|
|
||||||||


* Université Louis Pasteur, UMR 7519 CNRS, IPCB, 67084 Strasbourg Cedex, France;
Department of Pharmacology, Kyoto University Faculty of Medicine, Sakyo-ku, Kyoto 606-8315, Japan
1Correspondence: Université Louis Pasteur-UMR 7519 CNRS, 21, rue René Descartes, 67084 Strasbourg Cedex, France. E-mail: loeffler{at}neurochem.u-strasbg.fr
| ABSTRACT |
|---|
|
|
|---|
Key Words: CPP32/caspase-3 cAMP-responsive element binding protein (CREB) calcium channels nuclear condensation gene transfer
| INTRODUCTION |
|---|
|
|
|---|
Caspases, a group of cysteine proteases related to the cell death
protein CED3 in Caernohabditis elegans (8)
are
the main players in the proteolytic cascade activated during apoptosis.
They cleave a wide range of substrates at a site next to an aspartate
residue (9)
. The proteins that are targeted specifically
for degradation by caspases are believed to play some vital role in the
apoptotic process (10)
. The caspase family comprises 15
members divided into 3 groups: the caspase-1 (-like), caspase-2
(-like), and caspase-3 (-like) protease subfamilies (11)
.
Caspase-3 (-like) protease activation has been observed in various
apoptotic cell death events. Several groups of investigators have
recently reported that caspases may be involved in the death of
cerebellar granule neurons induced by serum or potassium deprivation
(5
, 12
13
14)
.
Previous studies have suggested that depolarization under HK and
subsequent Ca2+ entry helps to sustain the
survival of granule cells. Furthermore, calmodulin seems to be a key
effector in calcium promoted cell survival (15
, 16)
.
Calcium/calmodulin-dependent protein kinases (CaMKs) appear to be good
candidates for mediating calcium and calmodulin effects (16
, 17)
. CaMK types II and IV are serine/threonine kinases that are
expressed in cerebellar granule neurons. They have a highly homologous
catalytic domain adjacent to a regulatory region that contains an
overlapping autoinhibitory domain (AID) and a calmodulin binding domain
(CBD) (for a review, see refs 18
, 19
). CaMKs phosphorylate
a large variety of substrates and are implicated in the control of gene
transcription by phosphorylating several transcription factors
(20
21
22
23)
. Studies in hippocampal neurons indicate that
CaMKIV regulates CREB-dependent gene transcription in response to
electrical stimulation or KCl depolarization (24
25
26)
.
There is also good evidence for the involvement of CaMKIV in
transcriptional regulation of the BDNF gene through phosphorylation of
a CREB family member (26
, 27)
. Several reports have
indicated that CaMKII and IV modulate apoptosis (28
, 29)
.
Here we investigate the potential function and the proteolytic fate of
two mediators of the calcium signaling cascade, CaMKII and CaMKIV,
during cerebellar granule cell apoptosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents and antibodies
The various peptidic protease inhibitors Ac-YVAD-CHO
(N-Acetyl-Tyr-Val-Ala-Asp-aldehyde), Z-DEVD-fmk
(benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone), Z-VAD-fmk
(benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone), and the substrate
Ac-DEVD-AMC
(N-Acetyl-Asp-Glu-Val-Asp-7-Amino-4-methyl-coumarin) were
purchased from Calbiochem (La Jolla, Calif.). PEI 25 kDa
(polyethylenimine) was purchased from Sigma. FPL64176 was from RBI
(Natick, Mass.) and omega-conotoxin MVIIC was from Peptide Institute
(Osaka, Japan).
Monoclonal antibodies against CaMKIV and CaMKII were obtained from Transduction Laboratories (Lexington, Ky.) and Boehringer (Mannheim, Germany), respectively. Rabbit polyclonal antibodies against P-CREB and N-CREB were from Upstate Biotechnology (Lake Placid, N.Y.). Polyclonal antibody against Hemagglutinin (HA) (Y-11) was from Santa Cruz Biotechnology (Santa Cruz, Calif.). Horseradish peroxidase (HRP) -conjugated secondary antibodies, goat anti-rabbit IgG, and sheep anti-mouse IgG were purchased from Pierce (Rockford, Ill.). Cy3-conjugated secondary antibody, goat anti-rabbit was from Jackson ImmunoResearch (West Grove, Pa.).
Western blot analysis
Forty micrograms of total cell extract in sample buffer (62.5 mM
Tris HCl, pH 6.8, 10% glycerol, 1% sodium dodecyl sulfate (SDS), 1%
ß-mercaptoethanol, 0.1% bromphenol blue) were loaded on a 10%
SDS-polyacrylamide gel. Proteins were blotted onto a pure
nitrocellulose membrane (0.45 µm; Bio-Rad, Hercules, Calif.).
Unspecific labeling was blocked in 10% blotto (10% non-fat dry milk,
150 mM Tris HCl, pH 7.4, 50 mM NaCl, 0.05% Tween 20) for 1 h and
membranes were incubated overnight at 4°C with the appropriate
primary antibody diluted in 3% blotto. After three washes, membranes
were incubated for 2 h at room temperature with a 1/2000 dilution
of anti-mouse IgG, HRP-conjugated whole sheep antibody (Amersham,
Arlington Heights, Ill.) or with 1/5000 anti-rabbit IgG (Pierce),
followed by three more washes, and specific bands were detected by ECL
(Amersham). Blots were exposed for the indicated duration with
BIOMAX-MR KODAK films. All the Western blots were performed at least
three times.
Constructions of CaMKs expressing vectors and transfections
Construction of plasmids
Vectors expressing dominant active (DA) forms of CaMKIV
and CaMKII are derived from vectors previously described by Maurer et
al. (31)
. Sequence coding for the DA proteins were
polymerase chain reaction (PCR) amplified using primers: (for
CaMKII: 5'CGTGATATCGCCACCATGGGATACCCTTACGATGTTCCTGATTACGCTGCGTCGACCATGGCTACCATCACCTGCACCCGA3';
3'TGTCCTCTGGCACCTGACGGACACTCGCCGGCGTAC5'; for CaMKIV:
5'CGTGATATCGCCACCATGGGATACCCTTACGATGTTCCTGATTACGCTGCGTCGACCATGCTCAAAGTCACGGTCC-CT3';
3'CTGTGACGAGTCTTCTTTGAAACTCGCCGGCGTAC5'), where the HA
epitope was introduced with the 5' primer. These PCR products were then
subcloned in a pIRES-EGFP vector (Clontech, Palo Alto, Calif.)
downstream of the CMV promoter.
A dominant negative form of CaMKIV was generated from the DA form
by introducing two mutations (Lys71Glu, Thr196Ala), which renders
it kinase-dead and nonphosphorylatable by CaMKK. A PCR-mediated point
mutation method was used as described (32)
. Briefly, this
method is based on the amplification by PCR of two overlapping
fragments, both of which included a mismatch that introduced
a desired mutation (primers: Lys71Glu:
5'AGCCCTATGCTCTCTCGAAGTGTTAAAGAAAAC3';
5'GTTTTCTTTAACACTTCGAGAGCCATAGGGCT3'; Thr 196 Ala:
5'TCAAGTGCTCATGAAGGCAGTGTGTGGAACCC3';
5'GGGTTCCACACACTGCCTTCATGAGCACTTGA3').
In a second PCR round, the two fragments were mixed with the
primers at the most 5' and 3' ends, resulting in a joined product that
was then subcloned in the pIRES-EGFP vector (Clontech).
In preliminary control experiments, the functionality of all constructs
was tested by their ability to modulate gene transcription. Dominant
activator of CaMKIV (DA-CaMKIV) was able to induce CREB-dependent
luciferase activity in a CREB/Gal4 luc reporter system, as described
previously (31)
. Both DA-CaMKIV and dominant activator of
CaMKII (DA-CaMKII) were able to induce fos-luc reporter gene
in cerebellar granule neurons. The dominant negative form of CaMKIV was
shown to inhibit depolarization-induced Gal4-CREB activation in
cerebellar granule cells. We performed competition experiments in PC12
cells where increasing concentrations of DN-CaMKIV progressively
inhibited DA-CaMKIV-stimulated transcription from the
CRE-luc reporter gene (unpublished data).
Gene transfer
Neuronal gene transfer was performed as reported previously,
using PEI (25K) as DNA carrier (33)
. Three DIV cell
cultures on glass coverslips in 12-well plates were transfected for 30
min with 1 µg/ml of expression vector. Plates were spun for 5 min at
1500 rpm. Twenty-four hours after transfection in HK, neurons were
K+-deprived for 11 h when indicated.
Apoptotic nuclei were visualized by Hoechst staining and transfected
cells were revealed by immunocytochemistry using an anti-HA antibody
(Y-11).
Hoechst staining
Condensed and fragmented nuclei were evaluated in
situ in the cells (34)
, by intercalation into nuclear
DNA of the fluorescent probe bisbenzimide: Hoechst 33342 (Sigma). After
fixation with 4% paraformaldehyde in phosphate-buffered saline (PBS)
for 30 min, cells were incubated with the Hoechst dye 33342 at 1
µg/ml for 45 min at room temperature. Hoechst is visualized with AMCA
filter (excitation 350 nm, emission 450 nm), is cell permeant, and
labels both intact and apoptotic nuclei. Apoptosis was observed as
small, bright-staining nuclei, often very rounded, and usually
fragmented into distinct sections. The percentage of fragmented nuclei
was evaluated under each condition, by counting cells in at least 10
randomly chosen field with a 40x objective.
Statistical analysis
Statistical analyses were performed for all Western blot
experiments and Hoechst countings. The significance of the data was
assessed by analysis of variance (ANOVA), followed by the
Student-Newman-Keuls test for multiple comparisons using Graphpads
Instat 2 software.
Immunocytochemistry
After fixation and Hoechst staining as described above, cells
were washed and blocked for 10 min in PBS-merthiolate 0.02% containing
0.1% Triton X-100 and 5% sheep serum. Cells were subsequently
incubated with primary antibodies diluted in the same buffer (Y-11,
1/400). After three washes, immunostaining was detected with a goat
anti-rabbit Cy3-labeled secondary antibody (1/400). Staining was
visualized with a Leica microscope using a rhodamine filter and
photographs were taken with Kodak TMAX 320 film.
Caspase activity measurements
Caspase activities were determined as described previously by
Przywara et al. (35)
by measuring the release of
7-amino-4-methylcoumarin (AMC) from the caspase tetrapeptide CPP32
substrate DEVD-AMC (Calbiochem). Briefly, neurons grown in 30 mm
culture dishes were washed with PBS and lysed with 100 µl of lysis
buffer [0.5% Igepal NP-4 (Sigma), 0.5 mM EDTA, 150 mM NaCl, 50 mM
Tris pH 7.5] on ice. One portion of the lysate was used for protein
determination (Bradford method, Bio-Rad) and 50 µl of lysate was
added to a reaction mixture containing 100 µl of 2x reaction buffer
[20 mM HEPES pH 7.5, 50 mM NaCl, 2.5 mM DTT], 40 µl
H2O, and 10 µl of DEVD-AMC (final: 50 µM) and
incubated for 1 h at 37°C. The reaction was stopped by 10x
dilution with ice-cold lysis buffer. Fluorescence of free AMC was
measured using excitation and emission wavelengths of 360 and 465 nm,
respectively, using a Perkin-Elmer HTS 7000 Bioassay reader (Foster
City, Calif.). A standard curve of fluorescence vs. free AMC was used
to calculate amount of substrate cleaved per minute per milligram of
protein. Experiments were performed in duplicate and caspase activity
was expressed in µM of cleaved substrate · µg
protein-1 · min-1.
| RESULTS |
|---|
|
|
|---|
20% of the neurons showing
nucleus condensation (Fig. 1B
|
As described previously, shifting granule neurons from HK to LK
dramatically increased CPP32/caspase-3-like activity in a
time-dependent manner (Fig. 2
; refs 5
, 12
, 36
). Under our experimental conditions,
caspase-3-like activity increased after 3 h of LK treatment, with
a maximal activity at 10 h (11.5 µg of cleaved
substrate · µg
protein-1 · min-1)
followed by a progressive decline. This increase in caspase activity
was completely inhibited by 50 µM of a specific
CPP32/caspase-3-like inhibitor, Z-DEVD-fmk, and by a broad-range
caspase inhibitor, Z-VAD-fmk. A caspase-1-like inhibitor, ac-YVAD-CHO,
had no effect on caspase-3 activity, as expected. We next investigated
the changes of caspase-3-like activity in response to different
treatments modifying Ca2+ entries via VGCC. On
the one hand, treatment of neurons with 1 µM nifedipine produced a
robust activation of caspase activity similar to that obtained with a
switch to LK, whereas no rise in caspase-3-like activity was detected
in the presence of omega-conotoxin MVIIC (Fig. 2)
. On the other hand,
opening calcium L-type channels with FPL64176 in LK conditions
significantly reduced the LK-induced caspase-3 activity. Thus,
regulation of L-type Ca2+ channel activity
appears to have a strong impact on the initiation of the
caspase-3-dependent signaling cascade.
|
The effect of caspase inhibitors on nuclear condensation was further
examined (Fig. 3
). Application of 50 µM of Z-VAD-fmk completely inhibited nuclear
fragmentation induced by 18 h of LK exposure (Fig. 3C
),
whereas the more specific caspase-3 inhibitor (DEVD-fmk, 50 µM)
significantly reduced fragmentation by 25% (Fig. 3D
).
|
Caspase-3-like-dependent proteolysis of CaMKIV is induced by
potassium deprivation
We and others have shown that blockade of the
Ca2+/calmodulin signaling pathway induced
apoptosis in cerebellar granule neurons (15
, 16)
. We
examined the possibility that two effectors of the
Ca2+/calmodulin pathway, CaMKII and CaMKIV, may
be a target for caspases in LK-induced apoptosis of neurons. Indeed, a
number of regulators of apoptotic signaling have been shown to be
substrates of caspases in vitro and in vivo
(10)
, and CaMK type IV in particular has been shown to be
cleaved in several fragments by caspase- and calpain-dependent
mechanisms in a neuroblastoma cell line undergoing apoptosis
(37)
. CaMKII and CaMKIV were thus subjected to Western
blot analyses after K+ deprivation (Fig. 4A
, B
). Whereas CaMKII immunoreactivity did not change in
response to LK treatment (Fig. 4A
), a clear decrease in
total CaMKIV immunoreactivity was observed (Fig. 4B
,
fivefold decrease after 18 h of LK; P<0,01).
Examination of the same blots with longer exposure revealed that LK
induced a time-dependent proteolytic cleavage of the CaMKIV protein.
Cleavage products appeared at 45, 44, 36, and 33 kDa, a pattern similar
to that observed by McGinnis et al. (37)
, which suggests
that caspase-3 could be involved in degrading CaMKIV during granule
neurons apoptosis. The effect of caspase inhibitors on this cleavage
was further examined. Figure 4C
shows that the broad-range
caspase inhibitor Z-VAD-fmk strongly inhibited appearance of CaMKIV
cleavage products, hence also preventing the loss of immunoreactivity
of the full-length protein observed in LK (compare 117%±20 to
38%±15, P<0.01). Treatment with Z-DEVD-fmk, a more
specific inhibitor of caspase-3-like enzymes, also reduced CaMKIV
cleavage and prevented the loss of the full-length protein (80%±20
relative to 38%±15, P<0.01). These data suggest that
LK-induced activation of at least in part caspase-3 activity
contributes to CaMKIV degradation, but has no effect on CaMKII.
|
As calcium entry via L-type Ca2+ channels
modulates apoptosis and caspase-3-like activity, we speculated it could
also play a role in CaMKIV fragmentation. As shown in Fig. 4D
, closure of L-type Ca2+ channels in
HK by a 9 h nifedipine treatment (Nif, 1 µM) induced CaMKIV
fragmentation, similarly to LK treatment. Accordingly, the total amount
of CaMKIV decreased to 47%±12 (HK/nifedipine) and 38%±15 (LK)
relative to the HK control (P<0.01). In contrast,
inhibition of Ca2+ entry through N- and P/Q-type
channels by omega-conotoxin MVIIC was unable to induce CaMKIV
fragmentation and subsequent CaMKIV loss. Conversely, opening L-type
Ca2+ channels with the agonist FPL64176 partly
prevented LK-induced CaMKIV fragmentation. Indeed, after FPL/LK
treatment, levels of CaMKIV only dropped down to 71%±16 of HK control
relative to the 38%±15 observed in LK alone. Thus, CaMKIV
fragmentation was also likely to be regulated by specific
Ca2+ entry channels in neurons.
Taken together, this set of data is consistent with the idea that CaMKIV, a key effector of the intracellular Ca2+/calmodulin signaling pathway, is specifically cleaved and degraded during neuronal apoptosis by a caspase-dependent mechanism and is under the control of specific calcium entry routes. This raised the possibility that CaMKIV may play a potential role in cerebellar granule cell neuroprotection against LK-induced apoptosis.
CaMKIV promotes neuronal survival
To test whether CaMKs directly regulated neuronal survival,
dominant active forms of CaMKIV and II and a dominant negative form of
CaMKIV were overexpressed in cerebellar granule neurons by a transient
gene transfer technique, and their effects on apoptosis were monitored
by scoring apoptotic nuclei in the transfected cell population (Hoechst
staining; see Materials and Methods). The different CaMK-coding
sequences were fused to the hemagglutinin (HA) epitope tag and
subcloned in a mammalian expression vector. Expression of CaMKs in
transfected cells was detected by immunocytochemistry with an antibody
directed against the HA epitope. Controls were performed by evaluating
the percentage of apoptotic nuclei obtained in a population of neurons
transfected with the same vector expressing EGFP in which transfected
cells were monitored by EGFP fluorescence.
Overexpression of the dominant activator of CaMKIV (DA-CaMKIV) in
neurons maintained in HK (neuroprotective conditions) had little effect
on neuronal survival (Fig. 5A
). By contrast, when apoptosis was induced by LK treatment,
less than 10% of nuclei were apoptotic in neurons expressing DA-CaMKIV
whereas 30% of neurons expressing the control vector were apoptotic
(Fig. 5A
, C
). This indicated that an active CaMKIV is
sufficient to promote neuronal survival. In contrast, overexpression of
a DA-CaMKII was unable to prevent LK-induced apoptosis (Fig. 5B
, C
), a result consistent with the fact that LK treatment has no
effect on the CaMK II protein levels (Fig. 4A
). Thus CaMKIV,
but not CaMKII, may prevent LK-induced apoptosis. We next asked whether
CaMKIV activity at some level was in fact required to sustain survival
in HK medium. Figure 6
shows that expression of DN-CaMKIV induced nuclear fragmentation under
both HK and LK conditions. Under HK conditions, more than 30% of
DN-CaMKIV-expressing cells were apoptotic, whereas in LK conditions,
95% of transfected cells had a condensed nuclei. These data are in
line with the idea that CaMKIV is a key effector in promoting cell
survival and that the loss of its activity contributes to the
LK-induced apoptotic program.
|
|
Caspase-dependent CaMKIV cleavage interferes with CREB
phosphorylation
The functional consequence of caspase-mediated CaMKIV
fragmentation was evaluated on the phosphorylation state of the CREB
protein. Indeed, CREB is specifically phosphorylated by CaMK IV on the
serine 133 residue (31
, 38)
. Western blot analysis using
an antibody directed against the phosphorylated form of CREB (pCREB)
revealed an initial drop of the phosphorylation levels upon
K+ deprivation (15 min) that stayed constant
until 2 h and then declined progressively with kinetics comparable
to those observed for CaMKIV cleavage (Fig. 7A
). The decrease in pCREB observed during the initial 6 h period was not due to the proteolytic degradation of CREB, since
Western blot analysis with an antibody that recognizes native CREB
(N-CREB) showed that the total amount of CREB significantly decreased
after 6 h of K+ deprivation (25% and 50%
of decrease at 8 and 10 h, respectively, P<0.05; Fig. 7A
). This late decrease of N-CREB levels is probably due to
a caspase-dependent degradation, since caspase inhibitors (Z-DEVD and
Z-VAD) restored N-CREB levels at 8 h (Fig. 7B
). This
mechanism has not been explored further.
|
To test whether caspase activity contributed to the time-dependent
reduction in pCREB, the effects of Z-VAD-fmk and Z-DEVD-fmk were
examined under LK conditions. Both inhibitors almost completely
abolished the decline in pCREB from the original level in LK at 15 min
after the switch. The overlapping kinetics in the pCREB reduction and
CaMKIV degradation indicated that caspase-3-dependent CaMKIV cleavage
may have interfered with the maintenance of CREB phosphorylation. We
thus measured the effect of bidirectional manipulation of L-type
Ca2+ channel activity on long-term maintenance of
pCREB level at 6 h of treatment, a time point when N-CREB levels
are constant (Fig. 7C
). In keeping with our data on CaMKIV
cleavage, a shift from HK to LK or closure of L-type
Ca2+ channels in HK with nifedipine incapacitated
pCREB stabilization, whereas FPL64176 treatment in LK in part restored
pCREB levels (Fig. 7C
). Treatment with the N-P/Q-type
calcium channels blocker MVIIC induces a slight decrease in pCREB
levels (P<0.05).
| DISCUSSION |
|---|
|
|
|---|
18
h), CaMKIV levels dramatically declined within a few hours. This
observation clearly raised the question of whether the distinct fate of
these two calcium signaling molecules had some functional relevance on
K+ deprivation-induced apoptosis.
CaMKIV cleavage by a caspase-3-like protease: a turnoff of a
survival pathway
In this work we showed that CaMKIV exerts primarily
neuroprotective effects. Using transient transfection techniques (see
Fig. 5
), a dominant active form of CaMKIV protected cerebellar neurons
from K+ deprivation-induced apoptosis whereas its
dominant negative form induced apoptosis, even in depolarized neurons.
These data thus agree with results reported in T cells by Anderson et
al., who showed that an inactive form of CaMKIV, which is supposed to
act in a dominant negative manner, significantly increased apoptosis
(28
; for a review, see ref 19
). CaMKIV
furthermore mediated the neuroprotective effects of the neurotrophin
BDNF in cortical neurons (38)
. The role for CaMKII in
neuronal survival remains a wide open question. In our own study,
transient transfection of DA-CaMKII exerted no discernible
anti-apoptotic effect (Fig. 5C
). Furthermore, a tendency
pointing a potential proapoptotic role for CaMKII was even detectable
(Fig. 5C
), although this effect was not statistically
significant. In preliminary experiments, KN-62 treatment under LK
conditions in the absence of depolarization resulted in an apparent
reduction in the number of cerebellar granule neurons with fragmented
nuclei, also consistent with the possible existence of a
KN-62-sensitive proapoptotic CaMK species. However, more work needs to
be done in order to clarify this issue. Previous reports in the
literature either indicated a strong proapoptotic role in several
leukemia cell lines (44)
and in cortical neurons
(29)
or, to the contrary, supported its neuroprotective
effect in cerebellar granule cells (17)
or in cortical
neurons (45)
.
Our finding that CaMKIV stability may be regulated by a
caspase-dependent proteolysis falls in the general context explored by
Widmann et al. (10)
, who by testing the fate of 30
different proteins showed that caspase-dependent cleavage during
apoptosis inactivated certain neuroprotective proteins while activating
death-promoting proteins (e.g., activation of caspases themselves). Our
results point to the possibility that the caspase-dependent cleavage of
CaMKIV, but not CaMKII, may represent an irreversible turn off of a
survival pathway (here the calcium-dependent survival pathway) that
could otherwise interfere with the apoptotic process.
The signaling mechanism by which the state of depolarization and
biological activity controls this dual regulation is largely unexplored
in its fine details. Clearly, from our data, when
K+ deprivation recruits caspases, specific VGCC
are likely to play a role as a gate at the level of the cell membrane.
Cleavage of CaMKs may represent a general mechanism activated during
neuronal apoptosis since McGinnis et al. have shown that it also
occurred in cortical neurons (37)
. In their model of
staurosporine-induced apoptosis, CaMKs were strongly and gradually
cleaved within 24 h to a 55% loss of activity. In their model and
in contrast to our results, CaMKII was also cleaved by a
caspase-dependent mechanism. It seems unlikely that staurosporine
recruits the same caspase-activating mechanism as
K+ deprivation in cerebellar granule cells for
two reasons. First, staurosporine operates on a longer time scale (24
vs. 6 h in cerebellar granule cells), and Marks and Berg reported
a slower rise in caspase-3 activity with 1 µM staurosporine compared
to the switch from HK to LK in cerebellar neurons (46)
.
Second, staurosporine leads to a cleavage of both CaMKIV and CaMKII,
whereas K+ deprivation activates a mechanism that
is restricted to CaMKIV.
In our model, the degradation of CaMKIV operated through a
caspase-dependent mechanism (Fig. 4B
). Caspase inhibitors
Z-DEVD-fmk and Z-VAD-fmk were very effective by inhibiting both CaMKIV
fragmentation, caspase-3-like activity, and nuclear condensation.
However, inhibition of fragmentation and nuclear condensation were more
effective in the presence of the broad-range caspase inhibitor
Z-VAD-fmk than with the specific caspase-3-like inhibitor Z-DEVD-fmk.
This raises the question of the specificity of caspase that cleaves
CaMKIV. Based on our results, it appeared that CaMKIV was cleaved
mainly by a DEVD-sensitive caspase, but we cannot exclude the
possibility that other caspases may contribute as well.
Functional consequence of CaMKIV cleavage: impairment of CREB
phosphorylation
CaMKIV mediates Ca2+-dependent stimulation
of gene transcription through phosphorylation of the serine 133 residue
of the transcription factor CREB (cAMP-responsive element binding
protein) (31
, 47)
. As expected, we show that switching
culture medium from HK to LK quickly reduced the level of pCREB (15
min). However, this lower level of pCREB remained constant for 4 h, after which it progressively declined in parallel with the
degradation of CaMKIV. Inhibition of CaMKIV degradation also inhibited
the delayed decrease of pCREB. Since pCREB and CaMKIV decreased with
the same kinetics and were both sensitive to caspase antagonists,
CaMKIV was likely to be implicated in the maintenance of the basal
phosphorylation state (and resulting transcriptional activity) of CREB.
In control experiments with antibodies recognizing CREB independently
of its state of phosphorylation (N-CREB), we showed that the delayed
decline in pCREB (between 4 and 6 h of potassium deprivation) is
not due to the degradation of CREB. However, after 8 h of LK
treatment, N-CREB levels also started to slowly decrease by a
caspase-dependent mechanism, further decreasing the level of pCREB.
Similarly, a long-term nifedipine treatment (6 h) dramatically reduced
the long-term pCREB content, without affecting N-CREB levels. This
strong impairment in the maintenance of CREB phosphorylation in the
presence of nifedipine was also partially reversed by caspase
inhibitors, confirming that the reduction in pCREB levels resulted not
only from a decrease in the
Ca2+/calmodulin-dependent activation of the
kinase, but also from a loss of CaMKIV stability. The N- and P/Q-type
calcium channels blocker omega-conotoxin MVIIC had a small effect on
the rapid but not the delayed phase of pCREB level control, in contrast
to the known abundance of these channels that far exceeds L-type
channels in the cerebellar granule cells (48)
. The minor
inhibition of CREB phosphorylation by omega-conotoxin MVIIC apparently
had no effect on cell survival; omega-conotoxin did not induce
caspase-3-like activity nor produce any other apoptotic feature such as
nuclear condensation. Thus, only the later decrease in pCREB level is
directly associated with the apoptotic process. The relative
selectivity and specificity of the VGCC type involved in pCREB
regulation may be explained, at least in part, by the difference in the
activation/inactivation kinetics and voltage dependence of each channel
type (49)
.
It is known that CaMKIV regulates CREB-dependent gene transcription in
response to KCl depolarization (24)
. Among these genes,
there is a good evidence for involvement of CaMKIV in transcriptional
regulation of the BDNF gene through phosphorylation of a CREB family
member (26
, 27
, 50)
. Based on our results, the decrease in
sustained pCREB levels due to CaMKIV degradation could be a
reinforcement mechanism that significantly contributes to the apoptosis
signaling pathway by impairing the transcription of neuroprotective
genes like BDNF.
In summary, we showed that, in cerebellar granule cells, calcium entry
through L-type voltage gated calcium channels supports neuronal
survival in a CaMKIV-dependent manner (Fig. 8
). When cells entered apoptosis, the increase in caspase-3-like activity
led to the specific cleavage of CaMKIV, whose kinase activity was found
to be necessary and sufficient to sustain survival. The time-dependent
degradation of CaMKIV may account at least in part for the irreversible
nature of apoptosis under low K+ conditions.
Reversal of CaMKIV down-regulation by caspase inhibitors restored
survival as well as the sustained phosphorylation level of CREB
Ser-133, consistent with the idea that transcription of CREB-dependent
genes (such as BDNF, for example) may contribute to neuronal
survival.
|
| ACKNOWLEDGMENTS |
|---|
Received for publication March 17, 2000.
Revision received June 26, 2000.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. Yuan, S. Gong, J. Luo, Z. Zheng, B. Song, S. Ma, J. Guo, C. Hu, G. Thiel, C. Vinson, et al. Opposing Roles for ATF2 and c-Fos in c-Jun-Mediated Neuronal Apoptosis Mol. Cell. Biol., May 1, 2009; 29(9): 2431 - 2442. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Bilimoria and A. Bonni Cultures of Cerebellar Granule Neurons CSH Protocols, December 1, 2008; 2008(13): pdb.prot5107 - pdb.prot5107. [Abstract] [Full Text] |
||||
![]() |
M. J. Perez-Garcia, M. Gou-Fabregas, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler Neuroprotection by Neurotrophic Factors and Membrane Depolarization Is Regulated by Calmodulin Kinase IV J. Biol. Chem., February 15, 2008; 283(7): 4133 - 4144. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Lee, K.-L. Tsai, W.-S. Lee, and C. Hsu The molecular events occur during MK-801-induced cytochrome oxidase subunit II down-regulation in GT1-7 cells J. Mol. Endocrinol., July 1, 2007; 39(1): 53 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohmae, S. Takemoto-Kimura, M. Okamura, A. Adachi-Morishima, M. Nonaka, T. Fuse, S. Kida, M. Tanji, T. Furuyashiki, Y. Arakawa, et al. Molecular Identification and Characterization of a Family of Kinases with Homology to Ca2+/Calmodulin-dependent Protein Kinases I/IV J. Biol. Chem., July 21, 2006; 281(29): 20427 - 20439. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Morrison, N. Majdzadeh, X. Zhang, A. Lyles, R. Bassel-Duby, E. N. Olson, and S. R. D'Mello Neuroprotection by histone deacetylase-related protein. Mol. Cell. Biol., May 1, 2006; 26(9): 3550 - 3564. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. XIE, C. JAN, P. STOILOV, J. PARK, and D. L. BLACK A consensus CaMK IV-responsive RNA sequence mediates regulation of alternative exons in neurons RNA, December 1, 2005; 11(12): 1825 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Benedito, M. Lehtinen, R. Massol, U. G. Lopes, T. Kirchhausen, A. Rao, and A. Bonni The Transcription Factor NFAT3 Mediates Neuronal Survival J. Biol. Chem., January 28, 2005; 280(4): 2818 - 2825. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Tremper-Wells and M. L. Vallano Nuclear Calpain Regulates Ca2+-dependent Signaling via Proteolysis of Nuclear Ca2+/Calmodulin-dependent Protein Kinase Type IV in Cultured Neurons J. Biol. Chem., January 21, 2005; 280(3): 2165 - 2175. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. See, N. K.M. Rajala, D. G. Spiller, and M. R.H. White Calcium-dependent regulation of the cell cycle via a novel MAPK-NF-{kappa}B pathway in Swiss 3T3 cells J. Cell Biol., August 30, 2004; 166(5): 661 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Perez-Garcia, V. Cena, Y. de Pablo, M. Llovera, J. X. Comella, and R. M. Soler Glial Cell Line-derived Neurotrophic Factor Increases Intracellular Calcium Concentration: ROLE OF CALCIUM/CALMODULIN IN THE ACTIVATION OF THE PHOSPHATIDYLINOSITOL 3-KINASE PATHWAY J. Biol. Chem., February 13, 2004; 279(7): 6132 - 6142. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lalonde, P. E. D. Lachance, and A. Chaudhuri Monocular Enucleation Induces Nuclear Localization of Calcium/Calmodulin-Dependent Protein Kinase IV in Cortical Interneurons of Adult Monkey Area V1 J. Neurosci., January 14, 2004; 24(2): 554 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Linseman, C. M. Bartley, S. S. Le, T. A. Laessig, R. J. Bouchard, M. K. Meintzer, M. Li, and K. A. Heidenreich Inactivation of the Myocyte Enhancer Factor-2 Repressor Histone Deacetylase-5 by Endogenous Ca2//Calmodulin-dependent Kinase II Promotes Depolarization-mediated Cerebellar Granule Neuron Survival J. Biol. Chem., October 17, 2003; 278(42): 41472 - 41481. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ono, N. Sekino-Suzuki, Y. Kikkawa, H. Yonekawa, and S. Kawashima Alivin 1, a Novel Neuronal Activity-Dependent Gene, Inhibits Apoptosis and Promotes Survival of Cerebellar Granule Neurons J. Neurosci., July 2, 2003; 23(13): 5887 - 5896. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Mbebi, V. See, L. Mercken, L. Pradier, U. Muller, and J.-P. Loeffler Amyloid Precursor Protein Family-induced Neuronal Death Is Mediated by Impairment of the Neuroprotective Calcium/Calmodulin Protein Kinase IV-dependent Signaling Pathway J. Biol. Chem., May 31, 2002; 277(23): 20979 - 20990. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Hansen-Petrik, M. F. McEntee, B. Jull, H. Shi, M. B. Zemel, and J. Whelan Prostaglandin E2 Protects Intestinal Tumors from Nonsteroidal Anti-inflammatory Drug-induced Regression in ApcMin/+ Mice Cancer Res., January 1, 2002; 62(2): 403 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mabuchi, K. Kitagawa, K. Kuwabara, K. Takasawa, T. Ohtsuki, Z. Xia, D. Storm, T. Yanagihara, M. Hori, and M. Matsumoto Phosphorylation of cAMP Response Element-Binding Protein in Hippocampal Neurons as a Protective Response after Exposure to Glutamate In Vitro and Ischemia In Vivo J. Neurosci., December 1, 2001; 21(23): 9204 - 9213. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. L. Tan, S.-L. Chan, K. O. Tan, and V. C. Yu The Caenorhabditis elegans Sex-determining Protein FEM-2 and Its Human Homologue, hFEM-2, Are Ca2+/Calmodulin-dependent Protein Kinase Phosphatases That Promote Apoptosis J. Biol. Chem., November 16, 2001; 276(47): 44193 - 44202. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kruidering, T. Schouten, G. I. Evan, and E. Vreugdenhil Caspase-mediated Cleavage of the Ca2+/Calmodulin-dependent Protein Kinase-like Kinase Facilitates Neuronal Apoptosis J. Biol. Chem., October 12, 2001; 276(42): 38417 - 38425. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. See and J.-P. Loeffler Oxidative Stress Induces Neuronal Death by Recruiting a Protease and Phosphatase-gated Mechanism J. Biol. Chem., September 7, 2001; 276(37): 35049 - 35059. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Fladmark, O. T. Brustugun, G. Mellgren, C. Krakstad, R. Boe, O. K. Vintermyr, H. Schulman, and S. O. Doskeland Ca2+/Calmodulin-dependent Protein Kinase II Is Required for Microcystin-induced Apoptosis J. Biol. Chem., January 18, 2002; 277(4): 2804 - 2811. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |