| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Histology and Medical Embryology, University of Rome ‘La Sapienza’, 00161, Rome, Italy
1Correspondence: Department of Histology and Medical Embryology, University of Rome ‘La Sapienza’, Via A. Scarpa 14, 00161, Rome, Italy. E-mail: bouche{at}uniroma1.it
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: TPA • serine-protease system • muscle regulatory factors • RD cells
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. RD, the human
rhabdomyosarcoma cell line used in this study, retains the
rhabdomyoblast phenotype and, like the tumor in vivo,
undergoes very limited myogenic differentiation even though they
express the muscle regulatory factors (MRFs) myf3 and myf4, which also
retain their DNA binding activity (2
, 3)
. These factors
belong to the helix-loop-helix family of transcription factors and are
characterized by the ability, on transfection, to convert nonmyogenic
cells to the muscle phenotype (4
, 5)
. Because of these
features, they are considered ‘master genes’, and their expression in
cells where no or very little myogenic differentiation occurs, such as
rhabdomyosarcomas, appears to be paradoxical.
We have previously shown that treatment of RD cells with the
phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA), which usually
inhibits muscle differentiation, induces growth arrest and myogenic
differentiation in these cells without modifying the expression or
binding activity of the MRFs (2
, 6
; M. Bouchè,
unpublished observation). Furthermore, we have demonstrated that
TPA-induced growth arrest and myogenic differentiation are two
independent events involving the activation/down-regulation of
different protein kinase C isoforms; although no specific substrates
have been identified yet, the activation of the protein kinase C
(PKC) isoform is responsible for TPA-induced differentiation,
whereas down-regulation of the ß1 and 
isoforms causes TPA-induced growth arrest (7)
. Therefore,
the activity of factors involved in MRF transcriptional activity are
likely to be controlled, whether directly or indirectly, by
PKC-mediated phosphorylation events. Taken together, these data
suggest that the differentiation blockade in RD cells occurs, through a
PKC-dependent mechanism, downstream of the expression and the binding
activity of the MRF factors. A similar situation is observed when
muscle cells are treated with transforming growth factor ß (TGF-ß).
In fact, TGF-ß inhibits myogenic differentiation without inhibiting
the expression or the binding activity of the MRFs
(8
9
10)
. This is a peculiar effect of TGF-ß, since all
other growth factors, such as fibroblast growth factors (FGFs), inhibit
myogenic differentiation by interfering with the expression and/or
binding activity of the MRFs (10
, 11
and references
therein). RD cells express and secrete a high level of TGF-ß
(12)
, which may trigger an autocrine loop.
In mammals, TGF-ß comprises a family of at least three isoforms of
dimeric peptides, produced by different genes (13)
.
Synthesis, secretion, and activation of all three isoforms are
controlled similarly and in a very complex array. The secreted form is
a so-called ‘latent’ form because it does not exert its action on
cells or tissues (14)
. Activation requires extracellular
proteolytic digestion by serine proteases, which results in a mature
active TGF-ß dimer (15)
. The active TGF-ß molecule can
then bind the TGF-ß receptor type II (TßRII), which, on interaction
with the type l receptor (TßRI), transduces the TGF-ß-inducing
events through the Smad family of proteins, which are the
direct effector for the TßRI and mediator of the TGF-ß signals from
the cytoplasm to the nucleus (for a review, see ref 16
and
references therein).
Activation of secreted latent TGF-ß through serine proteases, such as
plasmin, is a finely regulated event involving activation,
localization, and balance of different components of the system and
represents one of the crucial events in regulating TGF-ß activity.
Plasmin is formed from a site-specific cleavage of its inactive
precursor (plasminogen) by urokinase plasminogen activator (uPA),
produced by the cells (17)
. This activation can be
controlled by specific inhibitors (plasminogen activator inhibitors
PAI-1 and -2) or by the presence of the uPA cell-surface receptor
(uPAR) (18
, 19)
. The uPAR is a 55–70 kDa glycoprotein
bound to the plasma membrane by a glycolipid anchor (20)
.
The specific binding of uPA to its receptor localizes the
plasmin-mediated uPA proteolytic activity in the pericellular space. It
is known that this localized proteolytic activity plays a crucial role
on cell migration and tissue remodeling (21
, 22)
. It has
also been reported that preventing the binding of uPA to the surface of
vascular endothelial cells results in a decrease of TGF-ß activation
and in perturbation of the differentiation of cocultured smooth muscle
cells (23)
. Moreover, in murine muscle cell lines,
aprotinin, a kunitz-type protease inhibitor, stimulates skeletal muscle
differentiation probably through inhibition of the activation of
TGF-ß by serine proteases, thus reducing the concentration of
extracellular active TGF-ß (24)
.
Autocrine loops are often involved in regulating proliferation and/or
differentiation in many transformed cells. Identification of the
autocrine loops that regulate these events may therefore be
instrumental in setting a differentiation therapy approach. It has been
reported that suramin, a drug that nonselectively interferes with
growth factors binding to their receptors, and therefore presumably
blocks all the autocrine loops simultaneously, induces growth arrest
and muscle differentiation in rhabdomyosarcoma cells (25)
.
However, the selective inhibition of certain single autocrine loops
[i.e., epidermal growth factor (EGF), insulin-like growth factor
(IGF), basic FGF (bFGF)] induces growth arrest, but does not lead to
muscle differentiation (25
26
27)
. These data suggest either
that the simultaneous inhibition of more than a single autocrine loop
is necessary for myogenesis to occur or that regulation of
differentiation is controlled by a different autocrine loop, which has
not yet been investigated.
We therefore investigated whether the autocrine TGF-ß loop is responsible for cell growth and suppression of differentiation in RD cells, and whether TPA-induced differentiation is dependent on interference with this autocrine loop.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. C2C12 cells were grown in DMEM containing 10% FCS;
to induce differentiation, the medium was replaced with DMEM containing
2% HS. Human primary skeletal muscle cells (hSkMC) were obtained from
Promocell (Heidelberg, Germany); the cells were grown in hSkMC growth
medium (modified MCDB 120 containing 5% FCS, 10 ng/ml EGF, 1 ng/ml
bFGF, 0.5 mg/ml fetuine, 0.1 mg/ml insulin, 0.4 µg/ml dexamethasone)
in order to induce differentiation, and the medium was replaced with
hSkMC differentiation medium (modified MCDB 120 containing 10 µg/ml
insulin).
Mink lung epithelial cells (MLEC) were kindly donated by Dr. D. B.
Rifkin, from the New York University Medical Center. The cells were
stably transfected with the truncated plasminogen activator inhibitor-1
(PAI-1) promoter driving expression of the luciferase reporter gene in
a TGF-ß-dependent manner (28)
. The cells were grown in
DMEM supplemented with 10% FCS. At confluence, cells were released by
trypsin and plated in 96-well dishes for the TGF-ß assay.
Determination of cell growth
Determination of cell growth was performed as described
previously (6)
. Briefly, triplicate 35 mm dishes were
seeded with 5 x 104 cells in 1.5 ml DMEM containing 10%
FCS. After 24 h, TGF-ß was added to the medium at the
concentrations indicated both in the absence and presence of 0.1 µM
TPA. Sister cells were incubated with TPA alone, as control. After 6
days in culture the cells were incubated with 6.25 (Ci/ml 3HThd
(Amersham, Little Chalfont, U.K.) for 16 h and the radioactivity
incorporated in the TCA-precipitable material was measured by
scintillation counting.
Assay for TGF-ß
Conditioned media were prepared from RD cells or from human
primary skeletal muscle cells, cultured for different periods of time,
as indicated.
Subconfluent MLECs were incubated with the conditioned medium (100 µl) for 16 h. The cells were then washed twice with phosphate-buffered saline (PBS) and lysed in 60 µl of lysis buffer (Promega, Madison, Wis.). Cell extracts were assayed for luciferase activity (Promega), according to the manufacturer’s instructions, using a Berthold luminometer. Parallel MLEC were incubated with known increasing concentrations of TGF-ß to obtain the TGF-ß standard curve.
Western blot and immunocytochemistry
For Western blot analysis, RD cells were lysed with sodium
dodecyl sulfate (SDS) Laemli buffer (29)
, loaded on 10%
SDS-polyacrylamide gel electrophoresis (PAGE), and transferred to
nitrocellulose membrane (Hybond C, Amersham). The membrane was then
probed with the appropriate specific antibodies as described elsewhere
(7)
; detection was performed by the ECL method (Amersham),
according to the manufacturer’s instructions. Scanning densitometry
was performed on fluorograms of the Western blot with a laser
densitometer (Ultroscan XL; Pharmacia LKB, Uppsala, Sweden). Data were
analyzed using the GSXL program (Pharmacia LKB).
The anti-sarcomeric myosin monoclonal antibody MF20 was kindly donated
by D. A. Fischman (Cornell University Medical College, New York);
it was used to determine the differentiation status of the cells
(30)
. Immunoperoxidase staining was performed on cultured
cells as described elsewhere (7)
. In summary, the cells
were fixed and permeabilized in ethanol:acetone (1:1), incubated for 30
min in PBS containing 5% non-fat milk (Carnation); the cells were then
incubated for 1 h with the MF20 mcAb. A biotin-conjugated goat
anti-mouse immunoglobulin G (IgG) antiserum (Zymed, San Francisco,
Calif.) was used as secondary antibody. After washing, the cells were
incubated with horseradish peroxidase-conjugated streptavidin (Zymed).
Diaminobenzidine (0.4 mg/ml; Sigma Chemical Co., St. Louis, Mo.) was
used as the substrate for peroxidase to visualize the immunostained
cells.
Northern blot
Total RNA was isolated by the acid-guanidinium
isothyocianate-phenol-chloroform method (31)
. Twenty
micrograms of total RNA were loaded into a 1.2% agarose-formaldehyde
gel and transferred to a nylon membrane (Hybond N, Amersham). The
hybridization was performed in 50% formamide, 10% dextran sulfate,
11.6 mg/ml NaCl, 0.1 mg/ml denatured salmon sperm DNA, and 1–3 x
106 cpm/ml of denatured random-primed
32P-labeled cDNA probe. The last washing was
performed in 0.5% SSC, 0.1% SDS at 65°C and the blots were exposed
to autoradiographic film (Reflection, Dupont, Wilmington, Del.).
The pHUK-1 plasmid containing the 1.5 kb uPA (plasminogen activator,
urokinase) cDNA probe, cloned in PstI sites was obtained from ATCC
(32)
. The pB33 plasmid, containing the full-length porcine
cDNA for TGF-ß-1 was kindly donated by P. Rossi and A. B.
Roberts (33)
. The 1.7 kb cDNA probe was prepared by BamHI
digestion; at the medium stringency conditions used, it recognizes all
three forms of mammalian TGF-ßs. The cDNA inserts were purified by
means of the Geneclean IIl kit (Bio 101, Inc., Vista, Calif.),
and 32P-labeled by the Ready-to-go random primed
labeling kit (Pharmacia), according to the manufacturer’s
instructions.
Zymography
For zymography of PA, culture medium or cell lysates (prepared
in 0.1 M Tris-HCl pH 8.1 containing 0.4% Triton X-100) were separated
in 10% SDS-PAGE under nonreducing conditions (29)
. PA was
then visualized by placing the Triton X-100 washed gel on a
casein-agar-plasminogen underlay as described previously
(34)
. Molecular weights were calculated from the position
of prestained markers that were subjected to electrophoresis in
parallel lanes. The lytic zones were plasminogen dependent.
Analysis of enzyme-inhibitor complexes
Low molecular mass urokinase (33 kDa, Serono) was labeled with
Iodogen (35)
at the specific activity of 2 x
107 cpm/µg of protein. Five microliters of
[125I]uPA (1–5 ng) were incubated for 1 h at 4°C
with 20 µl of the conditioned medium. The samples were then subjected
to SDS-PAGE and autoradiography, as described above.
DNA transfection
RD cells were transfected by electroporation using the Bio-Rad
Gene Pulser apparatus. In summary, 2.5 x 106 cells/50
µl DMEM serum-containing medium were electroporated at 80 mV with a
total of 12 µg of DNA (6 µg of plasmid + 6 µg salmon sperm DNA,
as carrier).
The ‘soluble’ TßRII cDNA was cloned as follows. The cDNA
fragment, lacking the cytoplasmic and the transmembrane domains, was
obtained by polymerase chain reaction (PCR amplification, using as
template the TßRII truncated-mutant-form cDNA (kindly donated by Dr.
Derynck, University of California at San Francisco) (36)
:
oligo forward: 5' GGGGAATTCGTCTGCCATGGGTCG 3'; reverse: 5'
GGGTCTAGACTAGTCAGGATTGCTGGTGTT 3'. PCR reactions were performed in 100
µl (1x PCR buffer, 0.25 mM dNTPs mix, 1.5 mM
MgCl2, 5 U Taq polymerase (Promega), and 50 pmol
primers) for 30 amplification cycles (1 min at 94°C, 1 min at 60°C,
1 min at 72°C). The resulting fragment was then cloned in the
XbaI/EcoRI sites of the pcDNA3 (InVitrogen, San Diego, Calif.)
expression plasmid. The cloned cDNA was completely sequenced with
Sequenase version 2.0 Kit (USB); sequence analysis was done using the
PCgene program.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, RD cells express high levels of the receptor, and TPA does not modify
its expression. Therefore, TGF-ß should be able to bind to the cell
in order to exert its effects. We investigated the effect of
exogeneously added TGF-ß on RD cell proliferation and
differentiation. RD cells were cultured both in the absence and
presence of TPA with different concentrations of TGF-ß (Fig. 2A
). After 5 days in culture, the cells were incubated with
3H Thd and the radioactivity in the TCA-precipitable
material was measured. As shown in Fig. 2A
, treatment with
TGF-ß induces growth arrest in a concentration-dependent manner; in
particular, TGF-ß concentrations ranging from 0.05 to 0.1 ng/ml exert
a very low level of inhibition, whereas a higher concentration of
TGF-ß (0.5 ng/ml) is necessary to reach a growth inhibition effect
similar to that observed after treatment with TPA. In a parallel
experiment, protein extracts of RD cells cultured as described above
were analyzed by Western blot for myosin expression (used as a
differentiation parameter) using the anti-myosin mcAb MF20. Figure 2B
shows that myosin expression is abolished by TGF-ß
administration at concentrations as low as 0.05 ng/ml; moreover,
TGF-ß prevents TPA-induced differentiation (Fig. 2B
).
|
|
TPA treatment reduces active extracellular TGF-ß in RD cells
Since like most tumor cells, RD cells produce TGF-ß
(12)
, express the receptor, and respond to TGF-ß action,
a TGF-ß autocrine loop is likely operating in these cells. We
therefore investigated whether the activity of this loop is impaired by
TPA to induce differentiation. Northern blot analysis revealed that TPA
enhances the expression of all three forms of TGF-ß even after only 1
day of treatment; this expression, however, decreases with the time
spent in culture, which means that there is only slight TPA induction
by the sixth day in culture when compared with the control cultures
(Fig. 3A
). As mentioned earlier, TGF-ßs are produced as latent
precursors, which need proteolytic digestion and dimerization to exert
their biological function. We therefore investigated whether TPA
treatment modifies the concentration of active TGF-ß to which RD
cells are exposed. To evaluate the amount of TGF-ß present in the
conditioned medium, MLEC stably transfected with a plasmid containing
the TGF-ß-inducible fragment of the PAI-1 promoter driving the
luciferase gene (28)
were incubated for 16 h with the
conditioned medium collected from RD cells cultured for 6 days both in
the absence or presence of TPA. The conditioned medium was used to
measure the active TGF-ß present or was prewarmed for 5 min at 85°C
to activate latent TGF-ß and measure the total TGF-ß present
(latent and active). The MLECs were then lysed and luciferase activity
was measured. As shown in Fig. 3B
, treatment with TPA
slightly enhances the concentration of the total (latent and active)
TGF-ß present in the medium, but reduces by 25-fold that of active
TGF-ß. It is worth noting that the active TGF-ß concentration in
control cells (0.04 ng/ml) is compatible with the anti-differentiative
effect, but not with the growth inhibition effect (see Fig. 2A, B
). When the data are expressed as a percentage of activation of
the total TGF-ß present in the medium, which also normalizes the data
for the TGF-ß-producing RD cell number in each sample, 22.6% of the
total TGF-ß is activated in control cells, whereas in TPA-treated
cells only 0.8% is activated. Taken together, these data suggest that
TPA may interfere with the anti-differentiative TGF-ß autocrine loop
by inhibiting the activation of latent TGF-ß.
|
To further investigate the possible role of the TGF-ß autocrine loop
in suppression of differentiation in RD cells, we treated the cells
with the serine-protease inhibitor, aprotinin. As stated before, the
activation of latent TGF-ß can be mediated by serine-proteases such
as plasmin (15)
. RD cells were therefore cultured for 6
days in the presence of aprotinin (2TIU/ml), a kunitz-type inhibitor of
serine proteases, or pepstatin (20 µM), a nonspecific protease
inhibitor; parallel cells were cultured both in the absence and
presence of TPA. Myogenic differentiation was then analyzed as the
expression of skeletal myosin by immunocytochemistry. As shown in
Fig. 4
, very few myosin positive cells are evident in control and in
pepstatin-treated cultures (Fig. 4a, c
); as previously
shown, TPA treatment induces the expression of myosin in a large
percentage of RD cells, together with a decrease in the cell number due
to growth inhibition (2
, 6
, 7)
(Fig: 4b);
treatment with aprotinin significantly enhances the number of
myosin-expressing cells when compared with the control and
pepstatin-treated cells (Fig. 4d
), but reduces only slightly
the total cell number. Therefore, the inhibition of serine-proteases,
which might account for the reduction in active TGF-ß, may mimic the
TPA-induced differentiation in RD cells.
|
To further investigate the mechanism by which TPA may inhibit the
activation of TGF-ß, we analyzed the expression of some of the
components of the PA/plasminogen system. In agreement with previous
reports (37)
, Northern blot analysis revealed that uPA
expression is induced after TPA treatment in RD cells, and is
maintained until the sixth day in culture; in control cells its
expression instead declines by that time (Fig. 5A
). To analyze the functional role of uPA accumulation in
control and TPA-treated RD cells, we performed zymographic analysis of
the activity localized in both medium and cell lysates at different
days of culture. The zymographs showed an increased secretion of uPA in
the conditioned medium after TPA treatment. The same treatment caused a
transient increase in cell bound uPA during the first 3 days in
culture, followed by a decrease on the sixth day, when TPA-treated RD
cells underwent differentiation (Fig. 5B
). Moreover, in the
extracellular compartment, a band of higher molecular weight appeared
in the samples of TPA-treated cells, suggesting the presence of a
complex containing uPA bound to its inhibitor, PAI. To study the
presence of free PAI in the conditioned medium of RD cells, aliquots of
medium were incubated in the presence of labeled uPA, as described in
Material and Methods. In the presence of unbound PAI, covalent
complexes between PA and its inhibitors were formed and revealed by
their lower mobility in an acrylamide gel. As shown in Fig. 5C
, only the medium obtained from TPA-treated cells
presented a higher molecular weight band, which indicates the
TPA-induced expression of PAI. Taken together, these data indicate that
TPA alters the balance of the uPA/PAI system and its activity; these
alterations may likely cause the reduction of TGF-ß activation
observed.
|
Reduction of TGF-ß concentration mimics TPA-induced
differentiation in RD cells
To formally demonstrate that the TPA-induced reduction in active
TGF-ß mediates the induction of differentiation, we transfected RD
cells with an expression plasmid containing a cDNA encoding for the
extracellular portion of TßRII, the so-called ‘soluble TßRII
receptor’. The resulting expressed protein works as a ‘dominant
negative’ for TGF-ß, because it competes for TGF-ß binding to the
cell membrane. After transfection, RD cells were cultured for 6 days
and myosin expression was analyzed by Western blot; to ensure that the
transfection itself did not modify the RD cell phenotype, parallel
cultures were cultured with the medium, which was changed every day for
6 days, conditioned from the soluble TßRII-transfected cells as well
as from ‘mock’ transfected cells; the cell lysates were analyzed for
myosin expression. In agreement with a previous observation on
nontransformed muscle cells (38)
, proliferation (as
revealed by BudR staining, not shown) and differentiation (as revealed
by myosin expression, Fig. 6
) are inhibited when extracellular TGF-ß is completely removed from RD
cell medium either by transfection of the soluble TßRII mutant form
(not shown) or by culturing them in conditioned medium collected from
soluble TßRII-transfected cells (Fig. 6A
, lane 10). To
verify whether an ‘optimal’ concentration of TGF-ß at which
differentiation occurs can be determined, we cultured RD cells in
medium conditioned from soluble TßRII-transfected cells titrated,
from 0 to 10 parts, with medium conditioned from the mock cells; the
cells were lysed after 6 days in culture. Media were assayed for the
presence of active TGF-ß, whereas cell lysates were analyzed for
myosin expression. With the serial dilution of the soluble TßRII
conditioned medium, increasing concentrations of active TGF-ß were
found by means of the MLEC standard assay. Western blot analysis of
cell lysates showed that myosin expression was comparable to
TPA-treated cells when RD cells were cultured with the conditioned
medium collected from the soluble TßRII-transfected cells, diluted
with conditioned medium collected from the mock cells in the 3:7–1:9
ratio range (Fig. 6A
); this range corresponds, as measured
by the MLEC standard assay, to a concentration of active TGF-ß
ranging between 0.14 and 0.20 x 10-2 ng/ml (Fig. 6C
). The relative quantification of myosin expression, by
the densitometric analysis of the Western blot is also shown (Fig. 6B
).
|
Effect of TGF-ß and TPA on differentiation of human primary
muscle cells
To investigate whether the proposed TGF-ß autocrine loop
regulating terminal myogenesis in RD cells can account for regulation
of differentiation in nontransformed cells as well, we used as a normal
counterpart primary human muscle cells, hSkMC (no human muscle cell
lines are yet available).
We first investigated the effect of TGF-ß or TPA on differentiation
of these cells. Growing hSkMC were cultured in hSkMC differentiation
medium (a synthetic medium containing insulin; see Material and
Methods) containing increasing concentrations of TGF-ß (0.05–5
ng/ml) or 0.1 µM TPA. After 3 days the cells were fixed and analyzed
for myotube formation and myosin expression by immunocytochemistry. As
shown in Fig. 7
TGF-ß inhibits differentiation of hSkMC in a concentration-dependent
manner; concentrations ranging from 0.05 to 0.5 ng/ml exert little or
no inhibition, whereas a higher concentration (1 ng/ml) is necessary to
reach a differentiation inhibitory effect (Fig. 7)
. This concentration
is almost two orders of magnitude higher than the concentration
required to reach the TGF-ß differentiation inhibitory effect in RD
cells. As shown in Fig. 7
, also TPA inhibits differentiation in hSkMC,
as it is usually considered an inhibitor of muscle cell
differentiation. To verify whether the mechanisms regulating
differentiation in RD cells can be compared to the ones responsible of
differentiation of primary cells, subconfluent hSkMC were cultured for
3 days with conditioned medium collected from RD cells cultured for 5
days in the absence or presence of TPA. As shown in Fig. 7A, B
, differentiation of hSkMC is not affected when the cells are
cultured with RD cell-conditioned medium (where the concentration of
active TGF-ß is 0.04 ng/ml, Fig. 3B
), whereas it is
inhibited when the cells are cultured with TPA-treated, RD
cell-conditioned medium; this inhibition is comparable to the one
obtained when hSkMC are cultured in the presence of TPA. Moreover, to
verify the effect of removal of TGF-ß on hSkMC differentiation,
subconfluent cells were cultured for 3 days in hSkMC differentiation
medium containing 30 µg/ml of anti-TGF-ß antibody (Genzyme, Boston,
Mass.). At this antibody concentration, active TGF-ß is not
detectable in the medium by the standard MLEC assay (not shown). As
shown in Fig. 7A, B
, removal of TGF-ß is not sufficient to
prevent primary human muscle cells differentiation, in contrast to what
is observed in RD cells.
|
Given the opposite effect exerted by TPA in hSkMC and RD cells, we then
investigated the role of TPA in controlling TGF-ß activity in hSkMC.
We first measured the concentration of active TGF-ß in hSkMC cultured
for 3 days in the presence or in the absence of TPA by the standard
MLEC assay. As shown in Fig. 8A
, TPA reduces the concentration of total TGF-ß and
inhibits almost completely its activation, indicating that the effect
of TPA on TGF-ß accumulation and activation in primary cells is
slightly different than in RD cells. To analyze the effect of TPA on
uPA activity, we performed zymographic analysis of the uPA activity
localized in both medium and cell lysate on the third day of culture.
As shown in Fig. 8B
, TPA treatment causes a significant
decrease in uPA activity in the extracellular compartment and only a
slight decrease in the cell-associated enzyme, which is compatible to
its anti-differentiative effect (39
, 40)
.
|
Taken together, these data indicate that primary human muscle cells are sensitive to the differentiation inhibitory effect of TGF-ß, although a much higher concentration is needed to exert its effect than in transformed muscle cells, and TPA inhibits differentiation in this cell system probably through a TGF-ß-independent mechanism.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
These data represent the first demonstration that a single autocrine
loop, the TGF-ß loop, is responsible for proliferation and
suppression of differentiation in rhabdomyosarcoma cells. In fact, it
has already been shown that the simultaneous blockade of all the
autocrine loops by suramin in these cells results in growth arrest and
muscle differentiation (25)
; the specific inhibition of
certain single autocrine loops, such as EGF, IGF, bFGF impairs cell
proliferation, but does not lead to muscle differentiation (26
, 27)
.
We show here that RD cells produce TGF-ßs, express the TßRII, and
are sensitive to the anti-differentiative effect of exogenously added
TGF-ß, thus demonstrating the existence of a TGF-ß autocrine loop.
The fact that the transformed phenotype and the suppression of
differentiation in these cells coexist with the expression and DNA
binding activity of the MRFs, as occurs in differentiation inhibited
TGF-ß-treated muscle cells (8)
, makes this autocrine
loop a good candidate for suppressing differentiation in RD cells.
Moreover, growth arrest and myogenic differentiation can be induced in
RD cells by treatment with the phorbol ester TPA (6)
without interfering with the expression or binding activity of the MRFs
(2
; M. Bouchè, unpublished observation). As TPA is
usually considered an inhibitor of muscle cell differentiation, its
highly specific action in RD cells must be due to its impairment of
particular anti-differentiative pathways in these cells. We demonstrate
that TPA decreases significantly (but does not abolish) the
concentration of active TGF-ß in the RD-conditioned medium, which
suggests that this may represent one of the crucial effects exerted by
TPA. Moreover, treatment of RD cells with the serine protease inhibitor
aprotinin results in a significant increase of myosin positive cells,
suggesting that the activity of these enzymes is closely involved in
the suppression of differentiation in these cells. This result is
consistent with a previous observation that the treatment of
nontransformed muscle cells with aprotinin enhances myogenic
differentiation (24)
. TPA is known to induce the
expression of both uPA and PAI-1 in RD cells (37)
as well
as in other cell systems, as we also show here, hence altering the
serine protease system activity and balance. Furthermore, although a
significant proportion of uPA is initially found to be associated with
the cell membranes in TPA-treated cells, at the onset of
differentiation, cell-associated uPA drops and becomes redistributed in
the extracellular compartment. The same kinetics of uPA-regulated
localization has been described in differentiating muscle cells; it has
been suggested that uPA might play a dual role: as a cell-associated
protease provides the machinery that allows myoblasts to migrate, then
as a soluble enzyme it regulates signals controlling differentiation
(41)
. In line with this hypothesis, the decrease observed
of cell-associated uPA in TPA-treated RD cells, together with the
increase of PAI, may stimulate myogenic differentiation by inhibiting
the formation of the uPA-mediated plasmin activity and, consequently,
the activation of latent TGF-ß.
Taken together, these data strongly suggest that TPA induces myogenic
differentiation in RD cells by lowering the concentration of active
TGF-ß, through a uPA/PAI-dependent mechanism. Proof that TGF-ß
plays a central role in controlling myogenic differentiation in these
cells is provided by the expression of the dominant negative mutant
form of TßRII. In fact, when TGF-ß is completely removed from the
medium by the expression of the soluble TßRII mutant form,
proliferation and differentiation are completely abolished, which is
consistent with a previous report in nontransformed muscle cell lines
(38)
. However, when the concentration of active TGF-ß is
titrated by serial dilution of the dominant negative mutant, an optimal
TGF-ß concentration that induces RD cell differentiation mimicking
the effect of TPA is determined; this concentration is comparable to
the one measured in conditioned medium from TPA-treated cells.
The situation appears to be more complicated when we compare the
proposed mechanisms with the regulation of differentiation in human
primary muscle cells. In fact, although differentiation of primary
human cells is inhibited by TGF-ß, a much higher concentration of the
factor (1 ng/ml) is needed to exert its effect in primary than in RD
cells; this suggests that primary cells are less sensitive to the
TGF-ß action. In line with this observation, RD cell-conditioned
medium, where the concentration of active TGF-ß is 0.04 ng/ml, is not
sufficient to inhibit differentiation in primary cells. Moreover, in
contrast to what is observed in RD cells, in primary cells complete
removal of TGF-ß, mediated by the anti-TGF-ß antibody, does not
inhibit differentiation, suggesting that other mechanisms may
compensate for its absence. Moreover, this result suggests that the
concept of a TGF-ß critical concentration may not be as relevant to
primary as to sarcoma cells; this is not surprising, however, since
unlike RD cells, primary muscle cells undergo spontaneous
differentiation. It is noteworthy that, although to get an optimal
myogenic differentiation, primary cells are cultured in a synthetic
medium containing insulin, they can differentiate even in high
serum-containing medium (not shown); this suggests that their ability
to differentiate can overcome growth factor-inhibiting action. Another
apparent contradiction arises from the comparison of the TPA-induced
effect on the differentiation of primary and RD cells. In fact, though
TPA induces RD cell differentiation, it inhibits this process in human
primary muscle cell, as it usually does in nontransformed cells.
Moreover, in primary cells, TPA decreases the concentration of the
total TGF-ß produced and inhibits its activation almost completely.
Whether the absence of active TGF-ß can account for the TPA
anti-differentiative effect is so far a matter of speculation. On the
other hand, the concentration of active TGF-ß in untreated cells is
not sufficient to inhibit differentiation; as discussed before,
antibody-mediated complete removal of TGF-ß in primary cells does not
inhibit muscle differentiation; nevertheless, the possibility that
this condition may cooperate with other TPA-induced mechanisms to exert
the anti-differentiative effect cannot be ruled out. As for RD cells,
in human cells the decreased activation of TGF-ß can be ascribed to a
decrease of uPA activity. In primary cells, though, TPA reduces uPA
activity in the extracellular compartment and only slightly in the
cell-associated fraction. Besides activation of TGF-ß, uPA has been
suggested to be involved in regulation of both migration and fusion of
myoblasts; therefore, this decrease in uPA activity is compatible with
the inhibition of differentiation due to a lack of migration and
fusion, as already hypothesized (39
, 40)
.
In conclusion, this paper demonstrate that RD cells, at variance with the nontransformed muscle cells, elicit a strict dependence on TGF-ß action and need an optimal concentration of active TGF-ß to differentiate, probably in synergy with other factors. Suppression of differentiation is due at least in part to overproduction of active TGF-ß and the establishment of an autocrine loop. The reduction of TGF-ß concentration by agents such as TPA or specific inhibitors such as aprotinin or the TßRII mutant form is sufficient to drive myogenic differentiation. Nevertheless, the possibility that TPA may impair the TGF-ß autocrine loop in ways other than through the serine protease system, such as the expression and/or the activity of the Smad proteins cannot be ruled out and currently is under investigation.
These data shed light on possible mechanisms instrumental in working out a differentiation therapy approach to this type of sarcoma.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
in 12-O-tetradecanoylphorbol-13-acetate-induced differentiation of human rhabdomyosarcoma cells. Cell Growth & Differ 6,845-852[Abstract]
This article has been cited by other articles:
|
|
 |
|
  S. Croci, L. Landuzzi, A. Astolfi, G. Nicoletti, A. Rosolen, F. Sartori, M. Y. Follo, N. Oliver, C. De Giovanni, P. Nanni, et al. Inhibition of Connective Tissue Growth Factor (CTGF/CCN2) Expression Decreases the Survival and Myogenic Differentiation of Human Rhabdomyosarcoma Cells Cancer Res., March 1, 2004; 64(5): 1730 - 1736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Wang, S. R. Thomson, J. D. Starkey, J. L. Page, A. D. Ealy, and S. E. Johnson Transforming Growth Factor {beta}1 Is Up-regulated by Activated Raf in Skeletal Myoblasts but Does Not Contribute to the Differentiation-defective Phenotype J. Biol. Chem., January 23, 2004; 279(4): 2528 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. V. L. Loducca, A. Mantesso, E. M. F. De Oliveira, and V. C. De Araujo Intraosseous Rhabdomyosarcoma of the Mandible: A Case Report International Journal of Surgical Pathology, January 1, 2003; 11(1): 57 - 60. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Mauro, C. Ciccarelli, P. De Cesaris, A. Scoglio, M. Bouche, M. Molinaro, A. Aquino, and B. M. Zani PKC{alpha}-mediated ERK, JNK and p38 activation regulates the myogenic program in human rhabdomyosarcoma cells J. Cell Sci., September 15, 2002; 115(18): 3587 - 3599. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
