FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SÉE, V.
Right arrow Articles by LOEFFLER, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SÉE, V.
Right arrow Articles by LOEFFLER, J.-P.
(The FASEB Journal. 2001;15:134-144.)
© 2001 FASEB

Calcium/calmodulin-dependent protein kinase type IV (CaMKIV) inhibits apoptosis induced by potassium deprivation in cerebellar granule neurons

VIOLAINE SÉE*,{dagger}, ANNE-LAURENCE BOUTILLIER*, HARUHIKO BITO{dagger} and JEAN-PHILIPPE LOEFFLER*1

* Université Louis Pasteur, UMR 7519 CNRS, IPCB, 67084 Strasbourg Cedex, France;
{dagger} Department of Pharmacology, Kyoto University Faculty of Medicine, Sakyo-ku, Kyoto 606-8315, Japan

1Correspondence: Université Louis Pasteur-UMR 7519 CNRS, 21, rue René Descartes, 67084 Strasbourg Cedex, France. E-mail: loeffler{at}neurochem.u-strasbg.fr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The neuroprotective mechanisms of the Ca2+/calmodulin kinase (CaMK) signaling pathway were studied in primary cerebellar neurons in vitro. When switched from depolarizing culture conditions HK (extracellular K+ 30 mM) to LK (K+ 5 mM), these neurons rapidly undergo nuclear fragmentation, a typical feature of apoptosis. We present evidence that blockade of L-type Ca2+ channels (nifedipine sensitive) but not N/P/Q-type Ca2+ channels (omega-conotoxin MVIIC sensitive) triggered apoptosis and CPP32/caspase-3-like activity. The entry into apoptosis was associated with a progressive caspase-3-dependent cleavage of CaMKIV, but not of CaMKII. CaMKIV function in neuronal apoptosis was further investigated by overexpression of CaMKIV mutants by gene transfer. A dominant-active CaMKIV mutant inhibited LK-induced apoptosis whereas a dominant-negative form induced apoptosis in HK, suggesting that CaMKIV exerts neuroprotective effects. The transcription factor CREB is a well-described nuclear target of CaMKIV in neurons. When switched to LK, the level of phosphorylation of CREB, after an initial drop, further declined progressively with kinetics comparable to those of CaMKIV degradation. This decrease was abolished by caspase-3 inhibitor. These data are compatible with a model where Ca2+ influx via L-type Ca2+ channels prevents caspase-dependent cleavage of CaMKIV and promotes neuronal survival by maintaining a constitutive level of CaMKIV/CREB-dependent gene expression.—Sée, V., Boutillier, A.-L., Bito, H., Loeffler, J.-P. Calcium/calmodulin-dependent protein kinase type IV (CaMKIV) inhibits apoptosis induced by potassium deprivation in cerebellar granule neurons.


Key Words: CPP32/caspase-3 • cAMP-responsive element binding protein (CREB) • calcium channels • nuclear condensation • gene transfer


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
APOPTOSIS, CONSIDERED TO BE A physiological mechanism of cell demise, is an active process with particular morphological and biochemical features. Apoptotic cells are characterized by condensed and fragmented nuclei, whereas necrotic cells present loss of membrane integrity without apparent damage of the nuclei. Such a complex mechanism by which a cell orchestrates its own destruction may also be inappropriately activated in the case of neurodegenerative diseases, such as Alzheimer’s disease (1) , Huntington’s disease (2) , or spinal muscular dystrophy (3) . This phenomenon can be experimentally induced in cerebellar granule neurons in vitro by using a model of K+ deprivation. Indeed, by acutely decreasing extracellular K+ concentrations (from 30 to 5 mM), granule cell cultures present the morphological hallmarks of apoptosis (4 5 6 7) .

Caspases, a group of cysteine proteases related to the cell death protein CED3 in Caernohabditis elegans (8) are the main players in the proteolytic cascade activated during apoptosis. They cleave a wide range of substrates at a site next to an aspartate residue (9) . The proteins that are targeted specifically for degradation by caspases are believed to play some vital role in the apoptotic process (10) . The caspase family comprises 15 members divided into 3 groups: the caspase-1 (-like), caspase-2 (-like), and caspase-3 (-like) protease subfamilies (11) . Caspase-3 (-like) protease activation has been observed in various apoptotic cell death events. Several groups of investigators have recently reported that caspases may be involved in the death of cerebellar granule neurons induced by serum or potassium deprivation (5 , 12 13 14) .

Previous studies have suggested that depolarization under HK and subsequent Ca2+ entry helps to sustain the survival of granule cells. Furthermore, calmodulin seems to be a key effector in calcium promoted cell survival (15 , 16) . Calcium/calmodulin-dependent protein kinases (CaMKs) appear to be good candidates for mediating calcium and calmodulin effects (16 , 17) . CaMK types II and IV are serine/threonine kinases that are expressed in cerebellar granule neurons. They have a highly homologous catalytic domain adjacent to a regulatory region that contains an overlapping autoinhibitory domain (AID) and a calmodulin binding domain (CBD) (for a review, see refs 18 , 19 ). CaMKs phosphorylate a large variety of substrates and are implicated in the control of gene transcription by phosphorylating several transcription factors (20 21 22 23) . Studies in hippocampal neurons indicate that CaMKIV regulates CREB-dependent gene transcription in response to electrical stimulation or KCl depolarization (24 25 26) . There is also good evidence for the involvement of CaMKIV in transcriptional regulation of the BDNF gene through phosphorylation of a CREB family member (26 , 27) . Several reports have indicated that CaMKII and IV modulate apoptosis (28 , 29) . Here we investigate the potential function and the proteolytic fate of two mediators of the calcium signaling cascade, CaMKII and CaMKIV, during cerebellar granule cell apoptosis.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell cultures
Cerebellar granule neurons were cultured as described previously (30) . Briefly, cerebella from 7-day-old mice (fvb strain) were dissected and cultured by enzymatic (trypsin, Sigma, St. Louis, Mo.) and mechanical dissociation in Dulbecco’s modified Eagle Medium (DMEM) containing 10% horse serum, 30 mM KCl, insulin (0.5 µM), gentamicin (50 µg/ml). After 2 days in culture, neurons were switched to defined medium without serum [DMEM, 30 mM KCl, insulin (0.5 µM), gentamicin (50 µg/ml), T3 (1 nM), putrescine (60 µM), transferrin (100 µM) and sodium selenite (30 nM)] and experiments were performed after 3 days in vitro in this medium. Typically, HK medium is one with 30 mM KCl and LK medium one with 5 mM KCl.

Reagents and antibodies
The various peptidic protease inhibitors Ac-YVAD-CHO (N-Acetyl-Tyr-Val-Ala-Asp-aldehyde), Z-DEVD-fmk (benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone), Z-VAD-fmk (benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone), and the substrate Ac-DEVD-AMC (N-Acetyl-Asp-Glu-Val-Asp-7-Amino-4-methyl-coumarin) were purchased from Calbiochem (La Jolla, Calif.). PEI 25 kDa (polyethylenimine) was purchased from Sigma. FPL64176 was from RBI (Natick, Mass.) and omega-conotoxin MVIIC was from Peptide Institute (Osaka, Japan).

Monoclonal antibodies against CaMKIV and CaMKII were obtained from Transduction Laboratories (Lexington, Ky.) and Boehringer (Mannheim, Germany), respectively. Rabbit polyclonal antibodies against P-CREB and N-CREB were from Upstate Biotechnology (Lake Placid, N.Y.). Polyclonal antibody against Hemagglutinin (HA) (Y-11) was from Santa Cruz Biotechnology (Santa Cruz, Calif.). Horseradish peroxidase (HRP) -conjugated secondary antibodies, goat anti-rabbit IgG, and sheep anti-mouse IgG were purchased from Pierce (Rockford, Ill.). Cy3-conjugated secondary antibody, goat anti-rabbit was from Jackson ImmunoResearch (West Grove, Pa.).

Western blot analysis
Forty micrograms of total cell extract in sample buffer (62.5 mM Tris HCl, pH 6.8, 10% glycerol, 1% sodium dodecyl sulfate (SDS), 1% ß-mercaptoethanol, 0.1% bromphenol blue) were loaded on a 10% SDS-polyacrylamide gel. Proteins were blotted onto a pure nitrocellulose membrane (0.45 µm; Bio-Rad, Hercules, Calif.). Unspecific labeling was blocked in 10% blotto (10% non-fat dry milk, 150 mM Tris HCl, pH 7.4, 50 mM NaCl, 0.05% Tween 20) for 1 h and membranes were incubated overnight at 4°C with the appropriate primary antibody diluted in 3% blotto. After three washes, membranes were incubated for 2 h at room temperature with a 1/2000 dilution of anti-mouse IgG, HRP-conjugated whole sheep antibody (Amersham, Arlington Heights, Ill.) or with 1/5000 anti-rabbit IgG (Pierce), followed by three more washes, and specific bands were detected by ECL (Amersham). Blots were exposed for the indicated duration with BIOMAX-MR KODAK films. All the Western blots were performed at least three times.

Constructions of CaMKs expressing vectors and transfections
Construction of plasmids
Vectors expressing dominant active (DA) forms of CaMKIV and CaMKII are derived from vectors previously described by Maurer et al. (31) . Sequence coding for the DA proteins were polymerase chain reaction (PCR) amplified using primers: (for CaMKII: 5'CGTGATATCGCCACCATGGGATACCCTTACGATGTTCCTGATTACGCTGCGTCGACCATGGCTACCATCACCTGCACCCGA3'; 3'TGTCCTCTGGCACCTGACGGACACTCGCCGGCGTAC5'; for CaMKIV: 5'CGTGATATCGCCACCATGGGATACCCTTACGATGTTCCTGATTACGCTGCGTCGACCATGCTCAAAGTCACGGTCC-CT3'; 3'CTGTGACGAGTCTTCTTTGAAACTCGCCGGCGTAC5'), where the HA epitope was introduced with the 5' primer. These PCR products were then subcloned in a pIRES-EGFP vector (Clontech, Palo Alto, Calif.) downstream of the CMV promoter.

A dominant negative form of CaMKIV was generated from the DA form by introducing two mutations (Lys71Glu, Thr196Ala), which renders it kinase-dead and nonphosphorylatable by CaMKK. A PCR-mediated point mutation method was used as described (32) . Briefly, this method is based on the amplification by PCR of two overlapping fragments, both of which included a mismatch that introduced a desired mutation (primers: Lys71Glu: 5'AGCCCTATGCTCTCTCGAAGTGTTAAAGAAAAC3'; 5'GTTTTCTTTAACACTTCGAGAGCCATAGGGCT3'; Thr 196 Ala: 5'TCAAGTGCTCATGAAGGCAGTGTGTGGAACCC3'; 5'GGGTTCCACACACTGCCTTCATGAGCACTTGA3'). In a second PCR round, the two fragments were mixed with the primers at the most 5' and 3' ends, resulting in a joined product that was then subcloned in the pIRES-EGFP vector (Clontech).

In preliminary control experiments, the functionality of all constructs was tested by their ability to modulate gene transcription. Dominant activator of CaMKIV (DA-CaMKIV) was able to induce CREB-dependent luciferase activity in a CREB/Gal4 luc reporter system, as described previously (31) . Both DA-CaMKIV and dominant activator of CaMKII (DA-CaMKII) were able to induce fos-luc reporter gene in cerebellar granule neurons. The dominant negative form of CaMKIV was shown to inhibit depolarization-induced Gal4-CREB activation in cerebellar granule cells. We performed competition experiments in PC12 cells where increasing concentrations of DN-CaMKIV progressively inhibited DA-CaMKIV-stimulated transcription from the CRE-luc reporter gene (unpublished data).

Gene transfer
Neuronal gene transfer was performed as reported previously, using PEI (25K) as DNA carrier (33) . Three DIV cell cultures on glass coverslips in 12-well plates were transfected for 30 min with 1 µg/ml of expression vector. Plates were spun for 5 min at 1500 rpm. Twenty-four hours after transfection in HK, neurons were K+-deprived for 11 h when indicated. Apoptotic nuclei were visualized by Hoechst staining and transfected cells were revealed by immunocytochemistry using an anti-HA antibody (Y-11).

Hoechst staining
Condensed and fragmented nuclei were evaluated in situ in the cells (34) , by intercalation into nuclear DNA of the fluorescent probe bisbenzimide: Hoechst 33342 (Sigma). After fixation with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min, cells were incubated with the Hoechst dye 33342 at 1 µg/ml for 45 min at room temperature. Hoechst is visualized with AMCA filter (excitation 350 nm, emission 450 nm), is cell permeant, and labels both intact and apoptotic nuclei. Apoptosis was observed as small, bright-staining nuclei, often very rounded, and usually fragmented into distinct sections. The percentage of fragmented nuclei was evaluated under each condition, by counting cells in at least 10 randomly chosen field with a 40x objective.

Statistical analysis
Statistical analyses were performed for all Western blot experiments and Hoechst countings. The significance of the data was assessed by analysis of variance (ANOVA), followed by the Student-Newman-Keuls test for multiple comparisons using Graphpad’s Instat 2 software.

Immunocytochemistry
After fixation and Hoechst staining as described above, cells were washed and blocked for 10 min in PBS-merthiolate 0.02% containing 0.1% Triton X-100 and 5% sheep serum. Cells were subsequently incubated with primary antibodies diluted in the same buffer (Y-11, 1/400). After three washes, immunostaining was detected with a goat anti-rabbit Cy3-labeled secondary antibody (1/400). Staining was visualized with a Leica microscope using a rhodamine filter and photographs were taken with Kodak TMAX 320 film.

Caspase activity measurements
Caspase activities were determined as described previously by Przywara et al. (35) by measuring the release of 7-amino-4-methylcoumarin (AMC) from the caspase tetrapeptide CPP32 substrate DEVD-AMC (Calbiochem). Briefly, neurons grown in 30 mm culture dishes were washed with PBS and lysed with 100 µl of lysis buffer [0.5% Igepal NP-4 (Sigma), 0.5 mM EDTA, 150 mM NaCl, 50 mM Tris pH 7.5] on ice. One portion of the lysate was used for protein determination (Bradford method, Bio-Rad) and 50 µl of lysate was added to a reaction mixture containing 100 µl of 2x reaction buffer [20 mM HEPES pH 7.5, 50 mM NaCl, 2.5 mM DTT], 40 µl H2O, and 10 µl of DEVD-AMC (final: 50 µM) and incubated for 1 h at 37°C. The reaction was stopped by 10x dilution with ice-cold lysis buffer. Fluorescence of free AMC was measured using excitation and emission wavelengths of 360 and 465 nm, respectively, using a Perkin-Elmer HTS 7000 Bioassay reader (Foster City, Calif.). A standard curve of fluorescence vs. free AMC was used to calculate amount of substrate cleaved per minute per milligram of protein. Experiments were performed in duplicate and caspase activity was expressed in µM of cleaved substrate · µg protein-1 · min-1.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Voltage-dependent Ca2+ entry through L-type channels modulates neuronal apoptosis and caspase-3-like activity
We first investigated the importance of voltage-dependent calcium influx in the control of cell survival in our K+ deprivation model. Figure 1A , D shows that 30% of cerebellar granule cells switched from depolarizing condition (HK) to nondepolarizing conditions (LK) for 11 h displayed nuclear fragmentation, a typical hallmark of apoptosis. The effect of LK could be replicated in neurons in HK by an 11 h treatment with nifedipine, a specific L-type voltage-gated calcium channels (VGCC) blocker, with ~20% of the neurons showing nucleus condensation (Fig. 1B ). In contrast, a 3 µM treatment with omega-conotoxin MVIIC that specifically blocks both N- and P/Q-type calcium channels had no visible effect on nuclear condensation (Fig. 1C ). Conversely, application of the dihydropyridine FPL64176, an agonist that facilitates currents mediated by L-type Ca2+ channels by increasing its opening probability, significantly prevented LK-induced apoptosis (Fig. 1E ). Taken together, these data suggested that regulation of L-type Ca2+ channel activity plays a key role in determining the survival of cerebellar granule cells. Consequently, an intracellular calcium-dependent pathway may be involved in promoting cell survival.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Regulation of cerebellar granule cells apoptosis by dihydropyridine agonist and antagonist. Neurons at 5 days in vitro were cultured in HK (30 mM KCl, see Materials and Methods) and maintained for 11 h in HK medium in the absence (A) or presence of nifedipine (1 µM) (B) or omega-conotoxin MVIIC (3 µM) (C). Neurons cultured in HK were switched to LK (5 mM KCl) for 11 h in the absence (D) or presence of FPL64126 (1 µM) (E). Apoptotic cells were monitored by chromatin condensation using Hoechst 33342 (1 µg/ml). The percentage of fragmented nuclei was evaluated in each condition by counting cells in at least 10 randomly chosen fields with a 40x objective. Results are mean ± SE of counting of 3 independent experiments. ** and ***, indicate a statistical difference with P<0.01 and P<0.001, respectively, compared to HK or LK where indicated (ANOVA, followed by a Student-Newman-Keuls multiple comparison test).

As described previously, shifting granule neurons from HK to LK dramatically increased CPP32/caspase-3-like activity in a time-dependent manner (Fig. 2 ; refs 5 , 12 , 36 ). Under our experimental conditions, caspase-3-like activity increased after 3 h of LK treatment, with a maximal activity at 10 h (11.5 µg of cleaved substrate · µg protein-1 · min-1) followed by a progressive decline. This increase in caspase activity was completely inhibited by 50 µM of a specific CPP32/caspase-3-like inhibitor, Z-DEVD-fmk, and by a broad-range caspase inhibitor, Z-VAD-fmk. A caspase-1-like inhibitor, ac-YVAD-CHO, had no effect on caspase-3 activity, as expected. We next investigated the changes of caspase-3-like activity in response to different treatments modifying Ca2+ entries via VGCC. On the one hand, treatment of neurons with 1 µM nifedipine produced a robust activation of caspase activity similar to that obtained with a switch to LK, whereas no rise in caspase-3-like activity was detected in the presence of omega-conotoxin MVIIC (Fig. 2) . On the other hand, opening calcium L-type channels with FPL64176 in LK conditions significantly reduced the LK-induced caspase-3 activity. Thus, regulation of L-type Ca2+ channel activity appears to have a strong impact on the initiation of the caspase-3-dependent signaling cascade.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Regulation of caspase activity by dihydropyridine agonist and antagonist. Caspase-3-like activity was measured with the fluorogenic DEVD-AMC substrate. Neurons at 5 days in vitro were cultured in HK and maintained in HK medium in the absence or presence of nifedipine (1 µM) or omega-conotoxin MVIIC (3 µM) for the times indicated. Neurons cultured in HK were switched to LK (5 mM KCl) at indicated times in the absence or presence of FPL64176 (1 µM) or caspase-3-like inhibitors Z-DEVD-fmk and Z-VAD-fmk (50 µM). Results are means ± SE of triplicate values; each experiment was performed 3 times.

The effect of caspase inhibitors on nuclear condensation was further examined (Fig. 3 ). Application of 50 µM of Z-VAD-fmk completely inhibited nuclear fragmentation induced by 18 h of LK exposure (Fig. 3C ), whereas the more specific caspase-3 inhibitor (DEVD-fmk, 50 µM) significantly reduced fragmentation by 25% (Fig. 3D ).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 3. Effect of caspase-3 inhibitors on neuronal apoptosis and cell death. Apoptotic cells were monitored by chromatin condensation using Hoechst 33342. Neurons at 5 days in vitro were maintained in HK medium (a) or switched to LK during 18 h (b) and treated in these LK conditions with Z-DEVD-fmk (50 µM) (c) or Z-VAD-fmk (50 µM) (d). The percentage of fragmented nuclei was evaluated under each condition by counting cells in at least 10 randomly chosen fields with a 40x objective. Results are mean ± SE from 3 independent experiments. ** and *** indicate a statistical difference P<0.01 and P<0.001, respectively, compared to HK or to LK where indicated (ANOVA, followed by a Student-Newman-Keuls multiple comparison test).

Caspase-3-like-dependent proteolysis of CaMKIV is induced by potassium deprivation
We and others have shown that blockade of the Ca2+/calmodulin signaling pathway induced apoptosis in cerebellar granule neurons (15 , 16) . We examined the possibility that two effectors of the Ca2+/calmodulin pathway, CaMKII and CaMKIV, may be a target for caspases in LK-induced apoptosis of neurons. Indeed, a number of regulators of apoptotic signaling have been shown to be substrates of caspases in vitro and in vivo (10) , and CaMK type IV in particular has been shown to be cleaved in several fragments by caspase- and calpain-dependent mechanisms in a neuroblastoma cell line undergoing apoptosis (37) . CaMKII and CaMKIV were thus subjected to Western blot analyses after K+ deprivation (Fig. 4A , B ). Whereas CaMKII immunoreactivity did not change in response to LK treatment (Fig. 4A ), a clear decrease in total CaMKIV immunoreactivity was observed (Fig. 4B , fivefold decrease after 18 h of LK; P<0,01). Examination of the same blots with longer exposure revealed that LK induced a time-dependent proteolytic cleavage of the CaMKIV protein. Cleavage products appeared at 45, 44, 36, and 33 kDa, a pattern similar to that observed by McGinnis et al. (37) , which suggests that caspase-3 could be involved in degrading CaMKIV during granule neurons apoptosis. The effect of caspase inhibitors on this cleavage was further examined. Figure 4C shows that the broad-range caspase inhibitor Z-VAD-fmk strongly inhibited appearance of CaMKIV cleavage products, hence also preventing the loss of immunoreactivity of the full-length protein observed in LK (compare 117%±20 to 38%±15, P<0.01). Treatment with Z-DEVD-fmk, a more specific inhibitor of caspase-3-like enzymes, also reduced CaMKIV cleavage and prevented the loss of the full-length protein (80%±20 relative to 38%±15, P<0.01). These data suggest that LK-induced activation of at least in part caspase-3 activity contributes to CaMKIV degradation, but has no effect on CaMKII.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 4. Specific CaMKIV cleavage under nondepolarizing conditions. A) Neurons at 5 days in vitro were cultured in HK medium (30 mM) and switched to LK medium (5 mM) at the indicated times. Cell extracts were submitted to Western blotting with an antibody directed against CaMKII. B) Cell extracts used in panel A were probed with an anti-CaMKIV antibody. A typical autoradiogram is shown on which CaMKIV cleavage products can be seen after 3 min of exposure (right panel), whereas a short exposure period (1 min, left panel) allows visualization of variations in the total amount of full-length protein. The graph represents the quantification ± SEM of 4 independent experiments. Relative densities of the bands have been quantified with a Bio-Rad analysis software (Multi-Analyst). Results are represented as percentage of control conditions (HK, arbitrary set at 100%). **P<0.01 reveals a statistically significant difference compared to the control (ANOVA, followed by a Student-Newman-Keuls multiple comparison test). C) Cerebellar granule cells were switched from HK to LK during 9 h in the absence (ct) or presence of inhibitors of caspase activity (50 µM) as indicated. D) Neurons were maintained in HK medium in absence (ct) or presence of 9 h of nifedipine (1 µM) or omega-conotoxin MVIIC (3 µM), or switched to LK medium (9 h) in the absence (ct) or presence of FPL64176 (1 µM). C, D) As in panel B, t1 and t2 correspond respectively to 3 and 1 min of the autoradiogram exposures. Numbers below each band represent the average of relative densities quantified as in panel B. HK=100%; 3 independent experiments.

As calcium entry via L-type Ca2+ channels modulates apoptosis and caspase-3-like activity, we speculated it could also play a role in CaMKIV fragmentation. As shown in Fig. 4D , closure of L-type Ca2+ channels in HK by a 9 h nifedipine treatment (Nif, 1 µM) induced CaMKIV fragmentation, similarly to LK treatment. Accordingly, the total amount of CaMKIV decreased to 47%±12 (HK/nifedipine) and 38%±15 (LK) relative to the HK control (P<0.01). In contrast, inhibition of Ca2+ entry through N- and P/Q-type channels by omega-conotoxin MVIIC was unable to induce CaMKIV fragmentation and subsequent CaMKIV loss. Conversely, opening L-type Ca2+ channels with the agonist FPL64176 partly prevented LK-induced CaMKIV fragmentation. Indeed, after FPL/LK treatment, levels of CaMKIV only dropped down to 71%±16 of HK control relative to the 38%±15 observed in LK alone. Thus, CaMKIV fragmentation was also likely to be regulated by specific Ca2+ entry channels in neurons.

Taken together, this set of data is consistent with the idea that CaMKIV, a key effector of the intracellular Ca2+/calmodulin signaling pathway, is specifically cleaved and degraded during neuronal apoptosis by a caspase-dependent mechanism and is under the control of specific calcium entry routes. This raised the possibility that CaMKIV may play a potential role in cerebellar granule cell neuroprotection against LK-induced apoptosis.

CaMKIV promotes neuronal survival
To test whether CaMKs directly regulated neuronal survival, dominant active forms of CaMKIV and II and a dominant negative form of CaMKIV were overexpressed in cerebellar granule neurons by a transient gene transfer technique, and their effects on apoptosis were monitored by scoring apoptotic nuclei in the transfected cell population (Hoechst staining; see Materials and Methods). The different CaMK-coding sequences were fused to the hemagglutinin (HA) epitope tag and subcloned in a mammalian expression vector. Expression of CaMKs in transfected cells was detected by immunocytochemistry with an antibody directed against the HA epitope. Controls were performed by evaluating the percentage of apoptotic nuclei obtained in a population of neurons transfected with the same vector expressing EGFP in which transfected cells were monitored by EGFP fluorescence.

Overexpression of the dominant activator of CaMKIV (DA-CaMKIV) in neurons maintained in HK (neuroprotective conditions) had little effect on neuronal survival (Fig. 5A ). By contrast, when apoptosis was induced by LK treatment, less than 10% of nuclei were apoptotic in neurons expressing DA-CaMKIV whereas 30% of neurons expressing the control vector were apoptotic (Fig. 5A , C ). This indicated that an active CaMKIV is sufficient to promote neuronal survival. In contrast, overexpression of a DA-CaMKII was unable to prevent LK-induced apoptosis (Fig. 5B , C ), a result consistent with the fact that LK treatment has no effect on the CaMK II protein levels (Fig. 4A ). Thus CaMKIV, but not CaMKII, may prevent LK-induced apoptosis. We next asked whether CaMKIV activity at some level was in fact required to sustain survival in HK medium. Figure 6 shows that expression of DN-CaMKIV induced nuclear fragmentation under both HK and LK conditions. Under HK conditions, more than 30% of DN-CaMKIV-expressing cells were apoptotic, whereas in LK conditions, 95% of transfected cells had a condensed nuclei. These data are in line with the idea that CaMKIV is a key effector in promoting cell survival and that the loss of its activity contributes to the LK-induced apoptotic program.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 5. Specific effects of active forms of CaMKIV and II on neuronal apoptosis. Neurons at 3 days in vitro were transfected with a vectors expressing either a dominant active form of CaMKIV fused to an hemagglutinin (HA) epitope (DA-CaMKIV) (A) or a dominant active form of CaMKII fused to an HA epitope (DA-CaMKII) (B). After 24 h of expression, cells were switched (c, d) or not (a, b) to LK medium (5 mM) during 11 h. Cells expressing DA-CaMKs were revealed by immunocytochemistry using a polyclonal anti-HA antibody recognized by a Cy3-coupled secondary antibody (red staining). A, B) Transfected cells from 5 independent experiments were counted in each condition and apoptosis for each cell was monitored by Hoechst staining. Arrows indicate nuclei of HA-positive neurons. Control countings were done with cells transfected with an EGFP-expressing vector. **P<0.01: a statistically significant difference of the apoptotic rate compared to mock transfected cells (Unpaired t test with Welch correction analysis).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Effects of a dominant negative form of CaMKIV on neuronal apoptosis. a) Neurons at 3 days in vitro were transfected with a vector expressing a dominant negative form of CaMKIV fused to an hemagglutinin epitope (DN-CaMKIV). After 24 h of expression, cells were switched (c, d) or not (a, b) to LK medium (5 mM) during 11 h. Cells expressing DN-CaMKIV were revealed by immunocytochemistry using a polyclonal anti-HA antibody recognized by a Cy3-coupled secondary antibody. Transfected cells were counted and apoptosis for each cell was monitored by Hoechst staining. Arrows indicate nuclei of HA-positive neurons. Control countings were done with cells transfected with an EGFP-expressing vector. **(P<0.01) reveals a statistically significant difference of the apoptotic rate compared to mock transfected cells (Unpaired t test with Welch correction analysis).

Caspase-dependent CaMKIV cleavage interferes with CREB phosphorylation
The functional consequence of caspase-mediated CaMKIV fragmentation was evaluated on the phosphorylation state of the CREB protein. Indeed, CREB is specifically phosphorylated by CaMK IV on the serine 133 residue (31 , 38) . Western blot analysis using an antibody directed against the phosphorylated form of CREB (pCREB) revealed an initial drop of the phosphorylation levels upon K+ deprivation (15 min) that stayed constant until 2 h and then declined progressively with kinetics comparable to those observed for CaMKIV cleavage (Fig. 7A ). The decrease in pCREB observed during the initial 6 h period was not due to the proteolytic degradation of CREB, since Western blot analysis with an antibody that recognizes native CREB (N-CREB) showed that the total amount of CREB significantly decreased after 6 h of K+ deprivation (25% and 50% of decrease at 8 and 10 h, respectively, P<0.05; Fig. 7A ). This late decrease of N-CREB levels is probably due to a caspase-dependent degradation, since caspase inhibitors (Z-DEVD and Z-VAD) restored N-CREB levels at 8 h (Fig. 7B ). This mechanism has not been explored further.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 7. Sustained levels of pCREB are regulated by a caspase-dependent mechanism. Phosphorylated CREB levels on serine 133 (pCREB S133) and total amount of CREB (N-CREB) were monitored by Western blot. A) Neurons at 5 days in vitro were cultured in HK medium (30 mM) and switched to LK medium (5 mM) for the indicated times. The graph represents quantification ± SE of 3 independent experiments as described in Fig. 4 . *P<0.05 and **P<0.01: a statistically significant difference when compared to the 15 min LK time point (ANOVA, followed by a Student-Newman-Keuls multiple comparison test). B) Cerebellar granule cells were switched from HK to LK during indicated times in the absence or presence of caspase inhibitors (50 µM) as indicated. C) cells were maintained in HK medium in the absence (ct) or presence of nifedipine (1 µM) or omega-conotoxin MVIIC (3 µM) for 6 h, or switched to LK medium (6 h) in the absence (ct) or presence of FPL (1 µM). The graph represents the quantification ± SE of 3 independent experiments as described in Fig. 4 . *P<0,05 and **P<0.01 indicate a statistically significant difference when compared to control HK (ANOVA, followed by a Student-Newman-Keuls multiple comparison test).

To test whether caspase activity contributed to the time-dependent reduction in pCREB, the effects of Z-VAD-fmk and Z-DEVD-fmk were examined under LK conditions. Both inhibitors almost completely abolished the decline in pCREB from the original level in LK at 15 min after the switch. The overlapping kinetics in the pCREB reduction and CaMKIV degradation indicated that caspase-3-dependent CaMKIV cleavage may have interfered with the maintenance of CREB phosphorylation. We thus measured the effect of bidirectional manipulation of L-type Ca2+ channel activity on long-term maintenance of pCREB level at 6 h of treatment, a time point when N-CREB levels are constant (Fig. 7C ). In keeping with our data on CaMKIV cleavage, a shift from HK to LK or closure of L-type Ca2+ channels in HK with nifedipine incapacitated pCREB stabilization, whereas FPL64176 treatment in LK in part restored pCREB levels (Fig. 7C ). Treatment with the N-P/Q-type calcium channels blocker MVIIC induces a slight decrease in pCREB levels (P<0.05).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Role of voltage-dependent calcium entry in prevention of neuronal apoptosis
Numerous studies highlight the important role of depolarization and calcium entry for neuronal survival (15 , 16 , 21 , 39) . Furthermore, the team of Ogura demonstrated the key role of calcium turnover in depolarized granule cells survival (40 , 41) . Calcium-dependent survival can also act dominantly over serum deprivation-induced apoptosis: in NG108 cells, serum deprivation-induced apoptosis was as efficiently blocked by NMDA receptor stimulation as by KCl depolarization. In NG108 cells, this calcium-dependent protection can be mimicked further by transfection of constitutively active CaMK kinase, which activates akt-mediated BAD phosphorylation (42) . The idea of a general neuroprotective role for voltage-dependent calcium entry is in line with our present data: blocking voltage-dependent calcium channels with nifedipine (but not with omega-conotoxin MVIIC) or by KCl deprivation induced apoptotic nuclei as well as induction of caspase-3-like activity. In contrast, opening the same voltage-dependent channels by FPL in LK conditions reduced the number of apoptotic cells and the LK-induced caspase-3-like activity. These results are in line with those of Moran et al. (43) , who observed a rise in caspase-3 mRNA when [Ca 2+] i is diminished in rat cerebellar granule cells. Our pharmacological study clearly implicates calcium entry through L-type (but not N/P/Q-type) voltage-dependent channels in caspase-3 activation. Further studies have been conducted to understand how these voltage-dependent calcium fluxes can promote neuronal survival. The calmodulin-dependent signaling pathway appeared to play a major role in neuroprotection since calmodulin inhibition impaired the neuroprotective effects of depolarization (16 , 17) . We show here that removal of the depolarizing neurotrophic stimulation or blockade of calcium entry through voltage-dependent channels exerts distinct and specific effects on CaMKII and IV, two major effectors of the calcium-dependent signaling pathway. Whereas the levels of CaMKII remained constant throughout the early step of cell death (until ~18 h), CaMKIV levels dramatically declined within a few hours. This observation clearly raised the question of whether the distinct fate of these two calcium signaling molecules had some functional relevance on K+ deprivation-induced apoptosis.

CaMKIV cleavage by a caspase-3-like protease: a turnoff of a survival pathway
In this work we showed that CaMKIV exerts primarily neuroprotective effects. Using transient transfection techniques (see Fig. 5 ), a dominant active form of CaMKIV protected cerebellar neurons from K+ deprivation-induced apoptosis whereas its dominant negative form induced apoptosis, even in depolarized neurons. These data thus agree with results reported in T cells by Anderson et al., who showed that an inactive form of CaMKIV, which is supposed to act in a dominant negative manner, significantly increased apoptosis (28 ; for a review, see ref 19 ). CaMKIV furthermore mediated the neuroprotective effects of the neurotrophin BDNF in cortical neurons (38) . The role for CaMKII in neuronal survival remains a wide open question. In our own study, transient transfection of DA-CaMKII exerted no discernible anti-apoptotic effect (Fig. 5C ). Furthermore, a tendency pointing a potential proapoptotic role for CaMKII was even detectable (Fig. 5C ), although this effect was not statistically significant. In preliminary experiments, KN-62 treatment under LK conditions in the absence of depolarization resulted in an apparent reduction in the number of cerebellar granule neurons with fragmented nuclei, also consistent with the possible existence of a KN-62-sensitive proapoptotic CaMK species. However, more work needs to be done in order to clarify this issue. Previous reports in the literature either indicated a strong proapoptotic role in several leukemia cell lines (44) and in cortical neurons (29) or, to the contrary, supported its neuroprotective effect in cerebellar granule cells (17) or in cortical neurons (45) .

Our finding that CaMKIV stability may be regulated by a caspase-dependent proteolysis falls in the general context explored by Widmann et al. (10) , who by testing the fate of 30 different proteins showed that caspase-dependent cleavage during apoptosis inactivated certain neuroprotective proteins while activating death-promoting proteins (e.g., activation of caspases themselves). Our results point to the possibility that the caspase-dependent cleavage of CaMKIV, but not CaMKII, may represent an irreversible turn off of a survival pathway (here the calcium-dependent survival pathway) that could otherwise interfere with the apoptotic process.

The signaling mechanism by which the state of depolarization and biological activity controls this dual regulation is largely unexplored in its fine details. Clearly, from our data, when K+ deprivation recruits caspases, specific VGCC are likely to play a role as a gate at the level of the cell membrane. Cleavage of CaMKs may represent a general mechanism activated during neuronal apoptosis since McGinnis et al. have shown that it also occurred in cortical neurons (37) . In their model of staurosporine-induced apoptosis, CaMKs were strongly and gradually cleaved within 24 h to a 55% loss of activity. In their model and in contrast to our results, CaMKII was also cleaved by a caspase-dependent mechanism. It seems unlikely that staurosporine recruits the same caspase-activating mechanism as K+ deprivation in cerebellar granule cells for two reasons. First, staurosporine operates on a longer time scale (24 vs. 6 h in cerebellar granule cells), and Marks and Berg reported a slower rise in caspase-3 activity with 1 µM staurosporine compared to the switch from HK to LK in cerebellar neurons (46) . Second, staurosporine leads to a cleavage of both CaMKIV and CaMKII, whereas K+ deprivation activates a mechanism that is restricted to CaMKIV.

In our model, the degradation of CaMKIV operated through a caspase-dependent mechanism (Fig. 4B ). Caspase inhibitors Z-DEVD-fmk and Z-VAD-fmk were very effective by inhibiting both CaMKIV fragmentation, caspase-3-like activity, and nuclear condensation. However, inhibition of fragmentation and nuclear condensation were more effective in the presence of the broad-range caspase inhibitor Z-VAD-fmk than with the specific caspase-3-like inhibitor Z-DEVD-fmk. This raises the question of the specificity of caspase that cleaves CaMKIV. Based on our results, it appeared that CaMKIV was cleaved mainly by a DEVD-sensitive caspase, but we cannot exclude the possibility that other caspases may contribute as well.

Functional consequence of CaMKIV cleavage: impairment of CREB phosphorylation
CaMKIV mediates Ca2+-dependent stimulation of gene transcription through phosphorylation of the serine 133 residue of the transcription factor CREB (cAMP-responsive element binding protein) (31 , 47) . As expected, we show that switching culture medium from HK to LK quickly reduced the level of pCREB (15 min). However, this lower level of pCREB remained constant for 4 h, after which it progressively declined in parallel with the degradation of CaMKIV. Inhibition of CaMKIV degradation also inhibited the delayed decrease of pCREB. Since pCREB and CaMKIV decreased with the same kinetics and were both sensitive to caspase antagonists, CaMKIV was likely to be implicated in the maintenance of the basal phosphorylation state (and resulting transcriptional activity) of CREB. In control experiments with antibodies recognizing CREB independently of its state of phosphorylation (N-CREB), we showed that the delayed decline in pCREB (between 4 and 6 h of potassium deprivation) is not due to the degradation of CREB. However, after 8 h of LK treatment, N-CREB levels also started to slowly decrease by a caspase-dependent mechanism, further decreasing the level of pCREB.

Similarly, a long-term nifedipine treatment (6 h) dramatically reduced the long-term pCREB content, without affecting N-CREB levels. This strong impairment in the maintenance of CREB phosphorylation in the presence of nifedipine was also partially reversed by caspase inhibitors, confirming that the reduction in pCREB levels resulted not only from a decrease in the Ca2+/calmodulin-dependent activation of the kinase, but also from a loss of CaMKIV stability. The N- and P/Q-type calcium channels blocker omega-conotoxin MVIIC had a small effect on the rapid but not the delayed phase of pCREB level control, in contrast to the known abundance of these channels that far exceeds L-type channels in the cerebellar granule cells (48) . The minor inhibition of CREB phosphorylation by omega-conotoxin MVIIC apparently had no effect on cell survival; omega-conotoxin did not induce caspase-3-like activity nor produce any other apoptotic feature such as nuclear condensation. Thus, only the later decrease in pCREB level is directly associated with the apoptotic process. The relative selectivity and specificity of the VGCC type involved in pCREB regulation may be explained, at least in part, by the difference in the activation/inactivation kinetics and voltage dependence of each channel type (49) .

It is known that CaMKIV regulates CREB-dependent gene transcription in response to KCl depolarization (24) . Among these genes, there is a good evidence for involvement of CaMKIV in transcriptional regulation of the BDNF gene through phosphorylation of a CREB family member (26 , 27 , 50) . Based on our results, the decrease in sustained pCREB levels due to CaMKIV degradation could be a reinforcement mechanism that significantly contributes to the apoptosis signaling pathway by impairing the transcription of neuroprotective genes like BDNF.

In summary, we showed that, in cerebellar granule cells, calcium entry through L-type voltage gated calcium channels supports neuronal survival in a CaMKIV-dependent manner (Fig. 8 ). When cells entered apoptosis, the increase in caspase-3-like activity led to the specific cleavage of CaMKIV, whose kinase activity was found to be necessary and sufficient to sustain survival. The time-dependent degradation of CaMKIV may account at least in part for the irreversible nature of apoptosis under low K+ conditions. Reversal of CaMKIV down-regulation by caspase inhibitors restored survival as well as the sustained phosphorylation level of CREB Ser-133, consistent with the idea that transcription of CREB-dependent genes (such as BDNF, for example) may contribute to neuronal survival.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 8. Model of CaMKIV-dependent neuroprotection. Calcium entry through L-type voltage-gated channels associated with intense bioelectrical activity (experimentally mimicked by chronic depolarization with HK) supports neuronal survival through activation of CaMKIV. This enzyme maintains CREB transcription factor in a phosphorylated state (+++) that is thought to induce neuroprotective genes. The drop in [Ca2+]i initiated by a switch from chronic depolarization (HK) to nondepolarization (LK) turns CaMKIV activity down to its basal activity. We propose that this activity is sufficient enough to keep low pCREB levels (+), still ensuring neuroprotection. Rapid increase in caspases activity in nondepolarizing conditions then progressively leads to the specific cleavage of CaMKIV with time and levels of phosphorylated CREB further decrease (- - -) following the same time course. The lack of CREB-dependent gene transcription would then reinforce the apoptotic signaling pathway. The time-dependent degradation of CaMKIV might define a restriction point where the apoptotic program is irreversibly engaged. At this time point, where CaMKIV is degraded, switching back to depolarized culture conditions cannot rescue the neurons because the calcium-dependent signaling pathway is interrupted.


   ACKNOWLEDGMENTS
 
We thank Richard Maurer (Oregon Health Science University) for providing the original constructs for DA-CaMKII and CaMKIV, Tomoyuki Furuyashiki and Shuh Narumiya (Kyoto University) for much advice and encouragement, and Yukiko Gotoh (University of Tokyo) for critical reading of an earlier version of the manuscript. We are grateful to Xavier Gidrol (French Embassy at Tokyo) and a Louis-Pasteur University/Kyoto University International Exchange Program for providing assistance to the collaboration between the Loeffler and Bito labs. This work was supported by ARC (no. 9821), Ligue contre le cancer and Région Alsace (J.P.L.), by Grants-in Aid from the Ministry of Education, Science, Sports and Culture of Japan (H.B.), and by Grants from the Japan Brain Foundation, the Ube Industries Research Foundation, and the Tokyo Biochemical Research Foundation and the Narishige Research Foundation (H.B.). V.S. is supported by the Ministère de la Recherche et de l’Enseignement Supérieur.

Received for publication March 17, 2000. Revision received June 26, 2000.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Loo, D. T., Copani, A., Pike, C. J., Whittemore, E. R., Walencewicz, A. J., Cotman, C. W. (1993) Apoptosis is induced by B-amyloid in cultured central nervous system neurons. Proc. Natl. Acad. Sci. USA 90,7951-7955[Abstract/Free Full Text]
  2. Portera, C. C., Hedreen, J. C., Price, D. L., Koliatsos, V. E. (1995) Evidence for apoptotic cell death in Huntington disease and excitotoxic animal models. J. Neurosci. ,3775-3787
  3. Roy, N., Mahadevan, M. S., McLean, M., Shutler, G., Yaraghi, Z., Farahani, R., Baird, S., Besner, J. A., Lefebvre, C., Kang, X., et al (1995) The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell 80,167-178[Medline]
  4. D’Mello, S., Galli, C., Ciotti, T., Calissano, P. (1993) Induction od apoptosis in cerebellar granule neurons by low potassium: inhibition of death by insulin-like growth factor I and cAMP. Proc. Natl. Acad. Sci. USA 90,10989-10993[Abstract/Free Full Text]
  5. Schulz, J. B., Weller, M., Klockgether, T. (1996) Potassium deprivation-induced apoptosis of cerebellar granule neurons: a sequential requirement for new mRNA and protein synthesis, ICE-like protease activity, and reactive oxygen species. J. Neurosci. 16,4696-4706[Abstract/Free Full Text]
  6. Nardi, N., Avidan, G., Daily, D., Zilkha, F. R., Barzilai, A. (1997) Biochemical and temporal analysis of events associated with apoptosis induced by lowering the extracellular potassium concentration in mouse cerebellar granule neurons. J. Neurochem. 68,750-759[Medline]
  7. Kienlen-Campard, P., Crochemore, C., René, F., Monnier, D., Koch, B., Loeffler, J. P. (1997) PACAP type I receptor activation promotes cerebellar neurons survival through the cAMP/PKA signalling pathway. DNA Cell Biol 16,323-333[Medline]
  8. Ellis, R. E., Yuan, J. Y., Horvitz, H. R. (1991) Mechanisms and functions of cell death. Annu. Rev. Cell Biol. 7,663-698
  9. Martin, S. J., Green, D. R. (1995) Protease activation during apoptosis: death by a thousand cuts?. Cell 82,349-352[Medline]
  10. Widmann, C., Gibson, S., Johnson, G. L. (1998) Caspase-dependent cleavage of signaling proteins during apoptosis. A turn-off mechanism for anti-apoptotic signals. J. Biol. Chem. 273,7141-7147[Abstract/Free Full Text]
  11. Alnemri, E. S., Livingston, D. J., Nicholson, D. W., Salvesen, G., Thornberry, N. A., Wong, W. W., Yuan, J. (1996) Human ICE/CED-3 protease nomenclature. Cell 87,171[Medline]
  12. Armstrong, R. C., Aja, T. J., Hoang, K. D., Gaur, S., Bai, X., Alnemri, E. S., Litwack, G., Karanewsky, D. S., Fritz, L. C., Tomaselli, K. J. (1997) Activation of the CED3/ICE-related protease CPP32 in cerebellar granule neurons undergoing apoptosis but not necrosis. J. Neurosci. 17,553-562[Abstract/Free Full Text]
  13. Eldadah, B. A., Yakovlev, A. G., Faden, A. I. (1997) The role of CED-3-related cysteine proteases in apoptosis of cerebellar granule cells. J. Neurosci. 17,6105-6113[Abstract/Free Full Text]
  14. Tanabe, H., Eguchi, Y., Shimizu, S., Martinou, J. C., Tsujimoto, Y. (1998) Death-signalling cascade in mouse cerebellar granule neurons. Eur. J. Neurosci. 10,1403-1411[Medline]
  15. Gallo, V., Kingsbury, A., Balazs, R., Jergensen, O. S. (1987) The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J. Neurosci. 7,2203-2213[Abstract]
  16. Boutillier, A. L., Kienlen, C. P., Loeffler, J. P. (1999) Depolarization regulates cyclin D1 degradation and neuronal apoptosis: a hypothesis about the role of the ubiquitin/proteasome signalling pathway. Eur. J. Neurosci. 11,441-448[Medline]
  17. Hack, N., Hidaka, H., Wakefield, M. J., Balazs, R. (1993) Promotion of granule cell survival by high K+ or excitatory amino acid treatment and Ca2+/calmodulin-dependent protein kinase activity. Neuroscience 57,9-20[Medline]
  18. Schulman, H. (1993) The multifunctional Ca2+/calmodulin-dependent protein kinases. Curr. Opin. Cell Biol. 5,247-253[Medline]
  19. Soderling, T. R. (1999) The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem. Sci. 24,232-236[Medline]
  20. Sheng, M., McFadden, G., Greenberg, M. E. (1990) Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4,571-582[Medline]
  21. Finkbeiner, S., Greenberg, M. E. (1996) Ca2+-dependent routes to ras: mechanisms for neuronal survival differentiation and plasticity. Neuron 16,233-236[Medline]
  22. Bito, H., Deisseroth, K., Tsien, R. W. (1997) Ca2+-dependent regulation in neuronal gene expression. Curr. Opin. Neurobiol. 7,419-429[Medline]
  23. Heist, E. K., Schulman, H. (1998) The role of Ca2+/calmodulin-dependent protein kinases within the nucleus. Cell Calcium 23,103-114[Medline]
  24. Bito, H., Deisseroth, K., Tsien, R. W. (1996) CREB phosphorylation and dephosphorylation: a Ca2+- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87,1203-1214[Medline]
  25. Hardingham, G. E., Chawla, S., Cruzalegui, F. H., Bading, H. (1999) Control of recruitment and transcription-activating function of CBP determines gene regulation by NMDA receptors and L-type calcium channels. Neuron 22,789-798[Medline]
  26. Tao, X., Finkbeiner, S., Arnold, D. B., Shaywitz, A. J., Greenberg, M. E. (1998) Ca2+ influx regulates BDNF transcription by a CREB transcription factor-dependent mechanism. Neuron 20,709-726[Medline]
  27. Shieh, P. B., Hu, S.-C., Bobb, K., Timmusk, T., Ghosh, A. (1998) Identification of a signaling pathway involved in calcium regulation of BDNF expression. Neuron 20,727-740[Medline]
  28. Anderson, K. A., Ribar, T. J., Illario, M., Means, A. R. (1997) Defective survival and activation of thymocytes in transgenic mice expressing a catalytically inactive form of Ca2+/calmodulin-dependent protein kinase IV. Mol. Endocrinol. 11,725-737[Abstract/Free Full Text]
  29. Hajimohammadreza, I., Probert, A. W., Coughenour, L. L., Borosky, S. A., Marcoux, F. W., Boxer, P. A., Wang, K. K. (1995) A specific inhibitor of calcium/calmodulin-dependent protein kinase-II provides neuroprotection against NMDA- and hypoxia/hypoglycemia-induced cell death. J. Neurosci. ,4093-4101
  30. Schousboe, A., Meier, E., Drejer, J., Hertz, L. (1989) Shahar, A. de Vellis, J. Vernadakis, A. Bito, H. eds. A Dissection and Culture Manual for the Nervous System ,203-206 Alan R. Liss New York.
  31. Sun, P., Enslen, H., Myung, P. S., Maurer, R. A. (1994) Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity. Genes Dev 8,2527-2539[Abstract/Free Full Text]
  32. Villarroel, A., Regalado, M. P. (1997) A fast and simple method to introduce multiple distant point mutations (Trends Pharmacol. Sci. Online T40068). Trends Genet 13,164
  33. Boussif, O., Lezoualc’h, F., Zanta, M. A., Mergny, M. D., Sherman, D., Demeinex, B., Behr, J. P. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc. Natl. Acad. Sci. USA 92,7297-7301[Abstract/Free Full Text]
  34. Brugg, B., Michel, P. P., Agid, Y., Ruberg, M. (1996) Ceramide induces apoptosis in cultured mesencephalic neurons. J. Neurochem. 66,733-739[Medline]
  35. Przywara, D. A., Kulkarni, J. S., Wakade, T. D., Leontiev, D. V., Wakade, A. R. (1998) Pituitary adenylyl cyclase-activating polypeptide and nerve growth factor use the proteasome to rescue nerve growth factor-deprived sympathetic neurons cultured from chick embryos. J. Neurochem. 71,1889-1897[Medline]
  36. Tanabe, H., Eguchi, Y., Kamada, S., Martinou, J. C., Tsujimoto, Y. (1997) Susceptibility of cerebellar granule neurons derived from Bcl-2-deficient and transgenic mice to cell death. Eur. J. Neurosci. 9,848-856[Medline]
  37. McGinnis, K. M., Whitton, M. M., Gnegy, M. E., Wang, K. K. (1998) Calcium/calmodulin-dependent protein kinase IV is cleaved by caspase-3 and calpain in SH-SY5Y human neuroblastoma cells undergoing apoptosis. J. Biol. Chem. 273,19993-20000[Abstract/Free Full Text]
  38. Finkbeiner, S., Tavazoie, S. F., Maloratsky, A., Jacobs, K. M., Harris, K. M., Greenberg, M. E. (1997) CREB: a major mediator of neuronal neurotrophin responses. Neuron 19,1031-1047[Medline]
  39. Barthel, F., Boutillier, A. L., Trouslard, J., Loeffler, J. P. (1996) Fine tuning of calcium entry into neurons regulates adenosine 3',5'-monophosphate-dependent transcription by several distinct mechanisms. Neuroscience 70,1053-1065[Medline]
  40. Kohara, K., Ono, T., Tominaga, Y. K., Shimonaga, T., Kawashima, S., Ogura, A. (1998) Activity-dependent survival and enhanced turnover of calcium in cultured rat cerebellar granule neurons. Brain Res 809,231-237[Medline]
  41. Ono, T., Kudo, Y., Kohara, K., Kawashima, S., Ogura, A. (1997) Activity-dependent survival of rat cerebellar granule neurons is not associated with sustained elevation of intracellular Ca2+. Neurosci. Lett. 228,123-126[Medline]
  42. Yano, S., Tokumitsu, H., Soderling, T. R. (1998) Calcium promotes cell survival through CaM-K kinase activation of the protein-kinase-B pathway. Nature (London) 396,584-587[Medline]
  43. Moran, J., Itoh, T., Reddy, U. R., Chen, M., Alnemri, E. S., Pleasure, D. (1999) Caspase-3 expression by cerebellar granule neurons is regulated by calcium and cyclic AMP. J. Neurochem. 73,568-577[Medline]
  44. Wright, S. C., Schellenberger, U., Ji, L., Wang, H., Larrick, J. W. (1997) Calmodulin-dependent protein kinase II mediates signal transduction in apoptosis. FASEB J 11,843-849[Abstract]
  45. Churn, S. B., Sombati, S., Taft, W. C., DeLorenzo, R. J. (1993) Excitotoxicity affects membrane potential and calmodulin kinase II activity in cultured rat cortical neurons. Stroke 24,271-277(discussion: pp. 277–278)[Abstract/Free Full Text]
  46. Marks, N., Berg, M. J. (1999) Recent advances on neuronal caspases in development and neurodegeneration. Neurochem. Int. 35,195-220[Medline]
  47. Matthews, R. P., Guthrie, C. R., Wailes, L. M., Zhao, X., Means, A. R., McKnight, G. S. (1994) Calcium/calmodulin-dependent protein kinase types II and IV differentially regulate CREB-dependent gene expression. Mol. Cell. Biol. 14,6107-6116[Abstract/Free Full Text]
  48. Randall, A., Tsien, R. W. (1995) Pharmacological dissection of multiple types of Ca2+ channel currents in rat cerebellar granule neurons. J. Neurosci. 15,2995-3012[Abstract]
  49. Mermelstein, P., Bito, H., Deisseroth, K., Tsien, R. W. (2000) Critical dependence of CREB phosphorylation on L-type calcium channels supports a selective response to EPSPs rather than action potentials. J. Neurosci. 20,266-273[Abstract/Free Full Text]
  50. Murray, K. D., Hayes, V. Y., Gall, C. M., Isackson, P. J. (1998) Attenuation of the seizure-induced expression of BDNF mRNA in adult rat brain by an inhibitor of calcium/calmodulin-dependent protein kinases. Eur. J. Neurosci. 10,377-387[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. M. Feliciano and A. M. Edelman
Repression of Ca2+/Calmodulin-dependent Protein Kinase IV Signaling Accelerates Retinoic Acid-induced Differentiation of Human Neuroblastoma Cells
J. Biol. Chem., September 25, 2009; 284(39): 26466 - 26481.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Kokubo, M. Nishio, T. J. Ribar, K. A. Anderson, A. E. West, and A. R. Means
BDNF-Mediated Cerebellar Granule Cell Development Is Impaired in Mice Null for CaMKK2 or CaMKIV
J. Neurosci., July 15, 2009; 29(28): 8901 - 8913.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Yuan, S. Gong, J. Luo, Z. Zheng, B. Song, S. Ma, J. Guo, C. Hu, G. Thiel, C. Vinson, et al.
Opposing Roles for ATF2 and c-Fos in c-Jun-Mediated Neuronal Apoptosis
Mol. Cell. Biol., May 1, 2009; 29(9): 2431 - 2442.
[Abstract] [Full Text] [PDF]


Home page
CSH ProtocolsHome page
P. M. Bilimoria and A. Bonni
Cultures of Cerebellar Granule Neurons
CSH Protocols, December 1, 2008; 2008(13): pdb.prot5107 - pdb.prot5107.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. J. Perez-Garcia, M. Gou-Fabregas, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler
Neuroprotection by Neurotrophic Factors and Membrane Depolarization Is Regulated by Calmodulin Kinase IV
J. Biol. Chem., February 15, 2008; 283(7): 4133 - 4144.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
T.-Y. Lee, K.-L. Tsai, W.-S. Lee, and C. Hsu
The molecular events occur during MK-801-induced cytochrome oxidase subunit II down-regulation in GT1-7 cells
J. Mol. Endocrinol., July 1, 2007; 39(1): 53 - 66.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ohmae, S. Takemoto-Kimura, M. Okamura, A. Adachi-Morishima, M. Nonaka, T. Fuse, S. Kida, M. Tanji, T. Furuyashiki, Y. Arakawa, et al.
Molecular Identification and Characterization of a Family of Kinases with Homology to Ca2+/Calmodulin-dependent Protein Kinases I/IV
J. Biol. Chem., July 21, 2006; 281(29): 20427 - 20439.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. E. Morrison, N. Majdzadeh, X. Zhang, A. Lyles, R. Bassel-Duby, E. N. Olson, and S. R. D'Mello
Neuroprotection by Histone Deacetylase-Related Protein
Mol. Cell. Biol., May 1, 2006; 26(9): 3550 - 3564.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
J. XIE, C. JAN, P. STOILOV, J. PARK, and D. L. BLACK
A consensus CaMK IV-responsive RNA sequence mediates regulation of alternative exons in neurons
RNA, December 1, 2005; 11(12): 1825 - 1834.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. B. Benedito, M. Lehtinen, R. Massol, U. G. Lopes, T. Kirchhausen, A. Rao, and A. Bonni
The Transcription Factor NFAT3 Mediates Neuronal Survival
J. Biol. Chem., January 28, 2005; 280(4): 2818 - 2825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Tremper-Wells and M. L. Vallano
Nuclear Calpain Regulates Ca2+-dependent Signaling via Proteolysis of Nuclear Ca2+/Calmodulin-dependent Protein Kinase Type IV in Cultured Neurons
J. Biol. Chem., January 21, 2005; 280(3): 2165 - 2175.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
V. See, N. K.M. Rajala, D. G. Spiller, and M. R.H. White
Calcium-dependent regulation of the cell cycle via a novel MAPK-NF-{kappa}B pathway in Swiss 3T3 cells
J. Cell Biol., August 30, 2004; 166(5): 661 - 672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Perez-Garcia, V. Cena, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler
Glial Cell Line-derived Neurotrophic Factor Increases Intracellular Calcium Concentration: ROLE OF CALCIUM/CALMODULIN IN THE ACTIVATION OF THE PHOSPHATIDYLINOSITOL 3-KINASE PATHWAY
J. Biol. Chem., February 13, 2004; 279(7): 6132 - 6142.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Lalonde, P. E. D. Lachance, and A. Chaudhuri
Monocular Enucleation Induces Nuclear Localization of Calcium/Calmodulin-Dependent Protein Kinase IV in Cortical Interneurons of Adult Monkey Area V1
J. Neurosci., January 14, 2004; 24(2): 554 - 564.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Linseman, C. M. Bartley, S. S. Le, T. A. Laessig, R. J. Bouchard, M. K. Meintzer, M. Li, and K. A. Heidenreich
Inactivation of the Myocyte Enhancer Factor-2 Repressor Histone Deacetylase-5 by Endogenous Ca2//Calmodulin-dependent Kinase II Promotes Depolarization-mediated Cerebellar Granule Neuron Survival
J. Biol. Chem., October 17, 2003; 278(42): 41472 - 41481.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Ono, N. Sekino-Suzuki, Y. Kikkawa, H. Yonekawa, and S. Kawashima
Alivin 1, a Novel Neuronal Activity-Dependent Gene, Inhibits Apoptosis and Promotes Survival of Cerebellar Granule Neurons
J. Neurosci., July 2, 2003; 23(13): 5887 - 5896.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Mbebi, V. See, L. Mercken, L. Pradier, U. Muller, and J.-P. Loeffler
Amyloid Precursor Protein Family-induced Neuronal Death Is Mediated by Impairment of the Neuroprotective Calcium/Calmodulin Protein Kinase IV-dependent Signaling Pathway
J. Biol. Chem., May 31, 2002; 277(23): 20979 - 20990.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. B. Hansen-Petrik, M. F. McEntee, B. Jull, H. Shi, M. B. Zemel, and J. Whelan
Prostaglandin E2 Protects Intestinal Tumors from Nonsteroidal Anti-inflammatory Drug-induced Regression in ApcMin/+ Mice
Cancer Res., January 1, 2002; 62(2): 403 - 408.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Mabuchi, K. Kitagawa, K. Kuwabara, K. Takasawa, T. Ohtsuki, Z. Xia, D. Storm, T. Yanagihara, M. Hori, and M. Matsumoto
Phosphorylation of cAMP Response Element-Binding Protein in Hippocampal Neurons as a Protective Response after Exposure to Glutamate In Vitro and Ischemia In Vivo
J. Neurosci., December 1, 2001; 21(23): 9204 - 9213.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. L. Tan, S.-L. Chan, K. O. Tan, and V. C. Yu
The Caenorhabditis elegans Sex-determining Protein FEM-2 and Its Human Homologue, hFEM-2, Are Ca2+/Calmodulin-dependent Protein Kinase Phosphatases That Promote Apoptosis
J. Biol. Chem., November 16, 2001; 276(47): 44193 - 44202.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kruidering, T. Schouten, G. I. Evan, and E. Vreugdenhil
Caspase-mediated Cleavage of the Ca2+/Calmodulin-dependent Protein Kinase-like Kinase Facilitates Neuronal Apoptosis
J. Biol. Chem., October 12, 2001; 276(42): 38417 - 38425.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. See and J.-P. Loeffler
Oxidative Stress Induces Neuronal Death by Recruiting a Protease and Phosphatase-gated Mechanism
J. Biol. Chem., September 7, 2001; 276(37): 35049 - 35059.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Fladmark, O. T. Brustugun, G. Mellgren, C. Krakstad, R. Boe, O. K. Vintermyr, H. Schulman, and S. O. Doskeland
Ca2+/Calmodulin-dependent Protein Kinase II Is Required for Microcystin-induced Apoptosis
J. Biol. Chem., January 18, 2002; 277(4): 2804 - 2811.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SÉE, V.
Right arrow Articles by LOEFFLER, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SÉE, V.
Right arrow Articles by LOEFFLER, J.-P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS