|
|
||||||||
B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated ß-casein gene expression
Institut für Medizinische Chemie und Biochemie, Universität Innsbruck, A-6020 Innsbruck, Austria
1Correspondence: Institute f. Medizinische Chemie und Biochemie, Universität Innsbruck, Fritz Pregl-Str. 3, A-6020 Innsbruck, Austria. E-mail: Wolfgang.Doppler{at}uibk.ac.at osupersub
| ABSTRACT |
|---|
|
|
|---|
B family of transcription factors regulates diverse cellular
functions such as immune response and cell growth and development, and
has been reported to be constitutively active in a variety of mammary
carcinoma cell lines. However, its role in normal mammary gland
development has not been addressed. In our study, we detected
developmentally regulated NF-
B activity in the mammary gland of
mice. During pregnancy, DNA binding activity of NF-
B p50/p65
increased until day 16 postcoitum and decreased with the onset of
lactation, most likely due to reduced p50 and p65 protein levels in the
nucleus. Cotransfection experiments performed with 293 cells revealed
an inhibition of the prolactin receptor/JAK2/STAT5 pathway by NF-
B.
In HC11 cells, NF-
B p50/p65 activity was inversely correlated with
prolactin-induced STAT5 tyrosine phosphorylation, expression of
endogenous ß-casein gene, and of a transfected ß-casein gene
promoter reporter construct. This indicates a negative cross talk
between NF-
B and the prolactin receptor/JAK2/STAT5 activation
pathway, which occurs at the level of STAT5 tyrosine phosphorylation.
Our results provide evidence for a role of NF-
B in normal mammary
gland development, and indicate its function as a negative regulator of
ß-casein gene expression during pregnancy by interfering with STAT5
tyrosine phosphorylation.Geymayer, S., Doppler, W. Activation of
NF-
B p50/p65 is regulated in the developing mammary gland and
inhibits STAT5-mediated ß-casein gene expression.
Key Words: TNF-
prolactin milk protein gene transcription tyrosine phosphorylation
| INTRODUCTION |
|---|
|
|
|---|
B (NUCLEAR FACTOR NF-
B) BELONGS TO an
evolutionarily conserved family of transcription factors that share a
common mechanism of activation. Members represent dimeric proteins
belonging to the Rel family and are retained in the cytoplasm as
inactive forms by binding to I
B inhibitory molecules.
Phosphorylation and subsequent degradation of I
B, induced by
external stimuli, lead to nuclear translocation of NF-
B dimers and
to activation or repression of NF-
B target genes. One major
biological function exerted by NF-
B in such diverse organisms as
mammals, arthropods, and plants is its participation in the innate and
humoral immune response (1)
B appears to be of central importance
(4)
B homologue DORSAL was found
to be an essential morphogen responsible for the ventralization in
developing embryos (7)
B family members
is lacking (8)
B to mammalian
development processes was provided by Delfino and Walker
(9)
B p50/p65 in
regulating gene expression in mammalian testis. The stage- and
cell-specific activation of NF-
B in Sertoli cells and germ cells
implicated NF-
B as a potential regulator of the genetic program of
differentiation during spermatogenesis.
We focused our attention on the role of NF-
B in the mammary gland,
where the major part of development occurs during puberty, pregnancy,
and lactation, triggered by changes in the concentration of steroid and
polypeptide hormones. The differentiation process involves ductal
elongation, alveolar proliferation, and functional differentiation of
the epithelium (10)
. Each reproductive cycle is completed
after lactation by a period of involution with a coordinated process of
alveolar programmed cell death.
The function of NF-
B in the normal development of the mammary gland
has not been addressed thus far. However, its role in tumors and tumor
cell lines derived from the mammary gland has been studied and it was
found to be constitutively activated in hormone-independent human
breast cancer cell lines (11)
. Inhibition of NF-
B
activity in human breast cancer cell lines lead to apoptosis (11
, 12)
, suggesting that the protective effect of NF-
B might
allow tumor cells to escape elimination by programmed cell death.
NF-
B activation in tumor cells might also facilitate invasion and
metastasis by aberrant expression of the NF-
B target genes such as
matrix metalloproteinase, vimentin, and urokinase plasminogen activator
(11)
. The demonstration of constitutive NF-
B activation
in tumor cells raises the question of whether this feature is typical
of normal mammary epithelial cells, from which the tumor is derived, or
evolved during tumor development. To distinguish between these two
possibilities, we studied the expression and activation of the NF-
B
family members during normal development of the mouse mammary gland and
in the nontumorigenic mammary epithelial cell line HC11. Our results
revealed pregnancy-specific activation of the NF-
B p50/p50 and
p50/p65 complexes in vivo and a basal level of activation of
these factors in HC11 cells, indicating their potential role in normal
mammary gland development and differentiation. The
prolactin-receptor/JAK2/STAT5 pathway was identified as a target
inhibited by NF-
B. One of the consequences of this inhibition is the
transcriptional repression of the milk protein gene ß-casein.
Accordingly, the pregnancy-specific activation pattern of NF-
B might
be important to confine high-level expression of the ß-casein gene to
the lactation period, when NF-
B activity is low, and might inhibit a
premature terminal differentiation of the mammary gland before
lactation by negatively interfering with STAT5 tyrosine
phosphorylation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(TNF-
; Sigma) per ml, and for 1 h prior to
stimulation with 1 to 10 µM parthenolide (Sigma) as described
(14)
wash-out experiments, HC11 cells were
washed after TNF-
treatment for 24 h with 2% fetal calf serum
and kept in TNF-
-free medium for the time period indicated.
Nuclear and whole cell extracts
Nuclear extracts were prepared essentially as described
(15)
. Briefly, cells were lysed on ice in 3-pellet volumes
of cytoplasmic extraction buffer (10 mM HEPES [pH 7.6], 60 mM KCl, 1
mM EDTA, 0.1% Nonidet P-40, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 2.5 µg each of aprotinin, leupeptin,
and pepstatin per ml). Nuclei were pelleted (200 g, 4°C, 5
min) and washed gently with 100 µl of cytoplasmic extraction buffer
without Nonidet P-40. Two-pellet volumes of nuclear extraction buffer
(20 mM Tris [pH 8.0], 420 mM NaCl, 1.5 mM
MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl
fluoride, 25% glycerol, 2.5 µg each of aprotinin, leupeptin, and
pepstatin per ml) were added and the final salt concentration was
adjusted to ~400 mM with 2.5 M NaCl. Nuclear pellets were resuspended
by vortexing, maintained on ice for 10 min with occasional vortexing,
and cleared by centrifugation at 16,000 g, 4°C for 10 min.
Nuclear extracts from the mammary gland were made from organs derived
from different developmental stages ground into powder in liquid
nitrogen. Whole cell extracts were prepared as described
(13)
, and protein concentrations were determined by
Bradford assay.
Electromobility shift assays
Binding reactions were carried out with double-stranded
oligonucleotides labeled with [
-32P] ATP
(>6000 Ci/mmol). The following oligonucleotides were used (only the
upper strand is shown, binding sites are underlined): NF-
B,
5'AGTTGAGGGGACTTTCCCAGG3'; STAT5,
5'TGTGGACTTCTTGGAATTAAGGGACTTTTG3'; and
SP1, 5'ATTCGATCGGGGCGGGGCGAGC3'. The sequence of the
oligonucleotide NF-
B contains an NF-
B site from the
light
chain enhancer in B cells; the sequence of the STAT5 oligonucleotide
spans the lactogenic hormone-responsive region in the rat ß-casein
promoter containing the binding site for STAT5 (TTCTTGGAA) and NF-
B
(GGGACTTTG). Equal amounts of nuclear extracts or whole cell extracts
(5 or 10 µg) were incubated for 30 min on ice with 50,000 cpm of
double-stranded oligonucleotide, a 100-fold molar excess of unlabeled
single-stranded oligonucleotide, 10 mM Tris/HCl (pH 7.6), 50 mM NaCl, 1
mM EDTA, 1 mM dithiothreitol, and 1 µg poly(dI-dC).
In supershift experiments, extracts were preincubated with 1 µl of
rabbit polyclonal antibodies against the Rel family proteins p50 and
p65 (sc-114 and sc-372, respectively, obtained from Santa Cruz
Biotechnology, Santa Cruz, Calif.) for 30 min at room temperature
before adding the labeled oligonucleotide. For oligonucleotide
competition experiments, a 100-fold molar excess of unlabeled
oligonucleotide was included in the reaction mix and incubated for 30
min at room temperature before adding the labeled oligonucleotide.
Complexes were separated on 4% polyacrylamide gels in 0.25 x TBE
electrophoresis buffer as described (16)
. Experiments
shown were repeated at least three times by using independent extracts.
Immunoprecipitation
For immunoprecipitation, 6 x 106
hormone-treated HC11 cells were incubated with 1 ml lysis buffer (50 mM
HEPES, 150 mM NaCl, 0.1% Nonidet P-40, 10% glycerol, 50 mM NaF, 1 mM
orthovanadat, 1 mM DTT, 10 M PMSF, 2 µg/ml leupeptin, 5 µg/ml
aprotinin) for 10 min at 4°C. After centrifugation at 17,500
g for 10 min, the supernatant was incubated with 2 µl of
polyclonal STAT5A (provided by T. Decker) together with 25 µl protein
A agarose (50% slurry, Santa Cruz) for 1 h at 4°C. Absorbed
immunocomplexes were washed three times with washing buffer (50 mM
HEPES, 150 mM NaCl 0.1% Nonidet P-40, 0.1 mM orthovanadat, 1 mM DTT),
directly eluted with SDS-sample buffer, and analyzed by gel
electrophoresis on NuPAGE 412% Bis-Tris gels (Novex, San Diego,
Calif.). Separated proteins were subjected to Western blot analysis as
described below.
Western blot analysis
Equal amounts of whole cell extracts or nuclear extracts (10
µg) were subjected to gel electrophoresis in NuPAGE 412% Bis-Tris
gels (Novex) and transferred to polyvinylidene difluoride membranes
(Millipore, Bedford, Mass.). Membranes were incubated with a 2000-fold
dilution of a polyclonal rabbit anti-milk protein antibody
(17)
or a monoclonal mouse phosphotyrosine antibody (4G10,
Upstate Biotechnology, Lake Placid, N.Y.), a 1000-fold dilution of a
polyclonal rabbit p65 antibody (sc-372, Santa Cruz Biotechnology), a
1000-fold dilution of a polyclonal goat p50 antibody (sc-1190X, Santa
Cruz Biotechnology) or a polyclonal rabbit SP1 antibody (sc-59X, Santa
Cruz Biotechnology), and a 300-fold dilution of a monoclonal mouse
STAT5A antibody (Transduction Laboratories, Lexington, Ky.). Anti-mouse
and rabbit secondary antibodies were obtained from Santa Cruz. Specific
proteins were visualized by enhanced chemiluminescence (Amersham,
Buckinghamshire, U.K.). Quantitation was performed by densitometry.
Transfection conditions and reporter gene assays
Transfections were done with the calcium phosphate precipitation
technique essentially as described (18)
. For generation of
stably transfected HC11 cells, 10 µg DNA of a mouse ß-casein-Luc
reporter gene construct, which contains the region from -300 to -1 of
the mouse promoter in front of the luciferase reporter gene, and 1 µg
of pSV2neo were cotransfected per 10 cm diameter tissue culture plates.
Colonies resistant to the antibiotic G418 were selected for the hormone
induction experiments. For reporter gene assays, 293 cells were split
into 6-well dishes at a cell density of 12 x
105 cells per well. Nine micrograms ß-casein
gene promoter-Luc construct with the sequence from -344 to -1 of the
rat gene (19)
, 4.2 µg mouse prolactin receptor
expression vector pcDNAI-PRLR (19)
, 4.2 µg STAT5A
expression vector pECESTAT5A (19)
, 1.8 µg Renilla
reporter construct pRL-SV40 (Promega, Madison, Wis.), and a total of
0.3 µg of expression vectors for p50 (20)
or p65
(21)
were used per six wells for transfections. Eighteen
hours after transfection, precipitates were removed by washing with
RPMI 1640 containing 2% fetal calf serum and cells were treated with
hormones for 24 h, as indicated. For determination of firefly and
Renilla luciferase activity, cells were lysed with 250 µl
buffer containing 25 mM glycylglycine (pH 7.8), 15 mM
MgSO4, 4 mM EGTA, 1 mM DTT, and 0.2% Tween 20.
Lysates were scraped off the dish and transferred into 1.5 ml
centrifuge tubes, incubated under vigorous shaking for 20 min at 4°C,
and centrifuged at 10,000 g for 5 min. Aliquots of the
supernatant were used to determine either firefly luciferase activity,
as described (18)
, or Renilla luciferase
activity, as described previously (22)
. For preparation of
nuclear extracts from transfected 293T cells, a total amount of 3 µg
of Rel family member p50 (20)
and p65 (21)
was used per 10 cm diameter tissue culture plates for transfection.
| RESULTS |
|---|
|
|
|---|
B p50/p50 and p50/p65 are present in the mammary gland of
mice and in the mouse mammary epithelia cell line HC11
B family members p50 and p65 are
expressed in multiple tissues (2)
B site from the
light enhancer was used (Fig. 1
|
In nuclear extracts of HC11 cells, p50/p50 homodimers and p50/p65
heterodimers (Fig. 1B
, lanes 5, 7) were identified by their
immunoreactivity to p50- and p65-specific antibodies: The p50/p50
complex was recognized by the p50-specific antibody (Fig. 1B
, lane 6), but not by the p65-specific antibody (Fig. 1B
, lane 8); the p50/p65 complex reacted partially with the
p50 (Fig. 1
, lane 6) and completely with the p65 antibody (Fig. 1B
, lane 8). The other two complexes formed with the NF-
B
probe and HC11 nuclear extracts did not react with the NF-
B
antibodies used; they were not competed with a 100-fold molar excess of
the NF-
B-specific probe (see also Fig. 6
) and therefore were not
considered to be NF-
B-specific complexes. Extracts derived from the
P16 mammary gland contained essential the same complexes with the
exception of a lower abundance of the p50/p65 complex. Thus, in the
nucleus of mammary epithelial cells the NF-
B forms p50/p50 and
p50/p65 were detectable.
|
NF-
B activation in the mouse mammary gland is regulated during
pregnancy and lactation
To investigate the role of NF-
B p50/p50 and p50/p65 in the
mammary gland, we analyzed activation of these complexes during mammary
gland development. Mammary gland tissue of different developmental
stages from pregnant mice (P) between day 12 and day 18 postcoitum and
from lactating mice (L) between day 3 and day 14 postpartum was
isolated, and nuclear extracts were analyzed by EMSA (Fig. 1C
). Comparing the abundance of p50/p50 and p50/p65
complexes from different stages of development revealed that their
activity was regulated. During pregnancy (P), binding activity of both
NF-
B forms peaked at day 16. Activity of p50/p65 was diminished
after day 16, whereas p50/p50 decreased; nuclear extracts from mammary
glands of lactating mice contained little p50/p50 NF-
B binding
activity at the onset of lactation (Fig. 1C
, first part of
panel, lane 5), but no detectable activity after the first week of
lactation (Fig. 1C
, lanes 68). The same nuclear extracts
were examined for binding activity of STAT5 (Fig. 1C
, second
part of panel) and SP1 (Fig. 1C
, third part of panel). The
developmental regulation of STAT5 observed was consistent with
previously described results (13)
and opposite to the
regulation of p50/p65 and p50/p50. In particular, the peak of STAT5
activation was more pronounced and occurred at a later developmental
stage compared to NF-
B. On the contrary, SP1 binding activity
remained fairly consistent until day 10 of lactation, indicating that
the changes in binding activity observed with the other transcription
factors were not due to a general effect.
Nuclear translocation of NF-
B p65 is developmentally regulated
in the mammary gland
Several mechanisms can be envisaged to be responsible for
the absence of NF-
B binding activity at later stages of lactation
(Fig. 1C
, first part of panel, lanes 68): reduced
expression of p50 or p65 protein, sequestering of NF-
B complexes
within the cytoplasm by I
B, or inhibition of nuclear binding by
proteins present in the nucleus. To elucidate which of these putative
mechanisms are prevalent, we compared the protein levels of p50 and p65
in nuclear extracts and whole cell extracts by immunoblot analysis.
Whereas p65 protein levels in both extracts were comparable during
pregnancy (Fig. 2
, lanes 13), at later stages of lactation the majority of p65 protein
was found in whole cell extracts (Fig. 2
, lanes 68). This suggests
that the absence of p50/p65 NF-
B binding activity during lactation
(L3-L10) is due to inhibited translocation of the p65 protein into the
nucleus. Accordingly, p50 expression levels in the nucleus were also
diminished during lactation but apparently remained invariant in total
cell extracts. At day P18, p65 protein levels were reduced in both
whole cell extracts and nuclear extracts (Fig. 2
, lane 4), indicating
that the decreased binding activity of p50/p65 in the nucleus at this
stage (Fig. 1C
, first part, lane 4) might be the result of
reduced expression levels of p65 rather than inhibition of nuclear
translocation. Control immunoblot experiments with an SP1-specific
antibody and the same mammary gland extracts revealed no pronounced
difference of nuclear SP-1 protein levels between pregnancy and early
lactation, indicating that the stage-specific differences in NF-
B
expression and translocation were not due to general differences in the
fraction of nuclear proteins present in the extracts.
|
Functional repression of STAT5-mediated activation of transcription
by NF-
B
To gain insight into the functional role of
NF-
B in the mammary gland, we investigated the effects of
activated NF-
B on the prolactin receptor/JAK2/STAT5 pathway, a
signaling pathway previously shown to be important for mammary gland
differentiation during pregnancy. We first used transient
cotransfection experiments by using 293 cells. Since these cells are
devoid of endogenously expressed prolactin receptor and STAT5, the
prolactin receptor/JAK2/STAT5 pathway can be reconstituted by
coexpression of the prolactin receptor and STAT5 and can be activated
by stimulating the cells with prolactin (18
, 24)
. A
ß-casein gene luciferase reporter construct served to monitor the
transcriptional activity of STAT5 in this assay. As shown in Fig. 3
(third and sixth column from the left), the activity of the ß-casein
gene promoter is stimulated 52-fold by prolactin under these
conditions. Coexpression of p50 and p65 together with STAT5 and
prolactin receptor expression vectors leads to distinct results on
ß-casein gene promoter activity, depending on whether STAT5 was
activated by prolactin or not. In noninduced cells (-PRL), expression
of p50 and p65 resulted in a 3.7-fold increase of the basal promoter
activity (Fig. 3
, columns 2 and 3), indicating that the NF-
B p50/p65
complex itself, which induces promoter activity in many other genes
(1)
, serves as a weak activator of ß-casein gene
transcription in the absence of an activated prolactin
receptor/JAK2/STAT5 pathway. As expected, expression of p50 alone (Fig. 3
, column 1), which is devoid of a trans-activation domain,
had no effect on promoter activity. By inducing cells with prolactin
(+PRL), coexpression of p50 and p65 repressed the STAT5-mediated
activation of the ß-casein gene promoter by 79% (Fig. 3
, columns 5
and 6), whereas expression of p50 alone had nearly no effect on
promoter activity. These results indicate an inhibition of
STAT5-mediated transcription by NF-
B p50/p65 heterodimers.
|
In HC11 cells NF-
B is activated by TNF-
and inhibited by
parthenolide
We next investigated the role of NF-
B on STAT5 signaling
in mammary epithelial cells. NF-
B activity was regulated by external
stimuli using TNF-
, an activator of NF-
B (1)
, and
parthenolide, a sesquiterpene lactone previously described as an
inhibitor of NF-
B activation (14)
. The influence of
TNF-
on NF-
B activation in HC11 cells was determined by its
effect on NF-
B DNA binding activity determined by EMSA in nuclear
extracts (Fig. 4
). As shown in Fig. 4
, TNF-
increased
p50/p65 DNA binding activity with a maximum at 30 min (100% increase),
whereas no TNF-
effect on p50/p50 was observed under the same
conditions. The activation of NF-
B p50/p65 by TNF-
observed in
HC11 cells was similar to what has been described in other cell types
(15)
. Treating HC11 with parthenolide resulted in a 50%
reduction of NF-
B p50/p65 DNA binding activity (Fig. 4B
).
These results indicate that the basal level of NF-
B binding activity
observed in HC11 cells not treated with TNF-
is apparently due to
persistent activation by a pathway, which is susceptible to the
inhibitory effect of parthenolide. Thus, treatment of HC11 cells with
either TNF-
or parthenolide selectively up- or down-regulated
binding activity of the p50/p65 heterodimeric complex in the nucleus
and thus allowed us to examine cells with different NF-
B activation
status for the functional activation of the prolactin
receptor/JAK2/STAT5 pathway. As a parameter for the activity of this
pathway, prolactin-induced tyrosine phosphorylation of STAT5 was
determined.
|
STAT5 tyrosine phosphorylation is repressed by TNF-
To assess the effect of NF-
B activation by TNF-
, STAT5
immunoprecipitates of cells treated with TNF-
and prolactin were
analyzed by Western blotting with a phosphotyrosine antibody and
compared to cells treated with prolactin alone. As shown in Fig. 5A
, TNF-
treatment leads to a reduction of STAT5 tyrosine
phosphorylation in a time-dependent fashion, resulting in a 70%
repression of STAT5 phosphorylation after 10 to 24 h (Fig. 5A
, lanes 4, 5).
|
The reversibility of the effect of a 24 h incubation with
TNF-
was investigated by incubating cells for the times indicated in
TNF-
-free medium. As shown in Fig. 5B
, the repression of
prolactin-induced tyrosine phosphorylation of STAT5 by TNF-
was
partially relieved after a TNF-
-free period of 2 h (Fig. 5B
, lane 3) and nearly completely relieved after 10 to
24 h (Fig. 5B
, lanes 4, 5). These results indicate that
TNF-
negatively affects STAT5 tyrosine phosphorylation in HC11 cells
and that this inhibitory effect can be reversed by removing TNF-
from the medium. However, relief of repression after TNF-
removal
was not instantaneous, raising the possibility that the TNF-
effect
is mediated via the expression of NF-
B-regulated genes, which remain
active for several hours after TNF-
removal, and not directly via
NF-
B.
STAT5 DNA binding is inhibited by TNF-
We next investigated whether the observed reduction of STAT5
tyrosine phosphorylation in response to TNF-
also results in reduced
STAT5 DNA binding by EMSA using a DNA probe spanning the proximal STAT5
binding site of the ß-casein gene promoter. As shown in Fig. 6
, prolactin-induced STAT5 DNA binding was reversible inhibited by a
24 h TNF-
treatment (compare lanes 2 and 4). Since the probe
used contains a weak NF-
B binding site described in Material and
Methods that forms a p50/p65 complex with HC11 cell extracts (S.
Geymayer, unpublished, position of complex is indicated in Fig. 6
), the
reduced STAT5 binding could also be due to competition between NF-
B
and STAT5 for binding. However, preventing NF-
B DNA binding to the
probe by inclusion of a 100-fold molar excess of an unlabeled high
affinity NF-
B DNA sequence (Fig. 6
, lanes 58) did not alter the
reduced STAT5 DNA binding by TNF-
, indicating that this inhibition
is not due to competition for binding.
STAT5 tyrosine phosphorylation is induced by parthenolide
If NF-
B is involved in attenuating the prolactin
receptor/JAK2/STAT5 pathway, one would expect that parthenolide, which
inactivates NF-
B p50/p65 (Fig. 4B
), would stimulate this
pathway. Indeed, parthenolide treatment for 24 h led to elevated
levels of STAT5 tyrosine phosphorylation (Fig. 7
), with a maximal effect at 10 µM. The combined results of Figs. 5
6
7
support the hypothesis that NF-
B inhibits STAT5 activation at the
level of tyrosine phosphorylation.
|
The STAT5-mediated gene ß-casein is repressed by TNF-
and
activated by parthenolide
To assess the biological consequences of modulation of STAT5
tyrosine phosphorylation by NF-
B in HC11 cells, expression of the
STAT5-induced gene ß-casein was analyzed in cells where NF-
B was
activated or inactivated by treatment with TNF-
or parthenolide.
Endogenous ß-casein protein levels were determined by immunoblotting
cells treated for 48 h with prolactin and the synthetic
glucocorticoid dexamethasone, an obligate costimulator required for the
expression of ß-casein in these cells (23)
. As shown in
Fig. 8
, TNF-
inhibited the ß-casein protein level in a dose-dependent
fashion (Fig. 8A
), whereas treatment with increasing
concentrations of parthenolide resulted in elevated ß-casein protein
levels (Fig. 9A
). Neither TNF-
nor parthenolide affected the protein
level of SP1, indicating the effects of these substances to be specific
for STAT5-mediated gene expression and demonstrating that the decrease
of ß-casein protein is not due to toxic effects of TNF-
. To
directly assess whether TNF-
or parthenolide acts at the
transcription level (e.g., by modulating STAT5 activation) and not by
regulation of message stability or protein degradation of ß-casein,
we used HC11 cells stably transfected with a mouse ß-casein gene
promoter luciferase reporter construct to perform
trans-activation assays. The effect of a 24 h treatment
with TNF-
or parthenolide on luciferase activity was measured in the
presence or absence of prolactin and dexamethasone. In hormone-treated
cells (+Dex/PRL), parthenolide and TNF-
changed the activity of the
reporter gene in a fashion similar to that observed with the endogenous
ß-casein protein (compare Fig. 8B
, closed bars, with Fig. 8A
). Promoter activity was decreased 60% by 80 ng/ml
TNF-
(Fig. 8B
) and was increased 63% by 10 µM
parthenolide (Fig. 9B
), indicating that TNF-
and
parthenolide act at the transcription level. In untreated cells
(-Dex/PRL), TNF-
had no effect and parthenolide slightly decreased
ß-casein gene promoter activity (Fig. 8B
and Fig. 9B
, open bars), indicating that the effects of these
substances observed in prolactin- and dexamethasone-induced cells
cannot be attributed to an effect on basal promoter activity. Thus,
TNF-
-induced activation of p50/p65 and decreased tyrosine
phosphorylation of STAT5 correlate with down-regulation of ß-casein
gene expression, whereas parthenolide-mediated inactivation of p50/p65
and increased tyrosine phosphorylation of STAT5 resulted in elevated
ß-casein gene expression.
|
|
Our results establish the inhibition of STAT5 tyrosine phosphorylation
as a novel mechanism of cross talk between NF-
B- and
STAT5-activating pathways and reveal the milk protein ß-casein as a
new target gene repressed by NF-
B in mammary epithelial cells.
| DISCUSSION |
|---|
|
|
|---|
B translocation into the nucleus of mouse mammary gland cells.
Nuclear NF-
B binding activity was detectable in nuclear extracts
derived from mammary epithelium of mid- to late-pregnant mice and was
absent in lactating mice. Similarly, in the established mammary
epithelial cell line HC11, which also originated from mammary glands of
mid-pregnant mice (23)
B binding activity was
observed. In both cases, the activated NF-
B was present as p50/p50
and p50/p65 complexes.
A novel finding of the present study is the negative cross talk between
activated NF-
B and the prolactin receptor/JAK2/STAT5 pathway. One
important mechanism in this cross talk represents the effect of NF-
B
on STAT5 tyrosine phosphorylation. It appears likely that it is
mediated indirectly, since there is no evidence by
coimmunoprecipitation experiments that NF-
B and STAT5 interact
directly at the protein level (S. Geymayer, unpublished results).
Furthermore, the recovery kinetics for STAT5 tyrosine phosphorylation
after TNF-
washout (Fig. 5B
) are slower than would be
expected if the main effect was due to a direct NF-
B effect, and
point to the persistent action of one or more NF-
B-regulated gene
products with a longer half-life than nuclear NF-
B. An additional
argument for an indirect effect is the finding that the transcriptional
activator p50/p65 was a more potent inhibitor of STAT5-mediated gene
transcription than p50/p50, an NF-
B form lacking a
trans-activation domain (Fig. 3)
. This indirect effect could
involve p50/p65-mediated induction of STAT5-specific tyrosine
phosphatases or of STAT activation inhibitors such as members of the
family of cytokine-inducible SH-2 domain proteins (25)
.
The effect of TNF-
on modulating STAT5 tyrosine phosphorylation does
not appear to be restricted to the prolactin receptor/JAK2 pathway.
Recent studies have demonstrated a negative interference between the
TNF receptor cascade and the insulin signaling pathway at the level of
STAT5 tyrosine phosphorylation in mouse muscle cells, where it was
postulated that the decrease in STAT5 tyrosine phosphorylation might
play a role in insulin resistance leading to type II diabetes
(26)
.
Another level of inhibition of STAT function by NF-
B is competition
for binding to DNA. An example for such an interaction has been
described recently (27)
. STAT6 was shown to inhibit
activation of E-selectin gene transcription by antagonizing DNA binding
of NF-
B through occupation of an adjacent binding site. The mapping
of a binding site for NF-
B adjacent to the STAT5 binding site in the
rat ß-casein gene promoter at position -75 to -84 (S. Geymayer,
unpublished data) indicated that such a mechanism could be also
relevant for explaining the negative effect of NF-
B on
STAT5-mediated ß-casein gene transcription. However, mutation of this
NF-
B site did not prevent repression of STAT5 by NF-
B in 293
cells, indicating that the repression does not necessarily depend on
binding of NF-
B to this sequence.
Since ß-casein gene expression in the mammary gland and in HC11 cells
requires the activated glucocorticoid receptor (23
, 28)
,
the inhibitory effect of NF-
B on the ß-casein gene transcription
could be also mediated by an antagonistic interaction between NF-
B
and the glucocorticoid receptor. In the immune system, the mechanism by
which these two transcription factors antagonize each other has been
investigated intensively (29)
. However, it should be noted
that such an antagonism alone cannot be responsible for the observed
effects of NF-
B on ß-casein gene expression, since the inhibitory
effect did not require the activated glucocorticoid receptor in 293
cells (Fig. 4)
and the effect of NF-
B activation on STAT5 tyrosine
phosphorylation was observed in the absence of activated glucocorticoid
receptor.
The mechanism by which NF-
B is activated during mammary gland
development remains unclear. NF-
B has the capability to respond to a
diverse range of stimuli, such as TNF-
, lipopolysaccharide,
interleukin 1, oxygen free radicals, UV light, and
-irradiation
(1)
. In the mammary gland, a reasonable candidate for
NF-
B activation is TNF-
. Previous studies demonstrated that
normal rat mammary epithelial cells produce TNF-
(30
, 31)
and suggested that it might play a physiological role in
directing growth and development of the mammary gland
(30)
. In this study, high levels of TNF-
mRNA were
detected during pregnancy, which decreased during lactation and
involution. The TNF-
expression pattern observed is similar to the
activation profile of NF-
B during mammary gland development found in
our investigation (Fig. 1C
) and is consistent with the
assumption that TNF-
is responsible for NF-
B activation in the
mammary gland. However, other mechanisms for NF-
B activation, e.g.,
the recently described epidermal growth factor receptor-mediated
pathway (32)
, could be involved since members of the
epidermal growth factor receptor family are important regulators of
mammary gland growth and development during pregnancy
(33)
.
The constitutive NF-
B binding activity exhibited in HC11 cells was
blocked by parthenolide (Fig. 4B
), a recently described
inhibitor of NF-
B activation. Parthenolide acts by preventing the
degradation of I
B-
and I
B-ß in response to external stimuli
(14)
, thereby inhibiting NF-
B activation. The
sensitivity of the constitutive-activated NF-
B to parthenolide
indicates that in HC11 cells, an autonomous signaling pathway is
responsible for the degradation of I
B forms and subsequent
activation of NF-
B. This pathway could potentially involve autocrine
mechanisms, such as production of TNF-
by HC11 cells. It was
possible to further increase the constitutive NF-
B binding activity
with TNF-
(Fig. 4A
, lanes 24), indicating that the
autonomous pathway does not lead to full activation of NF-
B.
Several distinct functions have been attributed to NF-
B in mature
tissues, including maintenance of tissue function (8)
,
tissue remodeling (11)
, and anti-apoptotic activity
(2)
. Aberrant NF-
B activity has frequently been
observed in tumor cells, and is thought to provide a survival advantage
for tumor cells and to facilitate metastasis (12)
. In the
mammary gland, NF-
B may also be involved in blocking premature
terminal differentiation of the gland before onset of lactation, as
suggested by our finding that NF-
B p50/p65 represses ß-casein gene
promoter activity in 293 cells (Fig. 3)
and that activation of NF-
B
inversely correlates with ß-casein gene expression in HC11 cells.
Based on our results with cell lines, it is likely that the activation
of NF-
B in the mammary gland of pregnant mice contributes to an
attenuation of the ß-casein gene expression at this stage of
development by inhibiting STAT5 activation. This notion is supported by
the observed inverse correlation of NF-
B p50/p65 and STAT5 DNA
binding activity during pregnancy as shown in Fig. 1C
.
Inhibition of premature ß-casein gene activation appears to be one of
the functions of activated NF-
B during pregnancy. Further
experiments using mice with a genetically altered activation pathway of
NF-
B will be required to gain a more complete understanding of its
role in mammary gland development and involution. Regarding the two
NF-
B complexes p50/p50 and p50/p65, which are detectable in nuclei
of mammary epithelial cells, changes in the nuclear concentration of
the p50/p65 heterodimer were more pronounced and correlated to
inhibition of ß-casein gene expression, indicating a special role of
p65 in the mammary gland. Since the available p65 knockouts are
embryonic lethal (34)
and thus not suitable for analysis
of mammary gland development, the generation of mice with a conditional
p65 knockout would be of prime interest to elucidate the function of
NF-
B p50/p65 during mammary gland development.
| ACKNOWLEDGMENTS |
|---|
B expression vectors p50 and p65. We thank M.
Tonko and K. Garimorth for their help in preparing mammary gland
extracts from different developmental stages and C. Soratroi for
excellent technical assistance. | FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
B in the immune system. Annu. Rev. Immunol. 12,141-179[Medline]
B and rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16,225-260[Medline]
B2 (p100/p52) is required for normal splenic microarchitecture and B-cell-mediated immune responses. J. Exp. Med. 187,185-196
B. Nature (London) 376,167-170[Medline]
B-deficient fetal liver cells. Immunity 6,765-772[Medline]
B activity in transgenic mice: developmental regulation and tissue specificity. Development 122,2117-2128[Abstract]
B im mammalian testis. Mol. Endocrinol. 12,1696-1707
B during progression of breast cancer to hormone-independent growth. Mol. Cell. Biol. 17,3629-3639[Abstract]
B/Rel expression and the pathogenesis of breast cancer. J. Clin. Invest. 100,2952-2960[Medline]
B by preventing the degradation of I
B-
and I
B-ß. J. Biol. Chem. 273,1288-1297
B by tumor necrosis factor alpha and gamma interferon via enhanced I
B
degradation and de novo I
Bß degradation. Mol. Cell. Biol. 17,6746-6754[Abstract]
B precursor p105 and the proto-oncogene product Bcl-3 are I
B molecules and control nuclear translocation of NF-
B. EMBO J 12,213-222[Medline]
B. Oncogene In press
B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18,3395-3404
B: what language?. Trends Biochem. Sci. 23,233-235[Medline]
: a multifunctional regulator of mammary gland development. Endocrinology 137,4915-4924[Abstract]
This article has been cited by other articles:
![]() |
M. D. Buzzelli, M. Nagarajan, J. F. Radtka, M. L. Shumate, M. Navaratnarajah, C. H. Lang, and R. N. Cooney Nuclear Factor-{kappa}B Mediates the Inhibitory Effects of Tumor Necrosis Factor-{alpha} on Growth Hormone-Inducible Gene Expression in Liver Endocrinology, December 1, 2008; 149(12): 6378 - 6388. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, C. Johnson, and M. Bakovic Stimulation of the human CTP:phosphoethanolamine cytidylyltransferase gene by early growth response protein 1 J. Lipid Res., October 1, 2008; 49(10): 2197 - 2211. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Connelly, C. Robinson-Benion, M. Chont, L. Saint-Jean, H. Li, V. V. Polosukhin, T. S. Blackwell, and F. E. Yull A Transgenic Model Reveals Important Roles for the NF-{kappa}B Alternative Pathway (p100/p52) in Mammary Development and Links to Tumorigenesis J. Biol. Chem., March 30, 2007; 282(13): 10028 - 10035. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zeold, M. Doleschall, M. C. Haffner, L. P. Capelo, J. Menyhert, Z. Liposits, W. S. da Silva, A. C. Bianco, I. Kacskovics, C. Fekete, et al. Characterization of the Nuclear Factor-{kappa}B Responsiveness of the Human dio2 Gene Endocrinology, September 1, 2006; 147(9): 4419 - 4429. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-S. Kim, H.-J. Kim, B.-K. Koo, M.-C. Kwon, Y.-W. Kim, Y. Cho, Y. Yokota, J. M. Penninger, and Y.-Y. Kong Receptor Activator of NF-{kappa}B Ligand Regulates the Proliferation of Mammary Epithelial Cells via Id2 Mol. Cell. Biol., February 1, 2006; 26(3): 1002 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Johansson, M. Kannius-Janson, A. Gritli-Linde, G. Bjursell, and J. Nilsson Nuclear Factor 1-C2 Is Regulated by Prolactin and Shows a Distinct Expression Pattern in the Mouse Mammary Epithelial Cells during Development Mol. Endocrinol., April 1, 2005; 19(4): 992 - 1003. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Murtagh, E. McArdle, E. Gilligan, L. Thornton, F. Furlong, and F. Martin Organization of mammary epithelial cells into 3D acinar structures requires glucocorticoid and JNK signaling J. Cell Biol., July 5, 2004; 166(1): 133 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, H. Zhang, L. Lee, and M. M. Ip The Liver-Enriched Inhibitory Protein Isoform of CCAAT/Enhancer-Binding Protein {beta}, But Not Nuclear Factor-{kappa}B, Mediates the Transcriptional Inhibition of {beta}-Casein by Tumor Necrosis Factor-{alpha} Endocrinology, June 1, 2004; 145(6): 2833 - 2844. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fekete, B. Gereben, M. Doleschall, J. W. Harney, J. M. Dora, A. C. Bianco, S. Sarkar, Z. Liposits, W. Rand, C. Emerson, et al. Lipopolysaccharide Induces Type 2 Iodothyronine Deiodinase in the Mediobasal Hypothalamus: Implications for the Nonthyroidal Illness Syndrome Endocrinology, April 1, 2004; 145(4): 1649 - 1655. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Safieh-Garabedian, G M Mouneimne, W El-Jouni, M Khattar, and R Talhouk The effect of endotoxin on functional parameters of mammary CID-9 cells Reproduction, March 1, 2004; 127(3): 397 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Komine, T. Kuroishi, Y. Komine, K. Watanabe, J. Kobayashi, T. Yamaguchi, S.-i. Kamata, and K. Kumagai Induction of Nitric Oxide Production Mediated by Tumor Necrosis Factor Alpha on Staphylococcal Enterotoxin C-Stimulated Bovine Mammary Gland Cells Clin. Vaccine Immunol., January 1, 2004; 11(1): 203 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Paukku, J. Yang, and O. Silvennoinen Tudor and Nuclease-Like Domains Containing Protein p100 Function as Coactivators for Signal Transducer and Activator of Transcription 5 Mol. Endocrinol., September 1, 2003; 17(9): 1805 - 1814. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Widschwendter, S. Tonko-Geymayer, T. Welte, G. Daxenbichler, C. Marth, and W. Doppler Prognostic Significance of Signal Transducer and Activator of Transcription 1 Activation in Breast Cancer Clin. Cancer Res., October 1, 2002; 8(10): 3065 - 3074. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Faraldo, M.-A. Deugnier, S. Tlouzeau, J. P. Thiery, and M. A. Glukhova Perturbation of beta 1-Integrin Function in Involuting Mammary Gland Results in Premature Dedifferentiation of Secretory Epithelial Cells Mol. Biol. Cell, October 1, 2002; 13(10): 3521 - 3531. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. E. Timsit and D. S. Riddick Stimulation of Hepatic Signal Transducer and Activator of Transcription 5b by GH Is Not Altered by 3-Methylcholanthrene Endocrinology, September 1, 2002; 143(9): 3284 - 3294. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Yu-Lee Prolactin Modulation of Immune and Inflammatory Responses Recent Prog. Horm. Res., January 1, 2002; 57(1): 435 - 455. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Teixeira, S. Maheswaran, and P. K. Donahoe Mullerian Inhibiting Substance: An Instructive Developmental Hormone with Diagnostic and Possible Therapeutic Applications Endocr. Rev., October 1, 2001; 22(5): 657 - 674. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. K. Shea-Eaton, P.-P. H. Lee, and M. M. Ip Regulation of Milk Protein Gene Expression in Normal Mammary Epithelial Cells by Tumor Necrosis Factor Endocrinology, June 1, 2001; 142(6): 2558 - 2568. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Segev, Y. Hoshiya, A. E. Stephen, M. Hoshiya, T. T. Tran, D. T. MacLaughlin, P. K. Donahoe, and S. Maheswaran Mullerian Inhibiting Substance Regulates NFkappa B Signaling and Growth of Mammary Epithelial Cells in Vivo J. Biol. Chem., July 13, 2001; 276(29): 26799 - 26806. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |