces Insulin Resistance in 3T3-L1 Adipocytes and Is, Like IL-8 and Tumor Necrosis Factor-{alpha}, Overexpressed in Human Fat Cells from Insulin-resistant Subjects J. Biol. Chem., November 14, 2003; 278(46): 45777 - 45784. [Abstract] [Full Text] [PDF]

				M. M. Meyer, K. Levin, T. Grimmsmann, N. Perwitz, A. Eirich, H. Beck-Nielsen, and H. H. Klein Troglitazone Treatment Increases Protein Kinase B Phosphorylation in Skeletal Muscle of Normoglycemic Subjects at Risk for the Development of Type 2 Diabetes Diabetes, September 1, 2002; 51(9): 2691 - 2697. [Abstract] [Full Text] [PDF]

				G. Jiang, Q. Dallas-Yang, Z. Li, D. Szalkowski, F. Liu, X. Shen, M. Wu, G. Zhou, T. Doebber, J. Berger, et al. Potentiation of Insulin Signaling in Tissues of Zucker Obese Rats After Acute and Long-Term Treatment With PPAR{gamma} Agonists Diabetes, August 1, 2002; 51(8): 2412 - 2419. [Abstract] [Full Text] [PDF]

				Y. Tamori, J. Masugi, N. Nishino, and M. Kasuga Role of Peroxisome Proliferator-Activated Receptor-{gamma} in Maintenance of the Characteristics of Mature 3T3-L1 Adipocytes Diabetes, July 1, 2002; 51(7): 2045 - 2055. [Abstract] [Full Text] [PDF]

				R. Walczak and P. Tontonoz PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism J. Lipid Res., February 1, 2002; 43(2): 177 - 186. [Abstract] [Full Text] [PDF]

				Y.-B. Kim, T. P. Ciaraldi, A. Kong, D. Kim, N. Chu, P. Mohideen, S. Mudaliar, R. R. Henry, and B. B. Kahn Troglitazone but not Metformin Restores Insulin-Stimulated Phosphoinositide 3-Kinase Activity and Increases p110{beta} Protein Levels in Skeletal Muscle of Type 2 Diabetic Subjects Diabetes, February 1, 2002; 51(2): 443 - 448. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by SMITH, U. Articles by SVALSTEDT, B. Search for Related Content PubMed PubMed Citation Articles by SMITH, U. Articles by SVALSTEDT, B.