FASEB J. FASEB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BOUCHÉ, M.
Right arrow Articles by MOLINARO, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BOUCHÉ, M.
Right arrow Articles by MOLINARO, M.
(The FASEB Journal. 2000;14:1147-1158.)
© 2000 FASEB

TGF-ß autocrine loop regulates cell growth and myogenic differentiation in human rhabdomyosarcoma cells

MARINA BOUCHÉ1, RITA CANIPARI, ROBERTA MELCHIONNA, DANIELA WILLEMS, MARIA I. SENNI and MARIO MOLINARO

Department of Histology and Medical Embryology, University of Rome ‘La Sapienza’, 00161, Rome, Italy

1Correspondence: Department of Histology and Medical Embryology, University of Rome ‘La Sapienza’, Via A. Scarpa 14, 00161, Rome, Italy. E-mail: bouche{at}uniroma1.it


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Transforming growth factor ß (TGF) is a well-known inhibitor of myogenic differentiation as well as an autocrine product of rhabdomyosarcoma cells. We studied the role of the TGF-ß autocrine loop in regulating growth and myogenic differentiation in the human rhabdomyosarcoma cell line, RD. We previously reported that the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) induces growth arrest and myogenic differentiation in these cells, which constitutively express muscle regulatory factors. We show that TPA inhibits the activation of secreted latent TGF-ß, thus decreasing the concentration of active TGF-ß to which the cells are exposed. This event is mediated by the TPA-induced alteration of the uPA/PAI serine-protease system. Complete removal of TGF-ß, mediated by the ectopic expression of a soluble type II TGF-ß receptor dominant negative cDNA, induces growth arrest, but does not trigger differentiation. In contrast, a reduction in the TGF-ß concentration, to a range of 0.14–0.20 x 10-2 ng/ml (which is similar to that measured in TPA-treated cells), mimics TPA-induced differentiation. Taken together, these data demonstrate that cell growth and suppression of differentiation in rhabdomyosarcoma cells require overproduction of active TGF-ß; furthermore, they show that a ‘critical’ concentration of TGF-ß is necessary for myogenic differentiation to occur, whereas myogenesis is abolished below and above this concentration. By impairing the TGF-ß autocrine loop, TPA stabilizes the factor concentration within the range compatible for differentiation to occur. In contrast, in human primary muscle cells a much higher concentration of exogenous TGF-ß is required for the differentiation inhibitory effect and TPA inhibits differentiation in these cells probably through a TGF-ß independent mechanism. These data thus clarify the mechanism underlying the multiple roles of TGF-ß in the regulation of both the transformed and differentiated phenotype.—Bouché, M., Canipari, R., Melchionna, R., Willems, D., Senni, M. I., Molinaro, M. TGF-ß autocrine loop regulates cell growth and myogenic differentiation in human rhabdomyosarcoma cells.


Key Words: TPA • serine-protease system • muscle regulatory factors • RD cells


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
RHABDOMYOSARCOMAS, THE MOST common soft tissue sarcomas in childhood, are a class of myoblast-derived solid tumors expressing some muscle-specific markers (1) . RD, the human rhabdomyosarcoma cell line used in this study, retains the rhabdomyoblast phenotype and, like the tumor in vivo, undergoes very limited myogenic differentiation even though they express the muscle regulatory factors (MRFs) myf3 and myf4, which also retain their DNA binding activity (2 , 3) . These factors belong to the helix-loop-helix family of transcription factors and are characterized by the ability, on transfection, to convert nonmyogenic cells to the muscle phenotype (4 , 5) . Because of these features, they are considered ‘master genes’, and their expression in cells where no or very little myogenic differentiation occurs, such as rhabdomyosarcomas, appears to be paradoxical.

We have previously shown that treatment of RD cells with the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA), which usually inhibits muscle differentiation, induces growth arrest and myogenic differentiation in these cells without modifying the expression or binding activity of the MRFs (2 , 6 ; M. Bouchè, unpublished observation). Furthermore, we have demonstrated that TPA-induced growth arrest and myogenic differentiation are two independent events involving the activation/down-regulation of different protein kinase C isoforms; although no specific substrates have been identified yet, the activation of the protein kinase C{alpha} (PKC{alpha}) isoform is responsible for TPA-induced differentiation, whereas down-regulation of the ß1 and {xi} isoforms causes TPA-induced growth arrest (7) . Therefore, the activity of factors involved in MRF transcriptional activity are likely to be controlled, whether directly or indirectly, by PKC{alpha}-mediated phosphorylation events. Taken together, these data suggest that the differentiation blockade in RD cells occurs, through a PKC-dependent mechanism, downstream of the expression and the binding activity of the MRF factors. A similar situation is observed when muscle cells are treated with transforming growth factor ß (TGF-ß). In fact, TGF-ß inhibits myogenic differentiation without inhibiting the expression or the binding activity of the MRFs (8 9 10) . This is a peculiar effect of TGF-ß, since all other growth factors, such as fibroblast growth factors (FGFs), inhibit myogenic differentiation by interfering with the expression and/or binding activity of the MRFs (10 , 11 and references therein). RD cells express and secrete a high level of TGF-ß (12) , which may trigger an autocrine loop.

In mammals, TGF-ß comprises a family of at least three isoforms of dimeric peptides, produced by different genes (13) . Synthesis, secretion, and activation of all three isoforms are controlled similarly and in a very complex array. The secreted form is a so-called ‘latent’ form because it does not exert its action on cells or tissues (14) . Activation requires extracellular proteolytic digestion by serine proteases, which results in a mature active TGF-ß dimer (15) . The active TGF-ß molecule can then bind the TGF-ß receptor type II (TßRII), which, on interaction with the type l receptor (TßRI), transduces the TGF-ß-inducing events through the Smad family of proteins, which are the direct effector for the TßRI and mediator of the TGF-ß signals from the cytoplasm to the nucleus (for a review, see ref 16 and references therein).

Activation of secreted latent TGF-ß through serine proteases, such as plasmin, is a finely regulated event involving activation, localization, and balance of different components of the system and represents one of the crucial events in regulating TGF-ß activity. Plasmin is formed from a site-specific cleavage of its inactive precursor (plasminogen) by urokinase plasminogen activator (uPA), produced by the cells (17) . This activation can be controlled by specific inhibitors (plasminogen activator inhibitors PAI-1 and -2) or by the presence of the uPA cell-surface receptor (uPAR) (18 , 19) . The uPAR is a 55–70 kDa glycoprotein bound to the plasma membrane by a glycolipid anchor (20) . The specific binding of uPA to its receptor localizes the plasmin-mediated uPA proteolytic activity in the pericellular space. It is known that this localized proteolytic activity plays a crucial role on cell migration and tissue remodeling (21 , 22) . It has also been reported that preventing the binding of uPA to the surface of vascular endothelial cells results in a decrease of TGF-ß activation and in perturbation of the differentiation of cocultured smooth muscle cells (23) . Moreover, in murine muscle cell lines, aprotinin, a kunitz-type protease inhibitor, stimulates skeletal muscle differentiation probably through inhibition of the activation of TGF-ß by serine proteases, thus reducing the concentration of extracellular active TGF-ß (24) .

Autocrine loops are often involved in regulating proliferation and/or differentiation in many transformed cells. Identification of the autocrine loops that regulate these events may therefore be instrumental in setting a differentiation therapy approach. It has been reported that suramin, a drug that nonselectively interferes with growth factors binding to their receptors, and therefore presumably blocks all the autocrine loops simultaneously, induces growth arrest and muscle differentiation in rhabdomyosarcoma cells (25) . However, the selective inhibition of certain single autocrine loops [i.e., epidermal growth factor (EGF), insulin-like growth factor (IGF), basic FGF (bFGF)] induces growth arrest, but does not lead to muscle differentiation (25 26 27) . These data suggest either that the simultaneous inhibition of more than a single autocrine loop is necessary for myogenesis to occur or that regulation of differentiation is controlled by a different autocrine loop, which has not yet been investigated.

We therefore investigated whether the autocrine TGF-ß loop is responsible for cell growth and suppression of differentiation in RD cells, and whether TPA-induced differentiation is dependent on interference with this autocrine loop.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell cultures
RD cells were obtained from the ATCC (Rockville, Md.). The cells were grown in DMEM containing 10% fetal calf serum (FCS); to induce differentiation, TPA (0.1 µM) was added, as described (6) . C2C12 cells were grown in DMEM containing 10% FCS; to induce differentiation, the medium was replaced with DMEM containing 2% HS. Human primary skeletal muscle cells (hSkMC) were obtained from Promocell (Heidelberg, Germany); the cells were grown in hSkMC growth medium (modified MCDB 120 containing 5% FCS, 10 ng/ml EGF, 1 ng/ml bFGF, 0.5 mg/ml fetuine, 0.1 mg/ml insulin, 0.4 µg/ml dexamethasone) in order to induce differentiation, and the medium was replaced with hSkMC differentiation medium (modified MCDB 120 containing 10 µg/ml insulin).

Mink lung epithelial cells (MLEC) were kindly donated by Dr. D. B. Rifkin, from the New York University Medical Center. The cells were stably transfected with the truncated plasminogen activator inhibitor-1 (PAI-1) promoter driving expression of the luciferase reporter gene in a TGF-ß-dependent manner (28) . The cells were grown in DMEM supplemented with 10% FCS. At confluence, cells were released by trypsin and plated in 96-well dishes for the TGF-ß assay.

Determination of cell growth
Determination of cell growth was performed as described previously (6) . Briefly, triplicate 35 mm dishes were seeded with 5 x 104 cells in 1.5 ml DMEM containing 10% FCS. After 24 h, TGF-ß was added to the medium at the concentrations indicated both in the absence and presence of 0.1 µM TPA. Sister cells were incubated with TPA alone, as control. After 6 days in culture the cells were incubated with 6.25 (Ci/ml 3HThd (Amersham, Little Chalfont, U.K.) for 16 h and the radioactivity incorporated in the TCA-precipitable material was measured by scintillation counting.

Assay for TGF-ß
Conditioned media were prepared from RD cells or from human primary skeletal muscle cells, cultured for different periods of time, as indicated.

Subconfluent MLECs were incubated with the conditioned medium (100 µl) for 16 h. The cells were then washed twice with phosphate-buffered saline (PBS) and lysed in 60 µl of lysis buffer (Promega, Madison, Wis.). Cell extracts were assayed for luciferase activity (Promega), according to the manufacturer’s instructions, using a Berthold luminometer. Parallel MLEC were incubated with known increasing concentrations of TGF-ß to obtain the TGF-ß standard curve.

Western blot and immunocytochemistry
For Western blot analysis, RD cells were lysed with sodium dodecyl sulfate (SDS) Laemli buffer (29) , loaded on 10% SDS-polyacrylamide gel electrophoresis (PAGE), and transferred to nitrocellulose membrane (Hybond C, Amersham). The membrane was then probed with the appropriate specific antibodies as described elsewhere (7) ; detection was performed by the ECL method (Amersham), according to the manufacturer’s instructions. Scanning densitometry was performed on fluorograms of the Western blot with a laser densitometer (Ultroscan XL; Pharmacia LKB, Uppsala, Sweden). Data were analyzed using the GSXL program (Pharmacia LKB).

The anti-sarcomeric myosin monoclonal antibody MF20 was kindly donated by D. A. Fischman (Cornell University Medical College, New York); it was used to determine the differentiation status of the cells (30) . Immunoperoxidase staining was performed on cultured cells as described elsewhere (7) . In summary, the cells were fixed and permeabilized in ethanol:acetone (1:1), incubated for 30 min in PBS containing 5% non-fat milk (Carnation); the cells were then incubated for 1 h with the MF20 mcAb. A biotin-conjugated goat anti-mouse immunoglobulin G (IgG) antiserum (Zymed, San Francisco, Calif.) was used as secondary antibody. After washing, the cells were incubated with horseradish peroxidase-conjugated streptavidin (Zymed). Diaminobenzidine (0.4 mg/ml; Sigma Chemical Co., St. Louis, Mo.) was used as the substrate for peroxidase to visualize the immunostained cells.

Northern blot
Total RNA was isolated by the acid-guanidinium isothyocianate-phenol-chloroform method (31) . Twenty micrograms of total RNA were loaded into a 1.2% agarose-formaldehyde gel and transferred to a nylon membrane (Hybond N, Amersham). The hybridization was performed in 50% formamide, 10% dextran sulfate, 11.6 mg/ml NaCl, 0.1 mg/ml denatured salmon sperm DNA, and 1–3 x 106 cpm/ml of denatured random-primed 32P-labeled cDNA probe. The last washing was performed in 0.5% SSC, 0.1% SDS at 65°C and the blots were exposed to autoradiographic film (Reflection, Dupont, Wilmington, Del.).

The pHUK-1 plasmid containing the 1.5 kb uPA (plasminogen activator, urokinase) cDNA probe, cloned in PstI sites was obtained from ATCC (32) . The pB33 plasmid, containing the full-length porcine cDNA for TGF-ß-1 was kindly donated by P. Rossi and A. B. Roberts (33) . The 1.7 kb cDNA probe was prepared by BamHI digestion; at the medium stringency conditions used, it recognizes all three forms of mammalian TGF-ßs. The cDNA inserts were purified by means of the Geneclean IIl kit (Bio 101, Inc., Vista, Calif.), and 32P-labeled by the Ready-to-go random primed labeling kit (Pharmacia), according to the manufacturer’s instructions.

Zymography
For zymography of PA, culture medium or cell lysates (prepared in 0.1 M Tris-HCl pH 8.1 containing 0.4% Triton X-100) were separated in 10% SDS-PAGE under nonreducing conditions (29) . PA was then visualized by placing the Triton X-100 washed gel on a casein-agar-plasminogen underlay as described previously (34) . Molecular weights were calculated from the position of prestained markers that were subjected to electrophoresis in parallel lanes. The lytic zones were plasminogen dependent.

Analysis of enzyme-inhibitor complexes
Low molecular mass urokinase (33 kDa, Serono) was labeled with Iodogen (35) at the specific activity of 2 x 107 cpm/µg of protein. Five microliters of [125I]uPA (1–5 ng) were incubated for 1 h at 4°C with 20 µl of the conditioned medium. The samples were then subjected to SDS-PAGE and autoradiography, as described above.

DNA transfection
RD cells were transfected by electroporation using the Bio-Rad Gene Pulser apparatus. In summary, 2.5 x 106 cells/50 µl DMEM serum-containing medium were electroporated at 80 mV with a total of 12 µg of DNA (6 µg of plasmid + 6 µg salmon sperm DNA, as carrier).

The ‘soluble’ TßRII cDNA was cloned as follows. The cDNA fragment, lacking the cytoplasmic and the transmembrane domains, was obtained by polymerase chain reaction (PCR amplification, using as template the TßRII truncated-mutant-form cDNA (kindly donated by Dr. Derynck, University of California at San Francisco) (36) : oligo forward: 5' GGGGAATTCGTCTGCCATGGGTCG 3'; reverse: 5' GGGTCTAGACTAGTCAGGATTGCTGGTGTT 3'. PCR reactions were performed in 100 µl (1x PCR buffer, 0.25 mM dNTPs mix, 1.5 mM MgCl2, 5 U Taq polymerase (Promega), and 50 pmol primers) for 30 amplification cycles (1 min at 94°C, 1 min at 60°C, 1 min at 72°C). The resulting fragment was then cloned in the XbaI/EcoRI sites of the pcDNA3 (InVitrogen, San Diego, Calif.) expression plasmid. The cloned cDNA was completely sequenced with Sequenase version 2.0 Kit (USB); sequence analysis was done using the PCgene program.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
TGF-ß inhibits growth and differentiation in RD cells
To investigate the possible role of the TGF-ß autocrine loop in regulating proliferation and differentiation of RD cells, as a preliminary experiment we examined the expression of the type II TGF-ß receptor by Western blot analysis. As shown in Fig. 1 , RD cells express high levels of the receptor, and TPA does not modify its expression. Therefore, TGF-ß should be able to bind to the cell in order to exert its effects. We investigated the effect of exogeneously added TGF-ß on RD cell proliferation and differentiation. RD cells were cultured both in the absence and presence of TPA with different concentrations of TGF-ß (Fig. 2A ). After 5 days in culture, the cells were incubated with 3H Thd and the radioactivity in the TCA-precipitable material was measured. As shown in Fig. 2A , treatment with TGF-ß induces growth arrest in a concentration-dependent manner; in particular, TGF-ß concentrations ranging from 0.05 to 0.1 ng/ml exert a very low level of inhibition, whereas a higher concentration of TGF-ß (0.5 ng/ml) is necessary to reach a growth inhibition effect similar to that observed after treatment with TPA. In a parallel experiment, protein extracts of RD cells cultured as described above were analyzed by Western blot for myosin expression (used as a differentiation parameter) using the anti-myosin mcAb MF20. Figure 2B shows that myosin expression is abolished by TGF-ß administration at concentrations as low as 0.05 ng/ml; moreover, TGF-ß prevents TPA-induced differentiation (Fig. 2B ).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Expression of the type II TGF-ß receptor in RD cells. Western blot analysis of total protein lysates from RD cells cultured for different periods of time (as indicated) both in the absence and presence of 0.1 µM TPA. Total lysate from C2C12 cells was used as control. Fifty micrograms of proteins were loaded in each lane. The membrane was incubated with the anti-TßRII pcAb.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Effect of TGF-ß on RD cell proliferation and differentiation. A) Dose-dependent effect of TGF-ß on RD cell proliferation. RD cells were cultured with increasing concentrations of TGF-ß both in the absence and presence of 0.1 µM TPA. Data represent the rate of 3HThd incorporation of triplicate samples expressed as a percentage of the untreated cells. B) Dose-dependent effect of TGF-ß on RD cell differentiation. Western blot analysis of total protein lysates from RD cells cultured with increasing concentrations of TGF-ß both in the absence and presence of 0.1 µM TPA (as indicated). Lysates from untreated or TPA-treated cells were loaded as controls. Twenty micrograms of proteins were loaded in each lane. The membrane was incubated with the anti-sarcomeric myosin mcAb MF20.

TPA treatment reduces active extracellular TGF-ß in RD cells
Since like most tumor cells, RD cells produce TGF-ß (12) , express the receptor, and respond to TGF-ß action, a TGF-ß autocrine loop is likely operating in these cells. We therefore investigated whether the activity of this loop is impaired by TPA to induce differentiation. Northern blot analysis revealed that TPA enhances the expression of all three forms of TGF-ß even after only 1 day of treatment; this expression, however, decreases with the time spent in culture, which means that there is only slight TPA induction by the sixth day in culture when compared with the control cultures (Fig. 3A ). As mentioned earlier, TGF-ßs are produced as latent precursors, which need proteolytic digestion and dimerization to exert their biological function. We therefore investigated whether TPA treatment modifies the concentration of active TGF-ß to which RD cells are exposed. To evaluate the amount of TGF-ß present in the conditioned medium, MLEC stably transfected with a plasmid containing the TGF-ß-inducible fragment of the PAI-1 promoter driving the luciferase gene (28) were incubated for 16 h with the conditioned medium collected from RD cells cultured for 6 days both in the absence or presence of TPA. The conditioned medium was used to measure the active TGF-ß present or was prewarmed for 5 min at 85°C to activate latent TGF-ß and measure the total TGF-ß present (latent and active). The MLECs were then lysed and luciferase activity was measured. As shown in Fig. 3B , treatment with TPA slightly enhances the concentration of the total (latent and active) TGF-ß present in the medium, but reduces by 25-fold that of active TGF-ß. It is worth noting that the active TGF-ß concentration in control cells (0.04 ng/ml) is compatible with the anti-differentiative effect, but not with the growth inhibition effect (see Fig. 2A, B ). When the data are expressed as a percentage of activation of the total TGF-ß present in the medium, which also normalizes the data for the TGF-ß-producing RD cell number in each sample, 22.6% of the total TGF-ß is activated in control cells, whereas in TPA-treated cells only 0.8% is activated. Taken together, these data suggest that TPA may interfere with the anti-differentiative TGF-ß autocrine loop by inhibiting the activation of latent TGF-ß.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. Expression and activity of TGF-ß in TPA-treated RD cells. A) Northern blot analysis of TGF-ß expression. Twenty micrograms of total RNA, prepared from RD cells cultured for different periods of time, both in the absence and presence of 0.1 µM TPA were loaded in each lane. The blot was hybridized with 32P-labeled TGF-ß-1 cDNA probe. The relative positions of the TGF-ß-1, -2, -3 mRNAs, recognized by the probe, are indicated. Hybridization with the 18S ribosomal cDNA probe is shown for normalization. B) Assay for TGF-ß concentration in RD cell-conditioned medium. MLECs were incubated for 16 h with medium collected from RD cells cultured both in the absence and presence of 0.1 µM TPA for 6 days. The conditioned medium was added in plain form to measure the active TGF-ß or was prewarmed to measure the total TGF-ß present. The relative luciferase units obtained in the MLEC lysates were converted into TGF-ß concentration (ng/ml), on the basis of the TGF-ß standard curve. The relative percentage of active TGF-ß, considering the total TGF-ß measured as 100%, is also shown.

To further investigate the possible role of the TGF-ß autocrine loop in suppression of differentiation in RD cells, we treated the cells with the serine-protease inhibitor, aprotinin. As stated before, the activation of latent TGF-ß can be mediated by serine-proteases such as plasmin (15) . RD cells were therefore cultured for 6 days in the presence of aprotinin (2TIU/ml), a kunitz-type inhibitor of serine proteases, or pepstatin (20 µM), a nonspecific protease inhibitor; parallel cells were cultured both in the absence and presence of TPA. Myogenic differentiation was then analyzed as the expression of skeletal myosin by immunocytochemistry. As shown in Fig. 4 , very few myosin positive cells are evident in control and in pepstatin-treated cultures (Fig. 4a, c ); as previously shown, TPA treatment induces the expression of myosin in a large percentage of RD cells, together with a decrease in the cell number due to growth inhibition (2 , 6 , 7) (Fig: 4b); treatment with aprotinin significantly enhances the number of myosin-expressing cells when compared with the control and pepstatin-treated cells (Fig. 4d ), but reduces only slightly the total cell number. Therefore, the inhibition of serine-proteases, which might account for the reduction in active TGF-ß, may mimic the TPA-induced differentiation in RD cells.



View larger version (139K):
[in this window]
[in a new window]
 
Figure 4. Effect of the serine-proteases inhibitor aprotinin on myosin expression. Immunoperoxidase staining of myosin heavy chain with the MF20 mcAb in RD cells cultured for 6 days in different culture conditions: a) control cells; b) cells treated with 0.1 µM TPA; c) cells treated with 20 µM pepstatine; d) cells treated with 2TIU/ml aprotinin.

To further investigate the mechanism by which TPA may inhibit the activation of TGF-ß, we analyzed the expression of some of the components of the PA/plasminogen system. In agreement with previous reports (37) , Northern blot analysis revealed that uPA expression is induced after TPA treatment in RD cells, and is maintained until the sixth day in culture; in control cells its expression instead declines by that time (Fig. 5A ). To analyze the functional role of uPA accumulation in control and TPA-treated RD cells, we performed zymographic analysis of the activity localized in both medium and cell lysates at different days of culture. The zymographs showed an increased secretion of uPA in the conditioned medium after TPA treatment. The same treatment caused a transient increase in cell bound uPA during the first 3 days in culture, followed by a decrease on the sixth day, when TPA-treated RD cells underwent differentiation (Fig. 5B ). Moreover, in the extracellular compartment, a band of higher molecular weight appeared in the samples of TPA-treated cells, suggesting the presence of a complex containing uPA bound to its inhibitor, PAI. To study the presence of free PAI in the conditioned medium of RD cells, aliquots of medium were incubated in the presence of labeled uPA, as described in Material and Methods. In the presence of unbound PAI, covalent complexes between PA and its inhibitors were formed and revealed by their lower mobility in an acrylamide gel. As shown in Fig. 5C , only the medium obtained from TPA-treated cells presented a higher molecular weight band, which indicates the TPA-induced expression of PAI. Taken together, these data indicate that TPA alters the balance of the uPA/PAI system and its activity; these alterations may likely cause the reduction of TGF-ß activation observed.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Effect of TPA on the PA/plasminogen system. A) Northern blot analysis of RD cells cultured for different periods of time (as indicated) both in the absence and presence of 0.1 µM TPA. Twenty micrograms of total RNA were loaded in each lane. The membrane was hybridized with 32P-labeled uPA cDNA. The 32P-labeled 18S ribosomal RNA. cDNA was used for normalization. B) Zymography of PA on culture medium (upper panel) or cell lysates (lower panel) obtained from RD cells cultured for different periods of time both in the absence and presence of 0.1 µM TPA. C) Autoradiography of the enzyme-inhibitor complexes obtained from culture medium collected from RD cells cultured for 6 days both in the absence and presence of 0.1 µM TPA. Only in the medium collected from TPA-treated cells is a 125IuPA-PAI complex evident.

Reduction of TGF-ß concentration mimics TPA-induced differentiation in RD cells
To formally demonstrate that the TPA-induced reduction in active TGF-ß mediates the induction of differentiation, we transfected RD cells with an expression plasmid containing a cDNA encoding for the extracellular portion of TßRII, the so-called ‘soluble TßRII receptor’. The resulting expressed protein works as a ‘dominant negative’ for TGF-ß, because it competes for TGF-ß binding to the cell membrane. After transfection, RD cells were cultured for 6 days and myosin expression was analyzed by Western blot; to ensure that the transfection itself did not modify the RD cell phenotype, parallel cultures were cultured with the medium, which was changed every day for 6 days, conditioned from the soluble TßRII-transfected cells as well as from ‘mock’ transfected cells; the cell lysates were analyzed for myosin expression. In agreement with a previous observation on nontransformed muscle cells (38) , proliferation (as revealed by BudR staining, not shown) and differentiation (as revealed by myosin expression, Fig. 6 ) are inhibited when extracellular TGF-ß is completely removed from RD cell medium either by transfection of the soluble TßRII mutant form (not shown) or by culturing them in conditioned medium collected from soluble TßRII-transfected cells (Fig. 6A , lane 10). To verify whether an ‘optimal’ concentration of TGF-ß at which differentiation occurs can be determined, we cultured RD cells in medium conditioned from soluble TßRII-transfected cells titrated, from 0 to 10 parts, with medium conditioned from the mock cells; the cells were lysed after 6 days in culture. Media were assayed for the presence of active TGF-ß, whereas cell lysates were analyzed for myosin expression. With the serial dilution of the soluble TßRII conditioned medium, increasing concentrations of active TGF-ß were found by means of the MLEC standard assay. Western blot analysis of cell lysates showed that myosin expression was comparable to TPA-treated cells when RD cells were cultured with the conditioned medium collected from the soluble TßRII-transfected cells, diluted with conditioned medium collected from the mock cells in the 3:7–1:9 ratio range (Fig. 6A ); this range corresponds, as measured by the MLEC standard assay, to a concentration of active TGF-ß ranging between 0.14 and 0.20 x 10-2 ng/ml (Fig. 6C ). The relative quantification of myosin expression, by the densitometric analysis of the Western blot is also shown (Fig. 6B ).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 6. Effect of decreasing concentration of dominant negative mutant form of TßRII on RD cell differentiation. A) Representative Western blot analysis of total protein lysates from RD cells cultured with conditioned medium collected from soluble TßRII-transfected cells, titrated with increasing dilutions (from lane 9 to lane 1) of conditioned medium collected from mock transfected cells. Lane 10: protein lysate from cells cultured with 10 parts of conditioned medium from soluble TßRII-transfected cells; lane 0: protein lysate from cells cultured with conditioned medium from mock transfected cells (zero parts of soluble TßRII conditional medium). Total protein lysates from RD cells cultured for 6 days in the absence (C) or presence (TPA) of 0.1 µM TPA, are shown as control. B) Densitometric analysis of the Western blot as in panel A. Each value represents the mean (± se) of three independent experiments. Myosin values are shown as fold induction with respect to control (untreated cells, C) set equal to 1. C) Determination of active TGF-ß concentration present in the medium used for the ‘dominant negative’ TßRII titration as in panel A. MLECs were incubated for 16 h with medium collected from RD cells cultured as in panel A. The conditioned medium was added in plain form, to measure the active TGF-ß. The relative luciferase units obtained in the MLEC lysates were converted into TGF-ß concentration (ng/ml), on the basis of the TGF-ß standard curve.

Effect of TGF-ß and TPA on differentiation of human primary muscle cells
To investigate whether the proposed TGF-ß autocrine loop regulating terminal myogenesis in RD cells can account for regulation of differentiation in nontransformed cells as well, we used as a normal counterpart primary human muscle cells, hSkMC (no human muscle cell lines are yet available).

We first investigated the effect of TGF-ß or TPA on differentiation of these cells. Growing hSkMC were cultured in hSkMC differentiation medium (a synthetic medium containing insulin; see Material and Methods) containing increasing concentrations of TGF-ß (0.05–5 ng/ml) or 0.1 µM TPA. After 3 days the cells were fixed and analyzed for myotube formation and myosin expression by immunocytochemistry. As shown in Fig. 7 TGF-ß inhibits differentiation of hSkMC in a concentration-dependent manner; concentrations ranging from 0.05 to 0.5 ng/ml exert little or no inhibition, whereas a higher concentration (1 ng/ml) is necessary to reach a differentiation inhibitory effect (Fig. 7) . This concentration is almost two orders of magnitude higher than the concentration required to reach the TGF-ß differentiation inhibitory effect in RD cells. As shown in Fig. 7 , also TPA inhibits differentiation in hSkMC, as it is usually considered an inhibitor of muscle cell differentiation. To verify whether the mechanisms regulating differentiation in RD cells can be compared to the ones responsible of differentiation of primary cells, subconfluent hSkMC were cultured for 3 days with conditioned medium collected from RD cells cultured for 5 days in the absence or presence of TPA. As shown in Fig. 7A, B , differentiation of hSkMC is not affected when the cells are cultured with RD cell-conditioned medium (where the concentration of active TGF-ß is 0.04 ng/ml, Fig. 3B ), whereas it is inhibited when the cells are cultured with TPA-treated, RD cell-conditioned medium; this inhibition is comparable to the one obtained when hSkMC are cultured in the presence of TPA. Moreover, to verify the effect of removal of TGF-ß on hSkMC differentiation, subconfluent cells were cultured for 3 days in hSkMC differentiation medium containing 30 µg/ml of anti-TGF-ß antibody (Genzyme, Boston, Mass.). At this antibody concentration, active TGF-ß is not detectable in the medium by the standard MLEC assay (not shown). As shown in Fig. 7A, B , removal of TGF-ß is not sufficient to prevent primary human muscle cells differentiation, in contrast to what is observed in RD cells.



View larger version (82K):
[in this window]
[in a new window]
 
Figure 7. Effect of TGF-ß and TPA on differentiation of human primary muscle cells. A) Differentiation of hSkMC, cultured for 3 days in the indicated conditions, measured as percentage of fusion. Nuclei present in myotubes, containing at least three nuclei, have been counted and expressed as percentage of the total nuclei present in the same field. Ten microscopic fields were analyzed randomly for each condition. B) Percentage of myosin positive hSkMC cultured for 3 days in the indicated conditions, measured by immunoperoxidase staining with the MF20 mcAb. Ten microscope fields have been analyzed randomly for each condition. C) Representative immunoperoxidase staining of myosin heavy chain with the MF20 mcAb in hSkMC cultured for 3 days in different culture conditions: a, b) control cells; c, d) cells treated with 1 ng/ml TGF-ß; e–f) cells treated with 0.1 µM TPA. Phase-contrast micrographs are shown in b, d, and f.

Given the opposite effect exerted by TPA in hSkMC and RD cells, we then investigated the role of TPA in controlling TGF-ß activity in hSkMC. We first measured the concentration of active TGF-ß in hSkMC cultured for 3 days in the presence or in the absence of TPA by the standard MLEC assay. As shown in Fig. 8A , TPA reduces the concentration of total TGF-ß and inhibits almost completely its activation, indicating that the effect of TPA on TGF-ß accumulation and activation in primary cells is slightly different than in RD cells. To analyze the effect of TPA on uPA activity, we performed zymographic analysis of the uPA activity localized in both medium and cell lysate on the third day of culture. As shown in Fig. 8B , TPA treatment causes a significant decrease in uPA activity in the extracellular compartment and only a slight decrease in the cell-associated enzyme, which is compatible to its anti-differentiative effect (39 , 40) .



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Effect of TPA on TGF-ß activation and the PA/plasminogen system in hSkMC. A) Assay for TGF-ß concentration in hSkMC conditioned medium. MLECs were incubated for 16 h with medium collected from hSkMC cultured both in the absence and presence of 0.1 µM TPA for 3 days. The conditioned medium was added in plain form, to measure the active TGF-ß or was prewarmed to measure the total TGF-ß present. The relative luciferase units obtained in the MLEC lysates were converted into TGF-ß concentration (ng/ml) on the basis of the TGF-ß standard curve. The relative percentage of active TGF-ß, considering the total TGF-ß measured as 100%, is also shown. B) Zymography of PA on culture medium (a) or cell lysates (b) obtained from hSkMC cultured for 3 days both in the absence and presence of 0.1 µM TPA.

Taken together, these data indicate that primary human muscle cells are sensitive to the differentiation inhibitory effect of TGF-ß, although a much higher concentration is needed to exert its effect than in transformed muscle cells, and TPA inhibits differentiation in this cell system probably through a TGF-ß-independent mechanism.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The data reported in this paper demonstrate that proliferation and suppression of differentiation in the human rhabdomyosarcoma cell line RD are dependent on overproduction of extracellular active TGF-ß; moreover, they demonstrate that a low but critical concentration of TGF-ß is necessary for myogenesis to occur, which is abolished below and above this concentration. The conclusion can be drawn that TPA induces differentiation in these cells by altering activity of the uPA/PAI system; this alteration results in a decrease of the active extracellular TGF-ß to a concentration compatible for the onset of differentiation.

These data represent the first demonstration that a single autocrine loop, the TGF-ß loop, is responsible for proliferation and suppression of differentiation in rhabdomyosarcoma cells. In fact, it has already been shown that the simultaneous blockade of all the autocrine loops by suramin in these cells results in growth arrest and muscle differentiation (25) ; the specific inhibition of certain single autocrine loops, such as EGF, IGF, bFGF impairs cell proliferation, but does not lead to muscle differentiation (26 , 27) .

We show here that RD cells produce TGF-ßs, express the TßRII, and are sensitive to the anti-differentiative effect of exogenously added TGF-ß, thus demonstrating the existence of a TGF-ß autocrine loop. The fact that the transformed phenotype and the suppression of differentiation in these cells coexist with the expression and DNA binding activity of the MRFs, as occurs in differentiation inhibited TGF-ß-treated muscle cells (8) , makes this autocrine loop a good candidate for suppressing differentiation in RD cells. Moreover, growth arrest and myogenic differentiation can be induced in RD cells by treatment with the phorbol ester TPA (6) without interfering with the expression or binding activity of the MRFs (2 ; M. Bouchè, unpublished observation). As TPA is usually considered an inhibitor of muscle cell differentiation, its highly specific action in RD cells must be due to its impairment of particular anti-differentiative pathways in these cells. We demonstrate that TPA decreases significantly (but does not abolish) the concentration of active TGF-ß in the RD-conditioned medium, which suggests that this may represent one of the crucial effects exerted by TPA. Moreover, treatment of RD cells with the serine protease inhibitor aprotinin results in a significant increase of myosin positive cells, suggesting that the activity of these enzymes is closely involved in the suppression of differentiation in these cells. This result is consistent with a previous observation that the treatment of nontransformed muscle cells with aprotinin enhances myogenic differentiation (24) . TPA is known to induce the expression of both uPA and PAI-1 in RD cells (37) as well as in other cell systems, as we also show here, hence altering the serine protease system activity and balance. Furthermore, although a significant proportion of uPA is initially found to be associated with the cell membranes in TPA-treated cells, at the onset of differentiation, cell-associated uPA drops and becomes redistributed in the extracellular compartment. The same kinetics of uPA-regulated localization has been described in differentiating muscle cells; it has been suggested that uPA might play a dual role: as a cell-associated protease provides the machinery that allows myoblasts to migrate, then as a soluble enzyme it regulates signals controlling differentiation (41) . In line with this hypothesis, the decrease observed of cell-associated uPA in TPA-treated RD cells, together with the increase of PAI, may stimulate myogenic differentiation by inhibiting the formation of the uPA-mediated plasmin activity and, consequently, the activation of latent TGF-ß.

Taken together, these data strongly suggest that TPA induces myogenic differentiation in RD cells by lowering the concentration of active TGF-ß, through a uPA/PAI-dependent mechanism. Proof that TGF-ß plays a central role in controlling myogenic differentiation in these cells is provided by the expression of the dominant negative mutant form of TßRII. In fact, when TGF-ß is completely removed from the medium by the expression of the soluble TßRII mutant form, proliferation and differentiation are completely abolished, which is consistent with a previous report in nontransformed muscle cell lines (38) . However, when the concentration of active TGF-ß is titrated by serial dilution of the dominant negative mutant, an optimal TGF-ß concentration that induces RD cell differentiation mimicking the effect of TPA is determined; this concentration is comparable to the one measured in conditioned medium from TPA-treated cells.

The situation appears to be more complicated when we compare the proposed mechanisms with the regulation of differentiation in human primary muscle cells. In fact, although differentiation of primary human cells is inhibited by TGF-ß, a much higher concentration of the factor (1 ng/ml) is needed to exert its effect in primary than in RD cells; this suggests that primary cells are less sensitive to the TGF-ß action. In line with this observation, RD cell-conditioned medium, where the concentration of active TGF-ß is 0.04 ng/ml, is not sufficient to inhibit differentiation in primary cells. Moreover, in contrast to what is observed in RD cells, in primary cells complete removal of TGF-ß, mediated by the anti-TGF-ß antibody, does not inhibit differentiation, suggesting that other mechanisms may compensate for its absence. Moreover, this result suggests that the concept of a TGF-ß critical concentration may not be as relevant to primary as to sarcoma cells; this is not surprising, however, since unlike RD cells, primary muscle cells undergo spontaneous differentiation. It is noteworthy that, although to get an optimal myogenic differentiation, primary cells are cultured in a synthetic medium containing insulin, they can differentiate even in high serum-containing medium (not shown); this suggests that their ability to differentiate can overcome growth factor-inhibiting action. Another apparent contradiction arises from the comparison of the TPA-induced effect on the differentiation of primary and RD cells. In fact, though TPA induces RD cell differentiation, it inhibits this process in human primary muscle cell, as it usually does in nontransformed cells. Moreover, in primary cells, TPA decreases the concentration of the total TGF-ß produced and inhibits its activation almost completely. Whether the absence of active TGF-ß can account for the TPA anti-differentiative effect is so far a matter of speculation. On the other hand, the concentration of active TGF-ß in untreated cells is not sufficient to inhibit differentiation; as discussed before, antibody-mediated complete removal of TGF-ß in primary cells does not inhibit muscle differentiation; nevertheless, the possibility that this condition may cooperate with other TPA-induced mechanisms to exert the anti-differentiative effect cannot be ruled out. As for RD cells, in human cells the decreased activation of TGF-ß can be ascribed to a decrease of uPA activity. In primary cells, though, TPA reduces uPA activity in the extracellular compartment and only slightly in the cell-associated fraction. Besides activation of TGF-ß, uPA has been suggested to be involved in regulation of both migration and fusion of myoblasts; therefore, this decrease in uPA activity is compatible with the inhibition of differentiation due to a lack of migration and fusion, as already hypothesized (39 , 40) .

In conclusion, this paper demonstrate that RD cells, at variance with the nontransformed muscle cells, elicit a strict dependence on TGF-ß action and need an optimal concentration of active TGF-ß to differentiate, probably in synergy with other factors. Suppression of differentiation is due at least in part to overproduction of active TGF-ß and the establishment of an autocrine loop. The reduction of TGF-ß concentration by agents such as TPA or specific inhibitors such as aprotinin or the TßRII mutant form is sufficient to drive myogenic differentiation. Nevertheless, the possibility that TPA may impair the TGF-ß autocrine loop in ways other than through the serine protease system, such as the expression and/or the activity of the Smad proteins cannot be ruled out and currently is under investigation.

These data shed light on possible mechanisms instrumental in working out a differentiation therapy approach to this type of sarcoma.


   ACKNOWLEDGMENTS
 
We thank Drs. A. B. Alberts, R. Derynck, D. A. Fischman, D. B. Rifkin, and P. Rossi for providing reagents and probes, and Drs. Giulio Cossu and Sergio Adamo, from the University of Rome, for continuous discussion and critical reading of the manuscript. We also thank Mr. Lewis Baker for reviewing our English usage in the manuscript. This work was funded by grants from Telethon (to M.B.), MURST (to M.M. and R.C.), ACRO-CNR, and AIRC (to M.M).


   FOOTNOTES
 
Received for publication April 23, 1999. Revised for publication January 5, 2000.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Malone, M. (1993) Soft tissue tumours in childhood [published erratum appears in Histopathology (1994) Vol. 24, p. 197]. Histopathology 23,203-216[Medline]
  2. Bouche, M., Senni, M. I., Grossi, A. M., Zappelli, F., Polimeni, M., Arnold, H. H., Cossu, G., Molinaro, M. (1993) TPA-induced differentiation of human rhabdomyosarcoma cells: expression of the myogenic regulatory factors. Exp. Cell Res. 208,209-217[Medline]
  3. Tapscott, S. J., Thayer, M. J., Weintraub, H. (1993) Deficiency in rhabdomyosarcomas of a factor required for MyoD activity and myogenesis. Science 259,1450-1453[Abstract/Free Full Text]
  4. Davis, R. L., Weintraub, H., Lassar, A. B. (1987) Expression of a single transfected cDNA converts fibroblast to myoblast. Cell 51,987-1000[Medline]
  5. Wright, W. E., Sassoon, D. A., Lin, V. K. (1989) Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56,607-617[Medline]
  6. Aguanno, S., Bouche, M., Adamo, S., Molinaro, M. (1990) 12-O-tetradecanoylphorbol-13-acetate-induced differentiation of a human rhabdomyosarcoma cell line. Cancer Res 50,3377-3382[Abstract/Free Full Text]
  7. Bouche, M., Zappelli, F., Polimeni, M., Adamo, S., Wetsel, W. C., Senni, M. I., Molinaro, M. (1995) Rapid activation and down-regulation of protein kinase C {alpha} in 12-O-tetradecanoylphorbol-13-acetate-induced differentiation of human rhabdomyosarcoma cells. Cell Growth & Differ 6,845-852[Abstract]
  8. Brennan, T. J., Edmondson, D. G., Li, L., Olson, E. N. (1991) Transforming growth factor beta represses the actions of myogenin through a mechanism independent of DNA binding. Proc. Natl. Acad. Sci. USA 88,3822-3826[Abstract/Free Full Text]
  9. Martin, J. F., Li, L., Olson, E. N. (1992) Repression of myogenin function by TGF-beta 1 is targeted at the basic helix-loop-helix motif and is independent of E2A products. J. Biol. Chem. 267,10956-10960[Abstract/Free Full Text]
  10. Olson, E. N. (1992) Interplay between proliferation and differentiation within the myogenic lineage. Dev. Biol. 154,261-272[Medline]
  11. Li, L., Zhou, J., James, G., Heller-Harrison, R., Czech, M. P., Olson, E. N. (1992) FGF inactivates myogenic helix-loop-helix proteins through phosphorylation of a conserved protein kinase C site in their DNA-binding domains. Cell 71,1181-1194[Medline]
  12. Derynck, R., Goeddel, D. V., Ullrich, A., Gutterman, J. U., Williams, R. D., Bringman, T. S., Berger, W. H. (1987) Synthesis of messenger RNAs for transforming growth factors alpha and beta and the epidermal growth factor receptor by human tumors. Cancer Res 47,707-712[Abstract/Free Full Text]
  13. Massagué, J. (1990) The transforming growth factor-beta family. Annu. Rev. Cell Biol. 6,597-641
  14. Taipale, J., Miyazono, K., Heldin, C. H., Keski-Oja, J. (1994) Latent transforming growth factor-ß1 associates to fibroblast extracellular matrix via latent TGF ß1 binding protein. J. Cell Biol. 124,171-181[Abstract/Free Full Text]
  15. Lyons, R. M., Gentry, L. E., Purchio, A. F., Moses, H. L. (1990) Mechanism of activation of latent recombinant transforming growth factor (1 by plasmin. J. Cell Biol. 110,1361-1367[Abstract/Free Full Text]
  16. Derynck, R., Zhang, Y., Feng, X. H. (1998) Smads: transcriptional activators of TGF-beta responses. Cell 95,737-740[Medline]
  17. Dano, K., Andreasen, P. A., Grondahl-Hansen, J., Kristensen, P., Nielsen, L. S., Skriver, L. (1985) Plasminogen activators, tissue degradation, and cancer. Adv. Cancer Res. 44,139-266[Medline]
  18. Andreasen, P. A., Georg, B., Lund, L. R., Riccio, A., Stacey, S. N. (1990) Plasminogen activator inhibitors: hormonally regulated serpins. Mol. Cell. Endocrinol. 68,1-19[Medline]
  19. Vassalli, J. D., Baccino, D., Belin, D. (1985) A cellular binding site for the Mr 55,000 form of the human plasminogen activator, urokinase. J. Cell Biol. 100,86-92[Abstract/Free Full Text]
  20. Ploug, M., Ronne, E., Behrendt, N., Jensen, A. L., Blasi, F., Dano, K. (1991) Cellular receptor for urokinase plasminogen activator. Carboxyl-terminal processing and membrane anchoring by glycosyl-phosphatidylinositol. J. Biol. Chem. 266,1926-1933[Abstract/Free Full Text]
  21. Blasi, F. (1993) Urokinase and urokinase receptor: a paracrine/autocrine system regulating cell migration and invasiveness. Bioassays 15,105-111[Medline]
  22. Sappino, A. P., Huarte, J., Belin, D., Vassalli, J. D. (1989) Plasminogen activators in tissue remodeling and invasion: mRNA localization in mouse ovaries and implanting embryos. J. Cell Biol. 109,2471-2479[Abstract/Free Full Text]
  23. Mignatti, P., Mazzieri, R., Rifkin, D. B. (1991) Expression of the urokinase receptor in vascular endothelial cells is stimulated by basic fibroblast growth factor. J. Cell Biol. 113,1193-1201[Abstract/Free Full Text]
  24. Wells, J. M., Strickland, S. (1994) Aprotinin, a Kunitz-type protease inhibitor, stimulates skeletal muscle differentiation. Development 120,3639-3647[Abstract]
  25. De Giovanni, C., Melani, C., Nanni, P., Landuzzi, L., Nicoletti, G., Frabetti, F., Griffoni, C., Colombo, M. P., Lollini, P. L. (1995) Redundancy of autocrine loops in human rhabdomyosarcoma cells: induction of differentiation by suramin. Br. J. Cancer 72,1224-1229[Medline]
  26. Shapiro, D. N., Jones, B. G., Shapiro, L. H., Dias, P., Houghton, P. J. (1994) Antisense-mediated reduction in insulin-like growth factor-I receptor expression suppresses the malignant phenotype of a human alveolar rhabdomyosarcoma. J. Clin. Invest. 94,1235-1242
  27. De Giovanni, C., Landuzzi, L., Frabetti, F., Nicoletti, G., Griffoni, C., Rossi, I., Mazzotti, M., Scotto, L., Nanni, P., Lollini, P. L. (1996) Antisense epidermal growth factor receptor transfection impairs the proliferative ability of human rhabdomyosarcoma cells. Cancer Res 56,3898-3901[Abstract/Free Full Text]
  28. Abe, M., Harpel, J. G., Metz, C. N., Nunes, I., Loskutoff, D. J., Rifkin, D. B. (1994) An assay for transforming growth factor-beta using cells transfected with a plasminogen activator inhibitor-1 promoter-luciferase construct. Anal. Biochem. 216,276-284[Medline]
  29. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227,680-685[Medline]
  30. Bader, D., Masaki, T., Fischman, D. A. (1982) Immunochemical analysis of myosin heavy chain during avian myogenesis in vivo and in vitro. J. Cell Biol. 95,763-770[Abstract/Free Full Text]
  31. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  32. Verde, P., Stoppelli, M. P., Galeffi, P., Di Nocera, P., Blasi, F. (1984) Identification and primary sequence of an unspliced human urokinase poly(A)+ RNA. Proc. Natl. Acad. Sci. USA 81,4727-4731[Abstract/Free Full Text]
  33. Roberts, A. B., Flanders, K. C., Kondaiah, P., Thompson, N. L., Van Obberghen-Schilling, E., Wakefield, L., Rossi, P., de Crombrugghe, B., Heine, U., Sporn, M. B. (1988) Transforming growth factor beta: biochemistry and roles in embryogenesis, tissue repair and remodeling, and carcinogenesis. Recent Prog. Horm. Res. 44,157-197
  34. Belin, D., Godeau, F., Vassalli, J. D. (1984) Tumor promoter PMA stimulates the synthesis and secretion of mouse pro-urokinase in MSV-transformed 3T3 cells: this is mediated by an increase in urokinase mRNA content. EMBO J 3,1901-1906[Medline]
  35. Baker, J. B., Low, D. A., Simmer, R. L., Cunningham, D. D. (1980) Protease-nexin: a cellular component that links thrombin and plasminogen activator and mediates their binding to cells. Cell 21,37-45[Medline]
  36. Chen, R. H., Derynck, R. (1994) Homomeric interactions between type II transforming growth factor-beta receptors. J. Biol. Chem. 269,22868-22874[Abstract/Free Full Text]
  37. Mayer, M., Lund, L. R., Riccio, A., Skouv, J., Nielsen, L. S., Stacey, S. N., Dano, K., Andreasen, P. A. (1988) Plasminogen activator inhibitor type-1 protein, mRNA and gene transcription are increased by phorbol esters in human rhabdomyosarcoma cells. J. Biol. Chem. 263,15688-15693[Abstract/Free Full Text]
  38. Filvaroff, E. H., Ebner, R., Derynck, R. (1994) Inhibition of myogenic differentiation in myoblasts expressing a truncated type II TGF-beta receptor. Development 120,1085-1095[Abstract]
  39. Munoz-Canoves, P., Miralles, F., Baiget, M., Felez, J. (1997) Inhibition of urokinase-type plasminogen activator (uPA) abrogates myogenesis in vitro. Thromb. Haemost. 77,526-534[Medline]
  40. Quax, P. H., Frisdal, E., Pedersen, N., Bonavaud, S., Thibert, P., Martelly, I., Verheijen, J. H., Blasi, F., Barlovatz-Meimon, G. (1992) Modulation of activities and RNA level of the components of the plasminogen activation system during fusion of human myogenic satellite cells in vitro. Dev. Biol. 151,166-175[Medline]
  41. Wells, J. M., Strickland, S. (1997) Regulated localization confers multiple functions on the protease urokinase plasminogen activator. J. Cell. Physiol. 171,217-225[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. Croci, L. Landuzzi, A. Astolfi, G. Nicoletti, A. Rosolen, F. Sartori, M. Y. Follo, N. Oliver, C. De Giovanni, P. Nanni, et al.
Inhibition of Connective Tissue Growth Factor (CTGF/CCN2) Expression Decreases the Survival and Myogenic Differentiation of Human Rhabdomyosarcoma Cells
Cancer Res., March 1, 2004; 64(5): 1730 - 1736.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Wang, S. R. Thomson, J. D. Starkey, J. L. Page, A. D. Ealy, and S. E. Johnson
Transforming Growth Factor {beta}1 Is Up-regulated by Activated Raf in Skeletal Myoblasts but Does Not Contribute to the Differentiation-defective Phenotype
J. Biol. Chem., January 23, 2004; 279(4): 2528 - 2534.
[Abstract] [Full Text] [PDF]


Home page
INT J SURG PATHOLHome page
S. V. L. Loducca, A. Mantesso, E. M. F. De Oliveira, and V. C. De Araujo
Intraosseous Rhabdomyosarcoma of the Mandible: A Case Report
International Journal of Surgical Pathology, January 1, 2003; 11(1): 57 - 60.
[Abstract] [PDF]


Home page
J. Cell Sci.Home page
A. Mauro, C. Ciccarelli, P. De Cesaris, A. Scoglio, M. Bouche, M. Molinaro, A. Aquino, and B. M. Zani
PKC{alpha}-mediated ERK, JNK and p38 activation regulates the myogenic program in human rhabdomyosarcoma cells
J. Cell Sci., September 15, 2002; 115(18): 3587 - 3599.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BOUCHÉ, M.
Right arrow Articles by MOLINARO, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BOUCHÉ, M.
Right arrow Articles by MOLINARO, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS