FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GEYMAYER, S.
Right arrow Articles by DOPPLER, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GEYMAYER, S.
Right arrow Articles by DOPPLER, W.
(The FASEB Journal. 2000;14:1159-1170.)
© 2000 FASEB

Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated ß-casein gene expression

SIBYLLE GEYMAYER and WOLFGANG DOPPLER1

Institut für Medizinische Chemie und Biochemie, Universität Innsbruck, A-6020 Innsbruck, Austria

1Correspondence: Institute f. Medizinische Chemie und Biochemie, Universität Innsbruck, Fritz Pregl-Str. 3, A-6020 Innsbruck, Austria. E-mail: Wolfgang.Doppler{at}uibk.ac.at osupersub


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The NF-{kappa}B family of transcription factors regulates diverse cellular functions such as immune response and cell growth and development, and has been reported to be constitutively active in a variety of mammary carcinoma cell lines. However, its role in normal mammary gland development has not been addressed. In our study, we detected developmentally regulated NF-{kappa}B activity in the mammary gland of mice. During pregnancy, DNA binding activity of NF-{kappa}B p50/p65 increased until day 16 postcoitum and decreased with the onset of lactation, most likely due to reduced p50 and p65 protein levels in the nucleus. Cotransfection experiments performed with 293 cells revealed an inhibition of the prolactin receptor/JAK2/STAT5 pathway by NF-{kappa}B. In HC11 cells, NF-{kappa}B p50/p65 activity was inversely correlated with prolactin-induced STAT5 tyrosine phosphorylation, expression of endogenous ß-casein gene, and of a transfected ß-casein gene promoter reporter construct. This indicates a negative cross talk between NF-{kappa}B and the prolactin receptor/JAK2/STAT5 activation pathway, which occurs at the level of STAT5 tyrosine phosphorylation. Our results provide evidence for a role of NF-{kappa}B in normal mammary gland development, and indicate its function as a negative regulator of ß-casein gene expression during pregnancy by interfering with STAT5 tyrosine phosphorylation.—Geymayer, S., Doppler, W. Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated ß-casein gene expression.


Key Words: TNF-{alpha} • prolactin • milk protein gene transcription • tyrosine phosphorylation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NF-{kappa}B (NUCLEAR FACTOR NF-{kappa}B) BELONGS TO an evolutionarily conserved family of transcription factors that share a common mechanism of activation. Members represent dimeric proteins belonging to the Rel family and are retained in the cytoplasm as inactive forms by binding to I{kappa}B inhibitory molecules. Phosphorylation and subsequent degradation of I{kappa}B, induced by external stimuli, lead to nuclear translocation of NF-{kappa}B dimers and to activation or repression of NF-{kappa}B target genes. One major biological function exerted by NF-{kappa}B in such diverse organisms as mammals, arthropods, and plants is its participation in the innate and humoral immune response (1) . Accordingly, mice harboring targeted deletions of the Rel family members p50, p52, c-rel, p65 (RelA), and RelB exhibit an impaired function of B cells, T cells, macrophages, or monocytes (2 , 3) . In addition to their role in the immune system, the ubiquitously expressed Rel family members p50 and p65 serve to maintain tissue integrity and protect against various forms of cellular stress. In this respect, the anti-apoptotic function of NF-{kappa}B appears to be of central importance (4) . Inactivation of p65 and p50 has been shown to result in early degeneration of liver tissue, which begins in p65 knockout mice at day 16 of embryonic development (5) and in p50/p65 double knockout mice as early as day 12 (6) . Since both knockout mice are embryonic lethal, the consequences of p50/p65 inactivation in the adult animal are unknown. Another documented role of Rel family members unrelated to their function in the immune system is their involvement in developmental regulation. This was demonstrated in Drosophila, where the NF-{kappa}B homologue DORSAL was found to be an essential morphogen responsible for the ventralization in developing embryos (7) . In mammals, however, a similar clear demonstration of a developmental role of NF-{kappa}B family members is lacking (8) . The only linkage of NF-{kappa}B to mammalian development processes was provided by Delfino and Walker (9) , who demonstrated the importance of NF-{kappa}B p50/p65 in regulating gene expression in mammalian testis. The stage- and cell-specific activation of NF-{kappa}B in Sertoli cells and germ cells implicated NF-{kappa}B as a potential regulator of the genetic program of differentiation during spermatogenesis.

We focused our attention on the role of NF-{kappa}B in the mammary gland, where the major part of development occurs during puberty, pregnancy, and lactation, triggered by changes in the concentration of steroid and polypeptide hormones. The differentiation process involves ductal elongation, alveolar proliferation, and functional differentiation of the epithelium (10) . Each reproductive cycle is completed after lactation by a period of involution with a coordinated process of alveolar programmed cell death.

The function of NF-{kappa}B in the normal development of the mammary gland has not been addressed thus far. However, its role in tumors and tumor cell lines derived from the mammary gland has been studied and it was found to be constitutively activated in hormone-independent human breast cancer cell lines (11) . Inhibition of NF-{kappa}B activity in human breast cancer cell lines lead to apoptosis (11 , 12) , suggesting that the protective effect of NF-{kappa}B might allow tumor cells to escape elimination by programmed cell death. NF-{kappa}B activation in tumor cells might also facilitate invasion and metastasis by aberrant expression of the NF-{kappa}B target genes such as matrix metalloproteinase, vimentin, and urokinase plasminogen activator (11) . The demonstration of constitutive NF-{kappa}B activation in tumor cells raises the question of whether this feature is typical of normal mammary epithelial cells, from which the tumor is derived, or evolved during tumor development. To distinguish between these two possibilities, we studied the expression and activation of the NF-{kappa}B family members during normal development of the mouse mammary gland and in the nontumorigenic mammary epithelial cell line HC11. Our results revealed pregnancy-specific activation of the NF-{kappa}B p50/p50 and p50/p65 complexes in vivo and a basal level of activation of these factors in HC11 cells, indicating their potential role in normal mammary gland development and differentiation. The prolactin-receptor/JAK2/STAT5 pathway was identified as a target inhibited by NF-{kappa}B. One of the consequences of this inhibition is the transcriptional repression of the milk protein gene ß-casein. Accordingly, the pregnancy-specific activation pattern of NF-{kappa}B might be important to confine high-level expression of the ß-casein gene to the lactation period, when NF-{kappa}B activity is low, and might inhibit a premature terminal differentiation of the mammary gland before lactation by negatively interfering with STAT5 tyrosine phosphorylation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture and treatments
The mouse mammary epithelial cell line HC11 was grown in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum, 5 µg/ml insulin, 10 ng/ml epidermal growth factor, and 50 µg/ml gentamicin. 293 and 293T cells (human embryonal kidney epithelial cells) were propagated in Dulbecco’s modified Eagle’s medium containing 10% heat-inactivated fetal calf serum, 5 µg/ml insulin, and 50 µg/ml gentamicin. Prior to hormone treatment, HC11 cells were kept for 2 days in epidermal growth factor-free medium containing 2% fetal calf serum, as described (13) . For hormone induction, cells were incubated for 24 h (reporter gene assay) or 48 h (ß-casein immunoblot analysis) with 5 µg/ml ovine prolactin (31 units/mg, Sigma, St. Louis, Mo.), 0.1 µM dexamethasone (Sigma), 5 to 80 ng mouse recombinant tumor necrosis factor {alpha} (TNF-{alpha}; Sigma) per ml, and for 1 h prior to stimulation with 1 to 10 µM parthenolide (Sigma) as described (14) . In TNF-{alpha} wash-out experiments, HC11 cells were washed after TNF-{alpha} treatment for 24 h with 2% fetal calf serum and kept in TNF-{alpha}-free medium for the time period indicated.

Nuclear and whole cell extracts
Nuclear extracts were prepared essentially as described (15) . Briefly, cells were lysed on ice in 3-pellet volumes of cytoplasmic extraction buffer (10 mM HEPES [pH 7.6], 60 mM KCl, 1 mM EDTA, 0.1% Nonidet P-40, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2.5 µg each of aprotinin, leupeptin, and pepstatin per ml). Nuclei were pelleted (200 g, 4°C, 5 min) and washed gently with 100 µl of cytoplasmic extraction buffer without Nonidet P-40. Two-pellet volumes of nuclear extraction buffer (20 mM Tris [pH 8.0], 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 25% glycerol, 2.5 µg each of aprotinin, leupeptin, and pepstatin per ml) were added and the final salt concentration was adjusted to ~400 mM with 2.5 M NaCl. Nuclear pellets were resuspended by vortexing, maintained on ice for 10 min with occasional vortexing, and cleared by centrifugation at 16,000 g, 4°C for 10 min. Nuclear extracts from the mammary gland were made from organs derived from different developmental stages ground into powder in liquid nitrogen. Whole cell extracts were prepared as described (13) , and protein concentrations were determined by Bradford assay.

Electromobility shift assays
Binding reactions were carried out with double-stranded oligonucleotides labeled with [{gamma}-32P] ATP (>6000 Ci/mmol). The following oligonucleotides were used (only the upper strand is shown, binding sites are underlined): NF-{kappa}B, 5'AGTTGAGGGGACTTTCCCAGG3'; STAT5, 5'TGTGGACTTCTTGGAATTAAGGGACTTTTG3'; and SP1, 5'ATTCGATCGGGGCGGGGCGAGC3'. The sequence of the oligonucleotide NF-{kappa}B contains an NF-{kappa}B site from the {kappa} light chain enhancer in B cells; the sequence of the STAT5 oligonucleotide spans the lactogenic hormone-responsive region in the rat ß-casein promoter containing the binding site for STAT5 (TTCTTGGAA) and NF-{kappa}B (GGGACTTTG). Equal amounts of nuclear extracts or whole cell extracts (5 or 10 µg) were incubated for 30 min on ice with 50,000 cpm of double-stranded oligonucleotide, a 100-fold molar excess of unlabeled single-stranded oligonucleotide, 10 mM Tris/HCl (pH 7.6), 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, and 1 µg poly(dI-dC).

In supershift experiments, extracts were preincubated with 1 µl of rabbit polyclonal antibodies against the Rel family proteins p50 and p65 (sc-114 and sc-372, respectively, obtained from Santa Cruz Biotechnology, Santa Cruz, Calif.) for 30 min at room temperature before adding the labeled oligonucleotide. For oligonucleotide competition experiments, a 100-fold molar excess of unlabeled oligonucleotide was included in the reaction mix and incubated for 30 min at room temperature before adding the labeled oligonucleotide. Complexes were separated on 4% polyacrylamide gels in 0.25 x TBE electrophoresis buffer as described (16) . Experiments shown were repeated at least three times by using independent extracts.

Immunoprecipitation
For immunoprecipitation, 6 x 106 hormone-treated HC11 cells were incubated with 1 ml lysis buffer (50 mM HEPES, 150 mM NaCl, 0.1% Nonidet P-40, 10% glycerol, 50 mM NaF, 1 mM orthovanadat, 1 mM DTT, 10 M PMSF, 2 µg/ml leupeptin, 5 µg/ml aprotinin) for 10 min at 4°C. After centrifugation at 17,500 g for 10 min, the supernatant was incubated with 2 µl of polyclonal STAT5A (provided by T. Decker) together with 25 µl protein A agarose (50% slurry, Santa Cruz) for 1 h at 4°C. Absorbed immunocomplexes were washed three times with washing buffer (50 mM HEPES, 150 mM NaCl 0.1% Nonidet P-40, 0.1 mM orthovanadat, 1 mM DTT), directly eluted with SDS-sample buffer, and analyzed by gel electrophoresis on NuPAGE 4–12% Bis-Tris gels (Novex, San Diego, Calif.). Separated proteins were subjected to Western blot analysis as described below.

Western blot analysis
Equal amounts of whole cell extracts or nuclear extracts (10 µg) were subjected to gel electrophoresis in NuPAGE 4–12% Bis-Tris gels (Novex) and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, Mass.). Membranes were incubated with a 2000-fold dilution of a polyclonal rabbit anti-milk protein antibody (17) or a monoclonal mouse phosphotyrosine antibody (4G10, Upstate Biotechnology, Lake Placid, N.Y.), a 1000-fold dilution of a polyclonal rabbit p65 antibody (sc-372, Santa Cruz Biotechnology), a 1000-fold dilution of a polyclonal goat p50 antibody (sc-1190X, Santa Cruz Biotechnology) or a polyclonal rabbit SP1 antibody (sc-59X, Santa Cruz Biotechnology), and a 300-fold dilution of a monoclonal mouse STAT5A antibody (Transduction Laboratories, Lexington, Ky.). Anti-mouse and rabbit secondary antibodies were obtained from Santa Cruz. Specific proteins were visualized by enhanced chemiluminescence (Amersham, Buckinghamshire, U.K.). Quantitation was performed by densitometry.

Transfection conditions and reporter gene assays
Transfections were done with the calcium phosphate precipitation technique essentially as described (18) . For generation of stably transfected HC11 cells, 10 µg DNA of a mouse ß-casein-Luc reporter gene construct, which contains the region from -300 to -1 of the mouse promoter in front of the luciferase reporter gene, and 1 µg of pSV2neo were cotransfected per 10 cm diameter tissue culture plates. Colonies resistant to the antibiotic G418 were selected for the hormone induction experiments. For reporter gene assays, 293 cells were split into 6-well dishes at a cell density of 1–2 x 105 cells per well. Nine micrograms ß-casein gene promoter-Luc construct with the sequence from -344 to -1 of the rat gene (19) , 4.2 µg mouse prolactin receptor expression vector pcDNAI-PRLR (19) , 4.2 µg STAT5A expression vector pECESTAT5A (19) , 1.8 µg Renilla reporter construct pRL-SV40 (Promega, Madison, Wis.), and a total of 0.3 µg of expression vectors for p50 (20) or p65 (21) were used per six wells for transfections. Eighteen hours after transfection, precipitates were removed by washing with RPMI 1640 containing 2% fetal calf serum and cells were treated with hormones for 24 h, as indicated. For determination of firefly and Renilla luciferase activity, cells were lysed with 250 µl buffer containing 25 mM glycylglycine (pH 7.8), 15 mM MgSO4, 4 mM EGTA, 1 mM DTT, and 0.2% Tween 20. Lysates were scraped off the dish and transferred into 1.5 ml centrifuge tubes, incubated under vigorous shaking for 20 min at 4°C, and centrifuged at 10,000 g for 5 min. Aliquots of the supernatant were used to determine either firefly luciferase activity, as described (18) , or Renilla luciferase activity, as described previously (22) . For preparation of nuclear extracts from transfected 293T cells, a total amount of 3 µg of Rel family member p50 (20) and p65 (21) was used per 10 cm diameter tissue culture plates for transfection.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
NF-{kappa}B p50/p50 and p50/p65 are present in the mammary gland of mice and in the mouse mammary epithelia cell line HC11
Although it is known that NF-{kappa}B family members p50 and p65 are expressed in multiple tissues (2) , to date there are no reports describing the expression and developmental regulation of Rel family members in the mammary gland. Therefore, we determined which members of this family of transcription factors are present and active in the mammary epithelium. For that purpose, nuclear extracts of mammary gland tissue from pregnant mice at day 16 (P16) and nuclear extracts of the mammary epithelial cell line HC11, which is derived from mammary glands of mid-pregnant mice (23) , were prepared and analyzed by electrophoretic mobility shift assay (EMSA). An oligonucleotide probe comprising the consensus NF-{kappa}B site from the {kappa} light enhancer was used (Fig. 1 ). Extracts from 293T cells transfected with expression vectors for p50 and p65 served as controls and formed complexes containing p50 and p65 homodimers (Fig. 1A , lanes 1, 3) and p50/p65 heterodimers (Fig. 1A , lane 5). Antibodies specific for p50 and p65 reacted with these complexes as expected (Fig. 1A , lanes 2, 4, 6).



View larger version (66K):
[in this window]
[in a new window]
  		Figure 1. Identification of NF-{kappa}B complexes in the mammary gland and in HC11 cells. Electromobility shift assays were performed using a probe containing the sequence of a classical NF-{kappa}B binding site (NF-{kappa}B) from the {kappa} light chain enhancer and equal amounts of nuclear extracts in the presence and absence of antibodies (Ab), as indicated at the top of each lane. Arrows in the left margin mark the positions of NF-{kappa}B-specific and nonspecific (ns) complexes. Supershifted complexes (ss) are indicated on the right. Experiments shown were performed in triplicate with consistent results. A) EMSA with nuclear extracts of 293T cells transiently transfected with expression vectors for the Rel family members p50 (lanes 1, 2), p65 (lanes 3,4), p50, and p65 (lanes 5, 6). For supershifts, antibodies against p50 (lanes 2, 6) and p65 (lanes 4, 6) were included into the reaction mixture. B) EMSA with nuclear extracts of non hormone-treated HC11 cells (5 µg) kept for 2 days in epidermal growth factor-free medium, as described in Material and Methods, and mammary gland tissue from pregnant mice at day 16, P16 (7 µg). Antibodies used for supershifts were directed against p50 (lanes 2, 6) and p65 (lanes 4, 8). C) EMSA with DNA probes containing the sequence of a classical NF-{kappa}B binding site (first part of panel), a STAT5 binding site (second part of panel), and an SP1 binding site (third part of panel). Nuclear extracts were prepared from mammary glands of pregnant (day 12–18; lanes 1–4) and lactating mice (day 3–14; lanes 5–8). Only the part of the gel with the specific complexes is shown. The days of pregnancy and lactation are indicated at the top of each panel. Arrows indicate the position of p50/p50, p50/p65, STAT5, and SP1 complexes, respectively.

In nuclear extracts of HC11 cells, p50/p50 homodimers and p50/p65 heterodimers (Fig. 1B , lanes 5, 7) were identified by their immunoreactivity to p50- and p65-specific antibodies: The p50/p50 complex was recognized by the p50-specific antibody (Fig. 1B , lane 6), but not by the p65-specific antibody (Fig. 1B , lane 8); the p50/p65 complex reacted partially with the p50 (Fig. 1 , lane 6) and completely with the p65 antibody (Fig. 1B , lane 8). The other two complexes formed with the NF-{kappa}B probe and HC11 nuclear extracts did not react with the NF-{kappa}B antibodies used; they were not competed with a 100-fold molar excess of the NF-{kappa}B-specific probe (see also Fig. 6 ) and therefore were not considered to be NF-{kappa}B-specific complexes. Extracts derived from the P16 mammary gland contained essential the same complexes with the exception of a lower abundance of the p50/p65 complex. Thus, in the nucleus of mammary epithelial cells the NF-{kappa}B forms p50/p50 and p50/p65 were detectable.



View larger version (67K):
[in this window]
[in a new window]
  		Figure 6. Effect of TNF-{alpha} on STAT5 DNA binding in HC11 cells. Electromobility shift assays were performed using a probe spanning the sequence of the lactogenic hormone-responsive region of the ß-casein gene promoter containing an NF-{kappa}B and STAT5 binding site. Equal amounts of HC11 whole cell extracts were incubated in the presence (lanes 1–4) or absence (lanes 5–8) of the unlabeled NF-{kappa}B oligonucleotide (100-fold molar excess) used in Fig. 1 . Extracts of cells treated with prolactin (5 µg/ml) and/or TNF-{alpha} (20 mg/ml) were used as indicated at the top of each lane. Arrows on the left margin mark the positions of NF-{kappa}B p50/p65- and STAT5-specific complexes.

NF-{kappa}B activation in the mouse mammary gland is regulated during pregnancy and lactation
To investigate the role of NF-{kappa}B p50/p50 and p50/p65 in the mammary gland, we analyzed activation of these complexes during mammary gland development. Mammary gland tissue of different developmental stages from pregnant mice (P) between day 12 and day 18 postcoitum and from lactating mice (L) between day 3 and day 14 postpartum was isolated, and nuclear extracts were analyzed by EMSA (Fig. 1C ). Comparing the abundance of p50/p50 and p50/p65 complexes from different stages of development revealed that their activity was regulated. During pregnancy (P), binding activity of both NF-{kappa}B forms peaked at day 16. Activity of p50/p65 was diminished after day 16, whereas p50/p50 decreased; nuclear extracts from mammary glands of lactating mice contained little p50/p50 NF-{kappa}B binding activity at the onset of lactation (Fig. 1C , first part of panel, lane 5), but no detectable activity after the first week of lactation (Fig. 1C , lanes 6–8). The same nuclear extracts were examined for binding activity of STAT5 (Fig. 1C , second part of panel) and SP1 (Fig. 1C , third part of panel). The developmental regulation of STAT5 observed was consistent with previously described results (13) and opposite to the regulation of p50/p65 and p50/p50. In particular, the peak of STAT5 activation was more pronounced and occurred at a later developmental stage compared to NF-{kappa}B. On the contrary, SP1 binding activity remained fairly consistent until day 10 of lactation, indicating that the changes in binding activity observed with the other transcription factors were not due to a general effect.

Nuclear translocation of NF-{kappa}B p65 is developmentally regulated in the mammary gland
Several mechanisms can be envisaged to be responsible for the absence of NF-{kappa}B binding activity at later stages of lactation (Fig. 1C , first part of panel, lanes 6–8): reduced expression of p50 or p65 protein, sequestering of NF-{kappa}B complexes within the cytoplasm by I{kappa}B, or inhibition of nuclear binding by proteins present in the nucleus. To elucidate which of these putative mechanisms are prevalent, we compared the protein levels of p50 and p65 in nuclear extracts and whole cell extracts by immunoblot analysis. Whereas p65 protein levels in both extracts were comparable during pregnancy (Fig. 2 , lanes 1–3), at later stages of lactation the majority of p65 protein was found in whole cell extracts (Fig. 2 , lanes 6–8). This suggests that the absence of p50/p65 NF-{kappa}B binding activity during lactation (L3-L10) is due to inhibited translocation of the p65 protein into the nucleus. Accordingly, p50 expression levels in the nucleus were also diminished during lactation but apparently remained invariant in total cell extracts. At day P18, p65 protein levels were reduced in both whole cell extracts and nuclear extracts (Fig. 2 , lane 4), indicating that the decreased binding activity of p50/p65 in the nucleus at this stage (Fig. 1C , first part, lane 4) might be the result of reduced expression levels of p65 rather than inhibition of nuclear translocation. Control immunoblot experiments with an SP1-specific antibody and the same mammary gland extracts revealed no pronounced difference of nuclear SP-1 protein levels between pregnancy and early lactation, indicating that the stage-specific differences in NF-{kappa}B expression and translocation were not due to general differences in the fraction of nuclear proteins present in the extracts.



View larger version (67K):
[in this window]
[in a new window]
  		Figure 2. Presence of NF-{kappa}B p50 and p65 in the nucleus during pregnancy and lactation. Western blot analysis of mammary gland nuclear (upper part of panel) and whole cell extracts (lower part of panel) prepared from mice at the same developmental stages as in Fig. 1C . Polyclonal antibodies specific for p50, p65, and SP1 (sc-1190X, sc-372, and sc-59X; Santa Cruz Biotechnology) were used. Arrows indicate the p50-, p65-, and SP1-specific bands. The position of the p50-specific band was determined by comparison with the migration of recombinant p50 expressed in 293 cells. The size of the standard proteins is indicated at the left margin. Western blots shown were performed at least three times with consistent results.

Functional repression of STAT5-mediated activation of transcription by NF-{kappa}B
To gain insight into the functional role of NF-{kappa}B in the mammary gland, we investigated the effects of activated NF-{kappa}B on the prolactin receptor/JAK2/STAT5 pathway, a signaling pathway previously shown to be important for mammary gland differentiation during pregnancy. We first used transient cotransfection experiments by using 293 cells. Since these cells are devoid of endogenously expressed prolactin receptor and STAT5, the prolactin receptor/JAK2/STAT5 pathway can be reconstituted by coexpression of the prolactin receptor and STAT5 and can be activated by stimulating the cells with prolactin (18 , 24) . A ß-casein gene luciferase reporter construct served to monitor the transcriptional activity of STAT5 in this assay. As shown in Fig. 3 (third and sixth column from the left), the activity of the ß-casein gene promoter is stimulated 52-fold by prolactin under these conditions. Coexpression of p50 and p65 together with STAT5 and prolactin receptor expression vectors leads to distinct results on ß-casein gene promoter activity, depending on whether STAT5 was activated by prolactin or not. In noninduced cells (-PRL), expression of p50 and p65 resulted in a 3.7-fold increase of the basal promoter activity (Fig. 3 , columns 2 and 3), indicating that the NF-{kappa}B p50/p65 complex itself, which induces promoter activity in many other genes (1) , serves as a weak activator of ß-casein gene transcription in the absence of an activated prolactin receptor/JAK2/STAT5 pathway. As expected, expression of p50 alone (Fig. 3 , column 1), which is devoid of a trans-activation domain, had no effect on promoter activity. By inducing cells with prolactin (+PRL), coexpression of p50 and p65 repressed the STAT5-mediated activation of the ß-casein gene promoter by 79% (Fig. 3 , columns 5 and 6), whereas expression of p50 alone had nearly no effect on promoter activity. These results indicate an inhibition of STAT5-mediated transcription by NF-{kappa}B p50/p65 heterodimers.



View larger version (22K):
[in this window]
[in a new window]
  		Figure 3. NF-{kappa}B inhibits STAT5-mediated activation of transcription in transfected 293 cells. Transient transfections were performed with a ß-casein gene promoter-Luc construct comprising the region from -344 to -1 of the rat gene and expression vectors for STAT5A, the prolactin receptor, and a SV40 Renilla reporter construct. Hormone inductions were performed with prolactin (5 µg/ml) for 24 h. Luciferase reporter gene activity was determined and normalized to Renilla activity. The data shown are the mean of five independent experiments assayed in triplicate with the SE indicated by bars. Values are given relative to the promoter activity of uninduced cells not transfected with Rel proteins.

In HC11 cells NF-{kappa}B is activated by TNF-{alpha} and inhibited by parthenolide
We next investigated the role of NF-{kappa}B on STAT5 signaling in mammary epithelial cells. NF-{kappa}B activity was regulated by external stimuli using TNF-{alpha}, an activator of NF-{kappa}B (1) , and parthenolide, a sesquiterpene lactone previously described as an inhibitor of NF-{kappa}B activation (14) . The influence of TNF-{alpha} on NF-{kappa}B activation in HC11 cells was determined by its effect on NF-{kappa}B DNA binding activity determined by EMSA in nuclear extracts (Fig. 4 ). As shown in Fig. 4 , TNF-{alpha} increased p50/p65 DNA binding activity with a maximum at 30 min (100% increase), whereas no TNF-{alpha} effect on p50/p50 was observed under the same conditions. The activation of NF-{kappa}B p50/p65 by TNF-{alpha} observed in HC11 cells was similar to what has been described in other cell types (15) . Treating HC11 with parthenolide resulted in a 50% reduction of NF-{kappa}B p50/p65 DNA binding activity (Fig. 4B ). These results indicate that the basal level of NF-{kappa}B binding activity observed in HC11 cells not treated with TNF-{alpha} is apparently due to persistent activation by a pathway, which is susceptible to the inhibitory effect of parthenolide. Thus, treatment of HC11 cells with either TNF-{alpha} or parthenolide selectively up- or down-regulated binding activity of the p50/p65 heterodimeric complex in the nucleus and thus allowed us to examine cells with different NF-{kappa}B activation status for the functional activation of the prolactin receptor/JAK2/STAT5 pathway. As a parameter for the activity of this pathway, prolactin-induced tyrosine phosphorylation of STAT5 was determined.



View larger version (57K):
[in this window]
[in a new window]
  		Figure 4. Effects of TNF-{alpha} and parthenolide on NF-{kappa}B DNA binding activity in nuclear extracts of HC11 cells. EMSA were carried out with the NF-{kappa}B oligonucleotide and an SP1 oligonucleotide as control. Arrows indicate the position of the NF-{kappa}B complexes (p50/p50, p50/p65), SP1, and a nonspecific complex (ns). The abundance of NF-{kappa}B complexes were quantified by PhosphorImager analysis. Values are shown for p50/p65 (closed bars) and p50/p50 (open bars) beside each panel as percent of controls not treated with TNF-{alpha} or parthenolide. The data shown are the mean of three independent experiments with the SE indicated by bars. A) Activation of DNA binding activity by TNF-{alpha}. HC11 cells were treated with TNF-{alpha} (20 ng/ml) for the times indicated. B) Inhibition of DNA binding activity by parthenolide. Treatment was for 1 h with the indicated concentrations of parthenolide.

STAT5 tyrosine phosphorylation is repressed by TNF-{alpha}
To assess the effect of NF-{kappa}B activation by TNF-{alpha}, STAT5 immunoprecipitates of cells treated with TNF-{alpha} and prolactin were analyzed by Western blotting with a phosphotyrosine antibody and compared to cells treated with prolactin alone. As shown in Fig. 5A , TNF-{alpha} treatment leads to a reduction of STAT5 tyrosine phosphorylation in a time-dependent fashion, resulting in a 70% repression of STAT5 phosphorylation after 10 to 24 h (Fig. 5A , lanes 4, 5).



View larger version (30K):
[in this window]
[in a new window]
  		Figure 5. Effect of TNF-{alpha} on STAT5 tyrosine phosphorylation in HC11 cells. Immunoprecipitation of STAT5 from HC11 induced with 5 µg/ml PRL for 15 min. Immunostaining of the membranes was performed with a monoclonal antibody directed against phosphotyrosine (upper panel) and with a monoclonal antibody directed against STAT5 (lower panel). The bands corresponding to STAT5 phosphotyrosine and STAT5 are indicated by arrows. The position of the molecular weight marker is indicated at the left margin. Results of the densitometric analysis of the phosphotyrosine-specific band normalized to the STAT5 protein level are shown below as percent of controls not treated with TNF-{alpha}. The data shown are the mean of three independent experiments with the SE indicated by bars. A) Repression of STAT5 tyrosine phosphorylation by TNF-{alpha}. Cells were treated with 20 ng/ml TNF-{alpha} for the time indicated. B) Repression of STAT5 tyrosine phosphorylation by TNF-{alpha} is reversible. After cells were treated with 20 ng/ml TNF-{alpha} for 24 h, they were kept in a TNF-{alpha}-free medium for the time period indicated.

The reversibility of the effect of a 24 h incubation with TNF-{alpha} was investigated by incubating cells for the times indicated in TNF-{alpha}-free medium. As shown in Fig. 5B , the repression of prolactin-induced tyrosine phosphorylation of STAT5 by TNF-{alpha} was partially relieved after a TNF-{alpha}-free period of 2 h (Fig. 5B , lane 3) and nearly completely relieved after 10 to 24 h (Fig. 5B , lanes 4, 5). These results indicate that TNF-{alpha} negatively affects STAT5 tyrosine phosphorylation in HC11 cells and that this inhibitory effect can be reversed by removing TNF-{alpha} from the medium. However, relief of repression after TNF-{alpha} removal was not instantaneous, raising the possibility that the TNF-{alpha} effect is mediated via the expression of NF-{kappa}B-regulated genes, which remain active for several hours after TNF-{alpha} removal, and not directly via NF-{kappa}B.

STAT5 DNA binding is inhibited by TNF-{alpha}
We next investigated whether the observed reduction of STAT5 tyrosine phosphorylation in response to TNF-{alpha} also results in reduced STAT5 DNA binding by EMSA using a DNA probe spanning the proximal STAT5 binding site of the ß-casein gene promoter. As shown in Fig. 6 , prolactin-induced STAT5 DNA binding was reversible inhibited by a 24 h TNF-{alpha} treatment (compare lanes 2 and 4). Since the probe used contains a weak NF-{kappa}B binding site described in Material and Methods that forms a p50/p65 complex with HC11 cell extracts (S. Geymayer, unpublished, position of complex is indicated in Fig. 6 ), the reduced STAT5 binding could also be due to competition between NF-{kappa}B and STAT5 for binding. However, preventing NF-{kappa}B DNA binding to the probe by inclusion of a 100-fold molar excess of an unlabeled high affinity NF-{kappa}B DNA sequence (Fig. 6 , lanes 5–8) did not alter the reduced STAT5 DNA binding by TNF-{alpha}, indicating that this inhibition is not due to competition for binding.

STAT5 tyrosine phosphorylation is induced by parthenolide
If NF-{kappa}B is involved in attenuating the prolactin receptor/JAK2/STAT5 pathway, one would expect that parthenolide, which inactivates NF-{kappa}B p50/p65 (Fig. 4B ), would stimulate this pathway. Indeed, parthenolide treatment for 24 h led to elevated levels of STAT5 tyrosine phosphorylation (Fig. 7 ), with a maximal effect at 10 µM. The combined results of Figs. 5 6 7 support the hypothesis that NF-{kappa}B inhibits STAT5 activation at the level of tyrosine phosphorylation.



View larger version (48K):
[in this window]
[in a new window]
  		Figure 7. Effect of parthenolide on STAT5 tyrosine phosphorylation in HC11 cells. Immunoprecipitation of STAT5 from HC11 cells treated with the indicated concentration of parthenolide for 24 h and induced with 5 µg/ml PRL for 15 min. Immunostaining of the membranes were performed with a monoclonal antibody directed against phosphotyrosine (upper panel) and with a monoclonal antibody directed against STAT5 (lower panel). The bands corresponding to STAT5 phosphotyrosine and STAT5 are indicated by arrows. The position of the molecular weight marker is indicated at the left margin. The results of the densitometric analysis of the phosphotyrosine-specific band normalized to the STAT5 protein level are shown below as percent of controls not treated with TNF-{alpha}. The data shown are the mean of three independent experiments with the SE indicated by bars.

The STAT5-mediated gene ß-casein is repressed by TNF-{alpha} and activated by parthenolide
To assess the biological consequences of modulation of STAT5 tyrosine phosphorylation by NF-{kappa}B in HC11 cells, expression of the STAT5-induced gene ß-casein was analyzed in cells where NF-{kappa}B was activated or inactivated by treatment with TNF-{alpha} or parthenolide. Endogenous ß-casein protein levels were determined by immunoblotting cells treated for 48 h with prolactin and the synthetic glucocorticoid dexamethasone, an obligate costimulator required for the expression of ß-casein in these cells (23) . As shown in Fig. 8 , TNF-{alpha} inhibited the ß-casein protein level in a dose-dependent fashion (Fig. 8A ), whereas treatment with increasing concentrations of parthenolide resulted in elevated ß-casein protein levels (Fig. 9A ). Neither TNF-{alpha} nor parthenolide affected the protein level of SP1, indicating the effects of these substances to be specific for STAT5-mediated gene expression and demonstrating that the decrease of ß-casein protein is not due to toxic effects of TNF-{alpha}. To directly assess whether TNF-{alpha} or parthenolide acts at the transcription level (e.g., by modulating STAT5 activation) and not by regulation of message stability or protein degradation of ß-casein, we used HC11 cells stably transfected with a mouse ß-casein gene promoter luciferase reporter construct to perform trans-activation assays. The effect of a 24 h treatment with TNF-{alpha} or parthenolide on luciferase activity was measured in the presence or absence of prolactin and dexamethasone. In hormone-treated cells (+Dex/PRL), parthenolide and TNF-{alpha} changed the activity of the reporter gene in a fashion similar to that observed with the endogenous ß-casein protein (compare Fig. 8B , closed bars, with Fig. 8A ). Promoter activity was decreased 60% by 80 ng/ml TNF-{alpha} (Fig. 8B ) and was increased 63% by 10 µM parthenolide (Fig. 9B ), indicating that TNF-{alpha} and parthenolide act at the transcription level. In untreated cells (-Dex/PRL), TNF-{alpha} had no effect and parthenolide slightly decreased ß-casein gene promoter activity (Fig. 8B and Fig. 9B , open bars), indicating that the effects of these substances observed in prolactin- and dexamethasone-induced cells cannot be attributed to an effect on basal promoter activity. Thus, TNF-{alpha}-induced activation of p50/p65 and decreased tyrosine phosphorylation of STAT5 correlate with down-regulation of ß-casein gene expression, whereas parthenolide-mediated inactivation of p50/p65 and increased tyrosine phosphorylation of STAT5 resulted in elevated ß-casein gene expression.



View larger version (33K):
[in this window]
[in a new window]
  		Figure 8. Effect of TNF-{alpha} on the expression of the endogenous ß-casein gene and of a stable transfected ß-casein gene promoter luciferase construct. A) Western blot analysis of the ß-casein protein in whole cell extracts of HC11 cells induced with dexamethasone (0.1 µM), prolactin (5 µg/ml), and the indicated TNF-{alpha} concentration for 48 h. Immunostaining of the membranes were performed with a polyclonal antibody directed against mouse milk proteins and SP1 (sc-59X, Santa Cruz Biotechnology). The bands corresponding to ß-casein and SP1 are indicated by arrows. The position of the molecular weight marker is indicated at the left margin. The results of the densitometric analysis of the ß-casein protein-specific band are shown below the panel as percent of controls not treated with TNF-{alpha}. The data shown are the mean of three independent experiments with the SE indicated by bars. B) Expression of the luciferase reporter was determined in HC11 transfectants induced with dexamethasone (0.1 µM) and prolactin (5 µM) for 24 h (+Dex/PRL) or kept in the absence of hormones (-Dex/PRL). The indicated concentrations of TNF-{alpha} were added 24 h before preparation of extracts. Luciferase activity was normalized to protein concentration and results are given as the mean ± SE of five independent experiments.



View larger version (26K):
[in this window]
[in a new window]
  		Figure 9. Effect of parthenolide on the expression of the endogenous ß-casein gene and of a stably transfected ß-casein gene promoter luciferase reporter construct. A) Western blot analysis of the ß-casein protein in whole cell extracts of HC11 cells induced with dexamethasone (0.1 µM) and prolactin (5 µg/ml) for 48 h. Parthenolide was added at the indicated concentration 1 h before induction with dexamethasone and prolactin. Immunostaining of the membranes were performed with a polyclonal antibody directed against mouse milk proteins and SP1 (sc-59X, Santa Cruz Biotechnology). The bands corresponding to ß-casein and SP1 are indicated by an arrow. The position of the molecular weight marker is indicated at the left margin. The results of the densitometric analysis of the ß-casein protein-specific band are shown below the panel as percent of controls not treated with parthenolide. The data shown are the mean of three independent experiments with the SE indicated by bars. B) Expression of the luciferase reporter was determined in HC11 transfectants induced with dexamethasone (0.1 µM) and prolactin (5 µM) for 24 h (+Dex/PRL) or kept in the absence of hormones (-Dex/PRL). The indicated concentrations of parthenolide were added 25 h before preparation of extracts (1 h before induction with dexamethasone and prolactin). Luciferase activity was normalized to protein concentration and results are given as the mean ± SE of five independent experiments.

Our results establish the inhibition of STAT5 tyrosine phosphorylation as a novel mechanism of cross talk between NF-{kappa}B- and STAT5-activating pathways and reveal the milk protein ß-casein as a new target gene repressed by NF-{kappa}B in mammary epithelial cells.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our study provides evidence for a developmental regulation of NF-{kappa}B translocation into the nucleus of mouse mammary gland cells. Nuclear NF-{kappa}B binding activity was detectable in nuclear extracts derived from mammary epithelium of mid- to late-pregnant mice and was absent in lactating mice. Similarly, in the established mammary epithelial cell line HC11, which also originated from mammary glands of mid-pregnant mice (23) , NF-{kappa}B binding activity was observed. In both cases, the activated NF-{kappa}B was present as p50/p50 and p50/p65 complexes.

A novel finding of the present study is the negative cross talk between activated NF-{kappa}B and the prolactin receptor/JAK2/STAT5 pathway. One important mechanism in this cross talk represents the effect of NF-{kappa}B on STAT5 tyrosine phosphorylation. It appears likely that it is mediated indirectly, since there is no evidence by coimmunoprecipitation experiments that NF-{kappa}B and STAT5 interact directly at the protein level (S. Geymayer, unpublished results). Furthermore, the recovery kinetics for STAT5 tyrosine phosphorylation after TNF-{alpha} washout (Fig. 5B ) are slower than would be expected if the main effect was due to a direct NF-{kappa}B effect, and point to the persistent action of one or more NF-{kappa}B-regulated gene products with a longer half-life than nuclear NF-{kappa}B. An additional argument for an indirect effect is the finding that the transcriptional activator p50/p65 was a more potent inhibitor of STAT5-mediated gene transcription than p50/p50, an NF-{kappa}B form lacking a trans-activation domain (Fig. 3) . This indirect effect could involve p50/p65-mediated induction of STAT5-specific tyrosine phosphatases or of STAT activation inhibitors such as members of the family of cytokine-inducible SH-2 domain proteins (25) .

The effect of TNF-{alpha} on modulating STAT5 tyrosine phosphorylation does not appear to be restricted to the prolactin receptor/JAK2 pathway. Recent studies have demonstrated a negative interference between the TNF receptor cascade and the insulin signaling pathway at the level of STAT5 tyrosine phosphorylation in mouse muscle cells, where it was postulated that the decrease in STAT5 tyrosine phosphorylation might play a role in insulin resistance leading to type II diabetes (26) .

Another level of inhibition of STAT function by NF-{kappa}B is competition for binding to DNA. An example for such an interaction has been described recently (27) . STAT6 was shown to inhibit activation of E-selectin gene transcription by antagonizing DNA binding of NF-{kappa}B through occupation of an adjacent binding site. The mapping of a binding site for NF-{kappa}B adjacent to the STAT5 binding site in the rat ß-casein gene promoter at position -75 to -84 (S. Geymayer, unpublished data) indicated that such a mechanism could be also relevant for explaining the negative effect of NF-{kappa}B on STAT5-mediated ß-casein gene transcription. However, mutation of this NF-{kappa}B site did not prevent repression of STAT5 by NF-{kappa}B in 293 cells, indicating that the repression does not necessarily depend on binding of NF-{kappa}B to this sequence.

Since ß-casein gene expression in the mammary gland and in HC11 cells requires the activated glucocorticoid receptor (23 , 28) , the inhibitory effect of NF-{kappa}B on the ß-casein gene transcription could be also mediated by an antagonistic interaction between NF-{kappa}B and the glucocorticoid receptor. In the immune system, the mechanism by which these two transcription factors antagonize each other has been investigated intensively (29) . However, it should be noted that such an antagonism alone cannot be responsible for the observed effects of NF-{kappa}B on ß-casein gene expression, since the inhibitory effect did not require the activated glucocorticoid receptor in 293 cells (Fig. 4) and the effect of NF-{kappa}B activation on STAT5 tyrosine phosphorylation was observed in the absence of activated glucocorticoid receptor.

The mechanism by which NF-{kappa}B is activated during mammary gland development remains unclear. NF-{kappa}B has the capability to respond to a diverse range of stimuli, such as TNF-{alpha}, lipopolysaccharide, interleukin 1, oxygen free radicals, UV light, and {gamma}-irradiation (1) . In the mammary gland, a reasonable candidate for NF-{kappa}B activation is TNF-{alpha}. Previous studies demonstrated that normal rat mammary epithelial cells produce TNF-{alpha} (30 , 31) and suggested that it might play a physiological role in directing growth and development of the mammary gland (30) . In this study, high levels of TNF-{alpha} mRNA were detected during pregnancy, which decreased during lactation and involution. The TNF-{alpha} expression pattern observed is similar to the activation profile of NF-{kappa}B during mammary gland development found in our investigation (Fig. 1C ) and is consistent with the assumption that TNF-{alpha} is responsible for NF-{kappa}B activation in the mammary gland. However, other mechanisms for NF-{kappa}B activation, e.g., the recently described epidermal growth factor receptor-mediated pathway (32) , could be involved since members of the epidermal growth factor receptor family are important regulators of mammary gland growth and development during pregnancy (33) .

The constitutive NF-{kappa}B binding activity exhibited in HC11 cells was blocked by parthenolide (Fig. 4B ), a recently described inhibitor of NF-{kappa}B activation. Parthenolide acts by preventing the degradation of I{kappa}B-{alpha} and I{kappa}B-ß in response to external stimuli (14) , thereby inhibiting NF-{kappa}B activation. The sensitivity of the constitutive-activated NF-{kappa}B to parthenolide indicates that in HC11 cells, an autonomous signaling pathway is responsible for the degradation of I{kappa}B forms and subsequent activation of NF-{kappa}B. This pathway could potentially involve autocrine mechanisms, such as production of TNF-{alpha} by HC11 cells. It was possible to further increase the constitutive NF-{kappa}B binding activity with TNF-{alpha} (Fig. 4A , lanes 2–4), indicating that the autonomous pathway does not lead to full activation of NF-{kappa}B.

Several distinct functions have been attributed to NF-{kappa}B in mature tissues, including maintenance of tissue function (8) , tissue remodeling (11) , and anti-apoptotic activity (2) . Aberrant NF-{kappa}B activity has frequently been observed in tumor cells, and is thought to provide a survival advantage for tumor cells and to facilitate metastasis (12) . In the mammary gland, NF-{kappa}B may also be involved in blocking premature terminal differentiation of the gland before onset of lactation, as suggested by our finding that NF-{kappa}B p50/p65 represses ß-casein gene promoter activity in 293 cells (Fig. 3) and that activation of NF-{kappa}B inversely correlates with ß-casein gene expression in HC11 cells. Based on our results with cell lines, it is likely that the activation of NF-{kappa}B in the mammary gland of pregnant mice contributes to an attenuation of the ß-casein gene expression at this stage of development by inhibiting STAT5 activation. This notion is supported by the observed inverse correlation of NF-{kappa}B p50/p65 and STAT5 DNA binding activity during pregnancy as shown in Fig. 1C .

Inhibition of premature ß-casein gene activation appears to be one of the functions of activated NF-{kappa}B during pregnancy. Further experiments using mice with a genetically altered activation pathway of NF-{kappa}B will be required to gain a more complete understanding of its role in mammary gland development and involution. Regarding the two NF-{kappa}B complexes p50/p50 and p50/p65, which are detectable in nuclei of mammary epithelial cells, changes in the nuclear concentration of the p50/p65 heterodimer were more pronounced and correlated to inhibition of ß-casein gene expression, indicating a special role of p65 in the mammary gland. Since the available p65 knockouts are embryonic lethal (34) and thus not suitable for analysis of mammary gland development, the generation of mice with a conditional p65 knockout would be of prime interest to elucidate the function of NF-{kappa}B p50/p65 during mammary gland development.


   ACKNOWLEDGMENTS
 
This work was supported by the Fonds zur Förderung der Wissenschaftlichen Forschung, project F209. We are grateful to T. Welte, M. Tonko, R. Kofler, A. Helmberg, K. Illmensee, and G. Daxenbichler for critically reading the manuscript and to M. Naumann for providing the NF-{kappa}B expression vectors p50 and p65. We thank M. Tonko and K. Garimorth for their help in preparing mammary gland extracts from different developmental stages and C. Soratroi for excellent technical assistance.


   FOOTNOTES
 
Received for publication July 27, 1999. Revised for publication January 3, 2000.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Baeuerle, P. A., Henkel, T. (1994) Function and activation of NF-{kappa}B in the immune system. Annu. Rev. Immunol. 12,141-179[Medline]
  2. Ghosh, S., May, M. J., Kopp, E. B. (1998) NF-{kappa}B and rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16,225-260[Medline]
  3. Caamono, J. H., Rizzo, C. A., Durham, S. K., Barton, D. S., Raventos-Suarez, C., Snapper, C. M., Bravo, R. (1998) NF-{kappa}B2 (p100/p52) is required for normal splenic microarchitecture and B-cell-mediated immune responses. J. Exp. Med. 187,185-196[Abstract/Free Full Text]
  4. Baichwal, V. R., Baeuerle, P. A. (1997) Activate NF-kappaB or die?. Curr. Biol. 7,94-96
  5. Beg, A. A., Sha, W. C., Bronson, R. T., Gosch, S., Baltimore, D. (1995) Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-{kappa}B. Nature (London) 376,167-170[Medline]
  6. Horwitz, B. H., Scott, M. L., Cherry, S. R., Bronson, R. T., Baltimore, D. (1997) Failure of lymphopoiesis after adoptive transfer of NF-{kappa}B-deficient fetal liver cells. Immunity 6,765-772[Medline]
  7. Steward, R. (1987) Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel. Science 238,692-694[Abstract/Free Full Text]
  8. Schmidt-Ullrich, R., Memét, S., Lilienbaum, A., Feuillard, J., Raphaël, M., Israël, A. (1996) NF-{kappa}B activity in transgenic mice: developmental regulation and tissue specificity. Development 122,2117-2128[Abstract]
  9. Delfino, F., Walker, W. H. (1998) Stage-specific nuclear expression of NF-{kappa}B im mammalian testis. Mol. Endocrinol. 12,1696-1707[Abstract/Free Full Text]
  10. Hennighausen, L., Robinson, G. W. (1998) Think globally, act locally: the making of a mouse mammary gland. Genes Dev 12,449-455[Free Full Text]
  11. Nakshatri, H., Bhat-Nakshatri, P., Martin, D. A., Goulet, R. J., Jr, Sledge, G. W., Jr (1997) Constitutive activation of NF-{kappa}B during progression of breast cancer to hormone-independent growth. Mol. Cell. Biol. 17,3629-3639[Abstract]
  12. Sovak, M. A., Bellas, R. E., Kim, D. W., Zanieski, G. J., Rogers, A. E., Traish, A. M., Sonenshein, G. E. (1997) Aberrant nuclear factor-{kappa}B/Rel expression and the pathogenesis of breast cancer. J. Clin. Invest. 100,2952-2960[Medline]
  13. Welte, T., Garimorth, K., Philipp, S., Doppler, W. (1994) Prolactin-dependent activation of a tyrosine phosphorylated DNA binding factor in mouse mammary epithelial cells. Mol. Endocrinol. 8,1091-1102[Abstract]
  14. Hehner, S. P., Heinrich, M., Bork, P. M., Vogt, M., Ratter, F., Lehmann, V., Schulze-Osthoff, K., Droge, W., Schmitz, M. L. (1998) Sesquiterpene lactones specifically inhibit activation of NF-{kappa}B by preventing the degradation of I{kappa}B-{alpha} and I{kappa}B-ß. J. Biol. Chem. 273,1288-1297[Abstract/Free Full Text]
  15. Cheshire, J., Baldwin, A. S., Jr (1997) Synergistic activation of NF-{kappa}B by tumor necrosis factor alpha and gamma interferon via enhanced I{kappa}B{alpha} degradation and de novo I{kappa}Bß degradation. Mol. Cell. Biol. 17,6746-6754[Abstract]
  16. Welte, T., Garimorth, K., Philipp, S., Jennewein, P., Huck, C., Cato, A. C., Doppler, W. (1994) Involvement of Ets-related proteins in hormone-independent mammary cell-specific gene expression. Eur. J. Biochem. 223,997-1006[Medline]
  17. Streuli, C. H., Edwards, G. M., Delcommenne, M., Whitelaw, C. B., Burdon, T. G., Schindler, C., Watson, C. J. (1995) Stat5 as a target for regulation by extracellular matrix. J. Biol. Chem. 270,21639-21644[Abstract/Free Full Text]
  18. Lechner, J., Welte, T., Tomasi, J. K., Bruno, P., Cairns, C., Gustafsson, J., Doppler, W. (1997) Promoter-dependent synergy between glucocorticoid receptor and Stat5 in the activation of beta-casein gene transcription. J. Biol. Chem. 272,20954-20960[Abstract/Free Full Text]
  19. Mayr, S., Welte, T., Windegger, M., Lechner, J., May, P., Heinrich, P. C., Horn, F., Doppler, W. (1998) Selective coupling of STAT factors to the mouse prolactin receptor. Eur. J. Biochem. 258,784-793[Medline]
  20. Naumann, M., Wulczyn, F. G., Scheidereit, C. (1993) The NF-{kappa}B precursor p105 and the proto-oncogene product Bcl-3 are I{kappa}B molecules and control nuclear translocation of NF-{kappa}B. EMBO J 12,213-222[Medline]
  21. Naumann, M. (1999) INK4 cell cycle inhibitors direct transcriptional inactivation of NF-{kappa}B. Oncogene In press
  22. Winklehner-Jennewein, P., Geymayer, S., Lechner, J., Welte, T., Hansson, L., Geley, S., Doppler, W. (1998) A distal enhancer region in the human ß-casein gene mediates the response to prolactin and glucocorticoid hormones. Gene 217,127-139[Medline]
  23. Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W., Groner, B. (1988) Prolactin regulation of ß-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J 7,2089-2095[Medline]
  24. Stöcklin, E., Wissler, M., Gouilleux, F., Groner, B. (1996) Functional interactions between Stat5 and the glucocorticoid receptor. Nature (London) 383,726-728[Medline]
  25. Starr, R., Hilton, D. J. (1999) Negative regulation of the JAK/STAT pathway. Bioessays 21,47-52[Medline]
  26. Storz, P., Döppler, A., Pfizenmaier, K., Müller, G. (1998) TNF inhibits insulin induced STAT5 activation in differentiated mouse muscle cells pmi28. FEBS. Lett. 440,41-45[Medline]
  27. Shen, C. H., Stavnezer, J. (1998) Interaction of Stat6 and NF-{kappa}B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18,3395-3404[Abstract/Free Full Text]
  28. Topper, Y. J., Freeman, C. S. (1980) Multiple hormone interactions in the developmental biology of the mammary gland. Physiol. Rev. 60,1049-1106[Free Full Text]
  29. Dumont, A., Hehner, S. P., Schmitz, M. L., Gustafsson, J. A., Liden, J., Okret, S., van der Saag, P. T., Wissink, S., van der Burg, B., Herrlich, P., Haegeman, G., De Bosscher, K., Fiers, W. (1998) Cross-talk between steroids and NF-{kappa}B: what language?. Trends Biochem. Sci. 23,233-235[Medline]
  30. Varela, L. M., Ip, M. M. (1996) Tumor necrosis factor-{alpha}: a multifunctional regulator of mammary gland development. Endocrinology 137,4915-4924[Abstract]
  31. Basolo, F., Conaldi, P. G., Fiore, L., Calvo, S., Toniolo, A. (1993) Normal breast epithelial cells produce interleukins 6 and 8 together with tumor necrosis factor: defective IL6 expression in mammary carcinoma. Int. J. Cancer 55,926-930[Medline]
  32. Sun, L., Carpenter, G. (1998) Epidermal growth factor activation of NF-kappaB is mediated through IkappaB alpha degradation and intracellular free calcium. Oncogene 16,2095-2102[Medline]
  33. Luettke, N. C., Qui, T. H., Fenton, S. E., Troyer, K. L., Riedel, R. F., Chang, A., Lee, D. C. (1999) Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development. Development 126,2739-2750[Abstract]
  34. Weih, F., Durham, S. K., Barton, D. S., Sha, W. C., Baltimore, D., Bravo, R. (1997) p50-NF-kappa B complexes partially compensate for the absence of relB: severely increased pathology in p50(-/-) relB(-/-) double-knockout mice. J. Exp. Med. 185,1359-1370[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
L. Zhu, C. Johnson, and M. Bakovic
Stimulation of the human CTP:phosphoethanolamine cytidylyltransferase gene by early growth response protein 1
J. Lipid Res., October 1, 2008; 49(10): 2197 - 2211.
[Abstract] [Full Text] [PDF]