FASEB J. Thermo Fisher Scientific
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BIROCCIO, A.
Right arrow Articles by DEL BUFALO, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BIROCCIO, A.
Right arrow Articles by DEL BUFALO, D.
(The FASEB Journal. 2000;14:652-660.)
© 2000 FASEB

Bcl-2 overexpression and hypoxia synergistically act to modulate vascular endothelial growth factor expression and in vivo angiogenesis in a breast carcinoma line

ANNAMARIA BIROCCIO*, ANTONIO CANDILORO*, MARCELLA MOTTOLESE{dagger}, ORAZIO SAPORA{ddagger}, ADRIANA ALBINI§, GABRIELLA ZUPI* and DONATELLA DEL BUFALO*1

* Experimental Chemotherapy Laboratory, Regina Elena Cancer Institute, Rome, Italy;
{dagger} Pathology Department, Regina Elena Cancer Institute, Rome; Italy;
{ddagger} Comparative Toxicology Laboratory, Istituto Superiore di Sanità, Rome; Italy; and
§ Advanced Biotechnology Center, National Institute for Research on Cancer, Genova, Italy

1Correspondence: Experimental Chemotherapy Lab., Regina Elena Cancer Institute, Via delle Messi d’Oro N.156, 00158 Rome, Italy. E-mail: delbufalo{at}ifo.it


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We have previously demonstrated that bcl-2 overexpression enhances the metastatic potential of the MCF7 ADR human breast cancer cell line resistant to adriamycin by inducing metastasis-associated properties. To further elucidate the relationship between bcl-2 expression and the metastatic potential of the MCF7 ADR line, we evaluated whether bcl-2 could be also involved in the modulation of the angiogenic phenotype. Four bcl-2-overexpressing clones, a control transfectant clone, and the MCF7 ADR parental line were used for in vitro and in vivo experiments. Bcl-2 overexpression enhanced the synthesis of the hypoxia-stimulated VEGF protein and mRNA. Northern blot analysis demonstrated an increased VEGF mRNA expression in bcl-2-overexpressing clones, and reverse transcription-polymerase chain reaction showed higher levels of the VEGF121 and VEGF165 mRNA isoforms, which are the most active in eliciting angiogenesis. When incorporated into matrigel, supernatants of bcl-2-transfected cells cultured under hypoxic conditions induced an increased angiogenic response in C57BL/6 mice compared with that of control clone. Tumors from bcl-2 transfectants demonstrated increased VEGF expression and neovascularization as compared to the parental line, whereas the apoptosis in in vivo xenografts was similar in control and bcl-2 transfectants. The effect of bcl-2 on angiogenesis was not mediated by p53 protein. These results demonstrate that bcl-2 and hypoxia can act synergistically to modulate VEGF expression and the in vivo angiogenic response in the MCF7 ADR line.—Biroccio, A., Candiloro, A., Mottolese, M., Sapora, O., Albini, A., Zupi, G., Del Bufalo, D. Bcl-2 overexpression and hypoxia synergistically act to modulate vascular endothelial growth factor expression and in vivo angiogenesis in a breast carcinoma line.


Key Words: in vivo matrigel assay • MCF7 ADR • metastasis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
BCL-2 BELONGS TO a growing family of apoptosis regulatory gene products that may be either death antagonists or death agonists (1) . This family of proteins has been demonstrated to regulate apoptosis in response to chemotherapy both in vitro and in vivo (2) . Even though several studies have indicated bcl-2 may not always function as a suppressor of apoptosis (3 4 5) , enforced overexpression of bcl-2 has been demonstrated to block or delay apoptosis and to provide a true survival advantage after diverse stimuli such as chemotherapeutic agents (2) . With the discovery of the antiapoptotic function of the bcl-2 oncogene (6) , the concept emerged that an elevated threshold for apoptosis represents a central step in tumorigenesis (7) . The oncogenic potential of bcl-2 has been demonstrated in NIH3T3 cells (8) and verified in bcl-2 transgenic mice (7) . Synergy between bcl-2 and myc in tumorigenesis, first noted in vitro (6) , has been demonstrated for lymphoma and breast cancer in bitransgenic mice (9) . Under the limiting growth conditions present in vivo, bcl-2 overexpression encourages the cell cycle exit into quiescence, as well as survival (10) . Potentiation of the malignant phenotype of the undifferentiated thyroid tumor cells by insertion of the bcl-2 gene has also been demonstrated (11) . In addition, a role for bcl-2 in tumor metastasis has been found. Takaoka et al. and our group (12 , 13) have recently demonstrated the ability of bcl-2 overexpression to enhance the metastatic potential of murine and human tumors. In particular, we demonstrated that bcl-2 overexpression enhances both tumorigenicity and metastatic potential of the MCF7 ADR human breast cancer cell line resistant to adriamycin (ADR) by inducing metastasis-associated properties such as in vitro invasion and migration (13) . To consider whether other mechanisms may explain the effect of bcl-2 transfection on MCF7 ADR metastatic ability, the objective of this study was to evaluate whether the overexpression of bcl-2 can be associated with the angiogenic process.

It is now well known that angiogenesis, the process leading to the formation of new blood vessels, plays a central role in the growth of both primary and metastatic tumors (14) . So far, no studies evaluating the role of bcl-2 on angiogenesis have been performed. Rapid primary tumor growth and local invasiveness generally accompany the switch from the avascular to the vascular phase. Furthermore, angiogenesis is necessary at both the beginning and the end of the development of distant metastasis, and is implicated in the phenomenon of dormant metastases (15 16 17) . The increase in vasculature enhances the probability of tumor cells entering the circulation and may give rise to metastasis (18) . In addition, angiogenesis index is a useful prognostic factor in early-stage breast cancer (19 , 20) . The switch to the angiogenic phenotype is strongly associated with increased expression of angiogenic-promoting cytokines such as tumor necrosis {alpha} and growth factor mitogens such as fibroblast growth factor, platelet-derived growth factor, and vascular endothelial growth factor (VEGF) (21 22 23) . Among these, VEGF is one of the most important factors involved in the angiogenesis of breast cancer (21) . Previous studies have demonstrated that oncogenic transformation with activated forms of the Src, Ras, and Raf-1 oncogenes and the loss of the wild-type p53 tumor suppressor gene could increase the expression of VEGF, suggesting a link between tumorigenesis and angiogenesis (24 25 26 27) . Studies have shown that hypoxia is also a potent activator of VEGF and many proangiogenic mitogens (28 , 29) . Thus, if oncogenes and antioncogenes prime cells for increased VEGF expression, tumor hypoxia would provide the necessary signal to increase or maintain this state of angiogenic growth factor production. A recent study has indicated that the oncogene activation observed during tumor development and the tumor microenvironment play critical and perhaps synergistic roles in regulating cell viability (30) .


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell lines and culture conditions
The MCF7 ADR breast cancer cell line resistant to ADR was kindly provided by Dr. K. Cowan (NCI, Bethesda, Md.). Bcl-2-overexpressing clones (MAB25, MAB26, MAB27, and MAB31) and a control clone (MAN9) were obtained by transfecting the MCF7 ADR cells with a bcl-2 expression vector or the native vector alone, respectively (13) . The tumor lines were maintained in RPMI 1640 medium containing 10 µM ADR and supplemented with 10% fetal calf serum, 2 mM L-glutamine, and antibiotics in a humidified atmosphere with 5% CO2 at 37°C. The cells were grown for 2 wk in drug-free medium prior to each experiment.

Hypoxic treatment
Cells were seeded at 1 x 106 cells/60 mm in tissue culture glass dishes and grown for 24 h in complete medium. Then medium was removed, cells were washed with phosphate-buffered saline, and serum-free medium was added. The cells were cultured in a humidified atmosphere with 95% air/5% CO2 (normoxia) or incubated in specially designed aluminum chambers flushed with a gas mixture containing 5% CO2 and 95% N2 (hypoxia, ref 31 ). After 24 h, cell supernatants were collected, centrifuged at 14,000 rpm for 10 min, and stored at -80°C. Concomitantly cells were harvested, counted, and used for total RNA extraction.

ELISA, RT-PCR, and Northern blot analysis
The amount of VEGF protein in the supernatant was determined with an ELISA kit (R & D Systems, Minneapolis, Minn.) according to the manufacturer’s instructions. The sensitivity of the VEGF assay was 31.2 pg/ml.

The levels of VEGF mRNA were determined by reverse transcriptase-polymerase chain reaction (RT-PCR). Total RNA was isolated by Trizol (Life Technologies, Inc.-BRL, Gaithersburg, Md.), following standard protocol, and quantified spectrophotometrically. First-strand cDNA synthesis and amplification of specific DNA sequence were performed according to the manufacturer’s instructions (GeneAmp, RNA PCR Kit, Perkin Elmer Cetus, Emeryville, Calif.). Briefly, 1 µg of total RNA was used for cDNA synthesis using oligo(dT) primer in the presence of Moloney murine leukemia virus reverse transcriptase. cDNA encoding VEGF was amplified for 25 cycles (95°C for 30 s, 60°C for 30 s, and 72°C for 30 s). The following primers were used: 5' GGCTCTAGATCGGGCCTCCGAAACCAT 3' (forward, base -16 to +2 in exon 1); 5' GGCTCTAGAGCGCAGAGTCTCCTCTTC 3' (reverse, bases 804 to 821 in the 3' untranslated region) as described by Boocock et al. (32) . Expression of GAPDH was used as an internal standard for RNA loading. Experiments were repeated three times.

Northern blot analysis was performed after 24 h of hypoxia for MCF7 ADR cells and bcl-2 transfectants. Total RNA (30 µg) was size-fractionated on denaturing formaldhyde agarose gel, blotted onto nylon filters, and hybridized with a 600 bp fragment of the plasmid specific for human VEGF (kindly provided by Dr. G. Persico; ref 33 ). Filters were exposed to autoradiographic film for 7 days.

Xenograft experiments and immunohistochemistry
MCF7 ADR line, a control clone, and two bcl-2-overexpressing clones were injected in nude mice as described previously (13) . Animals were killed 30 and 60 days after tumor implantation; the tumors were weighed and processed for Western blot and immunohistochemical analysis of VEGF expression, neovascularization, and TUNEL assay. VEGF expression was analyzed on paraffin sections stained with anti-VEGF monoclonal antibody (mAb) (C-1, Santa Cruz Biotechnology, Santa Cruz, Calif.), whereas the mouse tumor vasculature was examined on frozen sections stained with a rat anti-mouse CD31 antibody, (MEC 13.3, gift from Prof. Alberto Mantovani, Istituto di Ricerche Farmacologiche Mario Negri, Milan, Italy). Frozen and paraffin sections were processed with a three-step streptavidin biotin immunoperoxidase staining system (LSAB kit, Dako, Milan, Italy). The enzymatic activity was developed using 3-amino-9-ethylcarbazole (Dako) as chromogenic substrate. After counterstaining with Mayer hematoxylin, sections were mounted in aqueous mounting medium (Glycergel, Dako). Negative controls consisted of parallel sections in which the primary antibody was omitted. The immunohistochemical detection of apoptosis in formalin-fixed, paraffin-embedded tumor tissues was performed by TUNEL assay (in situ cell death detection kit, fluorescein; Boehringer Mannheim, Milan, Italy) as previously reported (34) .

Assessment of microvessel density
The method of Weidner et al. (35) , partially modified, was used to measure intratumoral microvessel density. All blood vessels were highlighted by staining endothelial cells for CD31 using a standard immunoperoxidase technique (described above). Any brown-stained endothelial cell or endothelial cell cluster, clearly separate from adjacent microvessels and tumor cells, was considered a single, countable microvessel. Since the size of frozen tumor biopsy was small, the microvessel density was determined by counting the immunohistochemically stained endothelial cells in all the cryostat sections. Vascular counts were estimated using an eyepiece graticule at high-power fields (HPF: 400x magnification). At this magnification, the graticule covered an area of 0.125 mm2. The average number of microvessels in all the fields scanned at HPF by two observers was calculated, taking into account three independent experiments.

Western blotting
The expression of p53 protein in cell lysates was evaluated by Western blot as previously reported (36) . For analysis of VEGF protein expression in xenografted tumors, 100 mg of homogenized tumor was incubated at 4°C for 30 min in lysis buffer with ionic detergent (2% sodium dodecyl sulfate; 20 mM Tris pH 8.0; 2 mM PMSF). Total proteins (60 µg) were loaded from each sample and separated on a 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis in nonreducing conditions. Anti-VEGF mAb (VEGF Ab-3, clone 14–124, Calbiochem, Cambridge, Mass.), which recognizes the four isoforms of VEGF (121, 165, 189, 206 amino acid residues long), was used at 1:500 dilution.

To check the amount of proteins transferred to nitrocellulose membrane, heat shock protein (HSP) was used as control and detected by an anti-human HSP 72/73 mAb (Ab-1, clone W27, Calbiochem). The relative amounts of the transferred proteins were quantified by scanning the autoradiographic films with a gel densitometer scanner (Bio-Rad, Milan, Italy) and normalized to the related HSP 72/73 amounts. Western blot analysis was performed in three different experiments.

In vivo matrigel assay
To evaluate the ability of bcl-2 to modulate the neovascularization within matrigel plugs containing heparin, the method described by Albini et al. was used (37) . Briefly, cell supernatants were concentrated 10X with Centricon-3 concentrators (Amicon, Danvers, Mass). Matrigel (600 µl) (Collaborative Research, Becton Dickinson, Bedford, Mass.) supplemented with heparin (19.2 U, Schwarz Pharma S.p.A., Milan, Italy) and 60 µl of supernatant concentrated were injected subcutaneously (s.c.) into the flank of 8-wk-old C57BL/6 mice (furnished by the Animal Care Unit of Regina Elena Cancer Institute, Rome), where it rapidly forms a gel. Within days, cells from the surrounding tissues migrate into the matrigel and formed vascular structures connected to the mouse blood vessels. After 5 days, the angiogenic response was evaluated by macroscopic analysis at autopsy, and by measurement of the hemoglobin content into the pellet of matrigel. Hemoglobin was mechanically extracted from the pellets in water and measured using the Drabkin method by spectrophotometrical analysis (Sigma, Chemical Co., St Louis, Mo.). The values were expressed as optical density/100 mg matrigel. Each group consisted of four animals. The experiments were repeated four times.

Statistical analysis
A two-sample t test was performed to compare VEGF protein secretion in cell lines exposed under various conditions, hemoglobin content into matrigel plug, and vessel density within tumors.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Hypoxia-induced VEGF expression is enhanced by bcl-2 overexpression
Angiogenesis is an essential step in the process of metastatization, and VEGF is considered a critical factor in neovascularization (16 , 22) . To investigate whether the transfection of MCF7 ADR cells with a bcl-2 expression vector modulates the in vitro secretion of VEGF protein, we compared the levels of VEGF protein in the supernatants of the parental line (MCF7 ADR), a control clone (MAN9), and 4 bcl-2 transfectants (MAB25, MAB26, MAB27, MAB31). The conditioned medium of the cells was collected 24 h after serum deprivation, and VEGF protein levels were determined (Fig. 1 ). The mean ± SD of the VEGF protein was 40 ± 2 pg/106 cells/24 h in the MCF7 ADR parental line. No significant increase in VEGF secretion was found in the bcl-2 transfectants (the VEGF protein ranged from 50±3 to 60±5 pg/106 cells/24 h for the different clones (P>0.05).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Expression of VEGF protein in conditioned media of the MCF7 ADR parental line, a control clone (MAN9), and four bcl-2 transfectants (MAB25, MAB26, MAB27, and MAB31) grown in normoxia and hypoxia for 24 h (average of three independent experiments; bars, SD).

Since hypoxia is the most potent activator of VEGF and solid tumors grow in lowered oxygen pressure (28 , 29 , 38) , in order to mimic the in vivo situation, VEGF secretion was also evaluated 24 h after exposure to hypoxic conditions. As demonstrated in several tumor histotypes (28 , 38) , hypoxia increased secretion of VEGF in all the lines. In particular, MCF7 ADR parental line and the control clone show about a threefold increase in the steady-state expression of VEGF after 24 h exposure to hypoxia (Fig. 1) . Bcl-2 transfectants at the same experimental conditions exhibited an eightfold induction of VEGF secretion compared to the bcl-2 transfectants grown in normoxia. The statistical analysis demonstrated a significant difference in VEGF secretion between control lines and bcl-2 transfectants grown in hypoxia (P<0.01).

cDNA sequence analysis of a variety of human VEGF had indicated that VEGF may exist as one of four different molecular species (21) . To analyze whether bcl-2 transfection is able to modulate the expression of different VEGF isoforms, VEGF mRNA levels were determined by RT-PCR. MCF7 ADR cells, MAN9 control clone and two representative bcl-2 transfectants (MAB25 and MAB31) were analyzed. As reported in Fig. 2 , amplification in normoxia of VEGF cDNA with VEGF-specific primers generated similar levels of VEGF121 isoform in all the lines tested. VEGF165, VEGF189, and VEGF206 isoforms were not detectable in the experimental conditions used. After 24 h hypoxic exposure, we found that the level of the VEGF121 isoform was higher in the bcl-2-overexpressing clones than in the parental line (~sixfold). Moreover, appreciable levels of VEGF165 isoform in both bcl-2 clones were detected, while no bands corresponding to this isoform were evident either in MCF7 ADR parental or neo-transfected lines. To confirm the increased VEGF mRNA production observed by RT-PCR in bcl-2 transfectants, Northern blot analysis of VEGF mRNA was performed (Fig. 3 ). After 24 h of hypoxic exposure, MCF7 ADR parental line and MAN9 control clone do not express detectable levels of VEGF specific transcript. Interestingly, VEGF mRNA expression is clearly evident in both bcl-2 transfectants at the same experimental conditions.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. Expression of VEGF mRNA in the MCF7 ADR parental line, a control clone (MAN9), and two bcl-2 transfectants (MAB25 and MAB31) analyzed by RT-PCR. Ethidium-stained agarose gel showing representative products amplified from cDNA. Molecular weight marker is a 100-bp ladder. Calculated molecular weights of product bands are indicated.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 3. Northern blot analysis of VEGF gene expression in MCF7 ADR parental line, MAN9 control clone, and MAB25 and MAB31 bcl-2 transfectants. Northern blot analysis was performed after 24 h of hypoxia loading 30 µg of total RNA. The bottom of the figure shows the ethidium bromide staining of the gel. A representative experiment is shown.

Since breast cancer cell lines and primary human breast tumors express a wide range of vascular growth factors (39) , we evaluated whether the overexpression of bcl-2 was also able to modulate the expression of basic fibroblast growth factor (bFGF) and tumor growth factor beta 1 (TGF-ß1), two important molecules involved in the angiogenesis of breast tumor. Neither of the proteins were detected in the conditioned media of all the clones grown in normoxia and hypoxia (data not shown). The sensitivity of the bFGF assay was 30 pg/ml, while that of TGF-ß1 was 10 pg/ml.

Bcl-2 increases angiogenesis in vivo
To evaluate whether the increase in VEGF secretion induced by bcl-2 in hypoxic conditions was associated with an increase in the angiogenic process, an in vivo angiogenesis assay was performed. Matrigel plugs containing the different cell supernatants were injected s.c. in mice and the degree of vascularization into matrigel plugs evaluated after 5 days (Fig. 4 ). Supernatants of the MAN9 control clone show only a slight angiogenic response (Fig. 4A ). In contrast, supernatants of the bcl-2 transfectants showed a stronger angiogenic response as compared with the response seen by macroscopic analysis in the MAN9 control clone. Quantification of the angiogenic response by determination of the hemoglobin content in the matrigel plugs demonstrated that the matrigel plugs containing bcl-2-transfected cell supernatants had a significantly higher (three- to sixfold, P<0.001) level of vascularization (Fig. 4B ) than those containing the MAN9 control supernatants. The MCF7 ADR parental line showed a similar angiogenic response in vivo as the MAN9 clone (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. In vivo angiogenesis assessed after injection on C57BL/6 mice with matrigel containing conditioned media from a control clone (MAN9) and two bcl-2 transfectants (MAB25 and MAB31) grown for 24 h in hypoxic conditions. After 5 days, mice were killed and neovascularization was evaluated. A) Macroscopic analysis of matrigels from one representative experiment. B) Hemoglobin content of matrigel pellets. The mean values of four independent experiments are reported.

Bcl-2 overexpression increases VEGF expression and vessel density in tumors
Since low pressure of oxygen is a feature of solid tumors, we evaluated whether bcl-2 overexpression is able to modulate VEGF expression in tumor xenografts. The VEGF expression was first analyzed by Western blot. We found an increased level of VEGF protein expression in tumors formed by four bcl-2-overexpressing clones as compared to tumors of the MAN9 control and MCF7 ADR parental cell lines (Fig. 5 ). Quantitative analysis of VEGF signal after normalization to HSP reveals that the MAB25, MAB31, MAB26, and MAB27 bcl-2-overexpressing clones showed very high levels of the VEGF121 isoform, while this isoform was not detectable in the control clone. No significant differences in the expression of the VEGF165 isoform were observed between the four lines. The expression of VEGF isoforms in MCF7 ADR tumors was similar to that of the MAN9 control clone (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. Western blot analysis of VEGF proteins in xenografted tumors obtained 60 days after implantation of a control clone (MAN9) and four bcl-2 transfectants (MAB25, MAB31, MAB26, and MAB27). A representative experiment is shown. The relative amounts of the transferred proteins were quantified and normalized to the corresponding HSP 72/73 protein amounts.

To analyze the tissue distribution of VEGF, we performed an immunohistochemical staining of tumors obtained injecting MCF7 ADR, MAN9, MAB25, and MAB31 lines in nude mice. Figure 6 shows VEGF expression in MCF7 ADR line (panel A) and MAB25 clone (panel B). The intensity of VEGF staining was significantly higher and more homogeneous in the tumor originating from the bcl-2-overexpressing clone than in the tumor obtained from the parental line. The immunohistochemical staining appeared confined in both the plasma membrane and the cytoplasm of tumor cells, indicating that cells synthesize VEGF protein. MAN9 and MAB31 showed a VEGF expression similar to that observed, respectively, in MCF7 ADR and MAB25 (data not shown).



View larger version (143K):
[in this window]
[in a new window]
 
Figure 6. Immunohistochemistry of xenografted tumors obtained 60 days after implantation of MCF7 ADR (A, C, E) or MAB25 bcl-2-transfected clone (B, D, F) (40 HPF, original magnification 400x). Staining with anti-VEGF antibody to examine the expression and distribution of VEGF protein (A, B). Staining with anti-CD31 antibody to examine vascular density (C, D). Fluorescence TUNEL assay (E, F) to evaluate in situ apoptosis counterstained with propidium iodide.

To evaluate whether the higher VEGF expression observed in tumors from the bcl-2 transfectants was associated with a higher vascular density compared to the parental line, we evaluated neovascularization in the tumor xenografts. Visualization of the tumor vessels using anti-CD31 mAb permitted an assessment of the vascular density of the tumors obtained 60 days after implantation in mice. Figure 6C, D shows a striking difference in the vascularization of tumors formed from the bcl-2 transfectants (panel D) compared with those from MCF7 ADR cells (panel C). Vessel counting demonstrated that all tumors formed from bcl-2 transfectants were significantly more vascular than those formed by implantation of MCF7 ADR cells (P<0.01). Thus, the number of vessels per 0.125 mm2 field was 15 ± 1.3 (mean ± SD) for MCF7 ADR cells, and 24 ± 1.5 (mean ± SD) and 25 ± 1.7 (mean ± SD) for MAB25 and MAB31, respectively. Similar results were obtained when assessing microvessel density in tumors obtained 30 days after implant, and using factor VIII-related antigen and anti-CD34 antibodies (data not shown). To determine whether differences exist in terms of apoptosis in the tumors from control and bcl-2 transfectants, in situ apoptosis was evaluated (Fig. 6E, F ). No differences in apoptosis were observed between bcl-2 (Fig. 6F ) and control (Fig. E) xenografts on day 60 after tumor implant.

Bcl-2 overexpression does not affect p53 expression
Since the p53 protein has been demonstrated to be down-regulated by bcl-2 (40) and also found to inhibit angiogenesis through down-regulation of VEGF (41 , 42) , we examined whether the increased angiogenic properties of the bcl-2-overexpressing clones were mediated by the p53 protein. The expression of p53 was evaluated by immunoblot analysis in the MCF7 ADR line, the two bcl-2 transfectants, and a control clone grown in hypoxic conditions (Fig. 7 ). Densitometric analysis revealed similar expression of the p53 protein in all the lines tested.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 7. Western blot analysis of p53 protein in the cell lysates of MCF7 ADR parental line, a control clone (MAN9), and two bcl-2 transfectants (MAB25, and MAB31) grown under hypoxic conditions for 24 h. A representative experiment is shown. The relative amounts of the transferred proteins were quantified and normalized to the corresponding HSP 72/73 protein amounts.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We previously demonstrated that bcl-2 overexpression enhances the metastatic potential of the human breast cancer line MCF7 ADR by inducing an increase of in vitro cell invasion, migration, and gelatinase production (13) .

Since growth, progression, and metastasis of breast cancer (as well as for most of the other tumors) are angiogenesis-dependent processes, the objective of this study was to determine whether the overexpression of bcl-2 could also be associated with the development or increase of the angiogenic phenotype.

Using four bcl-2 transfectants obtained after transfection of the MCF7 ADR line (13) , we demonstrated that bcl-2 overexpression substantially enhances the angiogenesis process. Because regions of low oxygen tension are a unifying feature of solid tumors, we performed in vitro experiments in hypoxic conditions in order to mimic the in vivo situation. We demonstrated an enhancement of in vitro VEGF induction under hypoxic conditions. In particular, bcl-2 overexpression induced an increase of VEGF protein secretion when cells were cultured in hypoxic conditions, which was paralleled by enhancement of mRNA for VEGF121 and VEGF165 isoforms, which are more efficiently secreted by the cells. Increased neovascularization was also found when matrigel containing supernatants of bcl-2 transfectants grown in hypoxic conditions was injected in mice and compared with that of the parental line.

Bcl-2 modulation of VEGF expression and matrigel neovascularization did not appear to be due to the ability of bcl-2 to protect cells from hypoxia-induced apoptosis, as hypoxia was not found to induce apoptosis in MCF7 ADR cells, with the apoptotic population no more than 10% of the total population (data not shown). Moreover, no differences in apoptosis were observed between bcl-2 and control xenografts.

We also demonstrated that the increased VEGF expression and matrigel neovascularization observed in hypoxic conditions occurs in tumor xenografts. Increased expression of the VEGF121 isoform and vascular density was also observed in tumors obtained after injection of bcl-2 transfectants in nude mice.

These results are consistent with a mechanism by which bcl-2 overexpression enhances metastatic potential of MCF7 ADR line; in addition to increasing the metastasis-associated properties, it also increases the tumor angiogenesis.

It is also possible that bcl-2 contribute to enhance the metastatic potential of MCF7 ADR line through alterations in energy metabolism. Bcl-2 overexpression may not only prime cells to the switch for the angiogenic phenotype, but may also facilitate their growth in the adverse and changing conditions of the tumor microenvironment by reducing energy metabolism. In fact, we recently demonstrated a lower CO2 production and oxygen consumption in bcl-2 transfectants than in the parental line (43) .

This is the first evidence indicating that bcl-2 overexpression in a cancer cell line is correlated with an enhanced in vivo angiogenic response. Our results indicate that this effect could be due to the increase of VEGF expression after bcl-2 overexpression in hypoxic conditions.

We exclude the possibility that bcl-2 could increase angiogenesis through enhancement of bFGF and TGF-ß1, two important vascular growth factors involved in the angiogenesis of breast cancer. In fact, these proteins were not detectable in the supernatants of all cell lines used in our study grown in normoxia and hypoxia.

There are several explanations for the role of bcl-2 protein in the acquisition of the angiogenic phenotype in our model system. The bcl-2 protein product could be involved in angiogenesis through several mechanisms. The possibility that bcl-2 could increase angiogenesis through down-regulation of p53 (40) and consequent up-regulation of VEGF (41) , was excluded by our studies, since we observed no modulation of p53 protein expression after bcl-2 overexpression.

We suggest that bcl-2 overexpression, which acts to increase the metastatic potential of MCF7ADR line through enhancement of in vitro cell invasion and migration and gelatinases production, can also prime cells for a switch to the angiogenic phenotype in response to low oxygen conditions. Since hypoxia represents a characteristic of solid tumors, this microenvironmental stress may provide a common signal that induces a prolonged increase in angiogenic gene expression during tumorigenesis (30) . Thus, if tumor hypoxia primes cells for increased VEGF expression, bcl-2 overexpression would provide the necessary signal to increase or maintain this state of angiogenic growth factor production.

It is also possible that a VEGF increase induced by bcl-2 in hypoxic conditions could enhance expression and/or activity of proteinases involved in the extracellular proteolytic processes. It has been demonstrated that VEGF-induced angiogenesis is accompanied by an increased urokinase receptor and plasminogen activator inhibitor expression and by urokinase-type plasminogen activator activity on the endothelial cell surface (44 , 45) . The ability of VEGF to up-regulate the expression of matrix metalloproteinases in vascular smooth muscle cells has also been demonstrated (46) .

Recently, Nor et al. (47) demonstrated that the angiogenic activity and the induction of endothelial cells survival attributed to VEGF may be due to its ability to enhance bcl-2 expression.

Further analyses to evaluate whether bcl-2 enhances the switch to the angiogenic phenotype—either modulating HIF-1, other hypoxic regulatory elements in the VEGF promoter, or the stability of VEGF mRNA—will be necessary to clarify the role of bcl-2 on angiogenesis.

A better understanding of the molecular basis of angiogenesis allows the development of new therapeutic strategies. Perhaps therapy with antiangiogenic factors or molecules able to down-regulate bcl-2 expression will be indicated in those patients having solid malignancies with high vascularization and high levels of bcl-2 protein.


   ACKNOWLEDGMENTS
 
This work was partially supported by CNR 98/05/C/4 (D.D.B.), AIRC 98/30/C/31 (G.Z.), Italy-USA Program (G.Z.), and Ministero della Sanità (D.D.B.). We thank Prof. Antonella Stoppacciaro for stimulating discussions and Mr. Giuseppe Bertini and Mrs. Luciana Masiello for technical support for the in vivo experiments. We are grateful to Mrs. Simona Righi for secretarial assistance in preparation of the manuscript, Ms. Paula Franke for reviewing the English usage, and Ms. Emilia Pediconi for technical support for the art graphic.


   FOOTNOTES
 
Received for publication May 25, 1999. Revised for publication October 22, 1999.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Adams, J. M., Cory, S. (1998) The bcl-2 protein family: arbiters of cell survival. Science 281,1322-1326[Abstract/Free Full Text]
  2. Kroemer, G. (1997) The proto-oncogene Bcl-2 and its role in regulating apoptosis. Nature Med 3,614-620[Medline]
  3. Arriola, E. L., Rodriguez-Lopez, A. M., Hickman, J. A., Chresta, C. M. (1999) Bcl-2 overexpression results in reciprocal downregulation of Bcl-XL and sensitizes human testicular germ cell tumours to chemotherapy-induced apoptosis. Oncogene 18,1457-1464[Medline]
  4. Cheng, E. H. Y., Kirsch, D. G., Clem, R. J., Ravi, R., Kastan, M. B., Bedi, A., Ueno, K., Hardwick, J. M. (1997) Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278,1966-1968[Abstract/Free Full Text]
  5. Uhlmann, E. J., Subramanian, T., Vater, C. A., Lutz, R., Chinnadurai, G. (1998) A potent cell death activity associated with transient high level expression of BCL-2. J. Biol. Chem. 273,17926-17932[Abstract/Free Full Text]
  6. Vaux, D. L., Cory, S., Adams, J. M. (1988) Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature (London) 335,440-442[Medline]
  7. Strasser, A., Harris, A. W., Cory, S. (1993) E µ-bcl-2 transgene facilitates spontaneous transformation of early pre-B and immunoglobulin-secreting cells but not T cells. Oncogene 8,1-9[Medline]
  8. Reed, J. C., Cuddy, M., Slabiaak, T., Croce, C. M., Nowell, P. (1988) Oncogenic potential of bcl-2 demonstrated by gene transfer. Nature (London) 336,259-261[Medline]
  9. Jager, R., Herzer, U., Schenkel, J., Weiher, H. (1997) Overexpression of Bcl-2 inhibits alveolar cell apoptosis during involution and accelerates c-myc-induced tumorigenesis of the mammary gland in transgenic mice. Oncogene 15,1787-1795[Medline]
  10. Uhlmann, E. J., D’Sa-Eipper, C., Subramanian, T., Wagner, A. J., Hay, N., Chinnadurai, G. (1996) Deletion of a nonconserved region of Bcl-2 confers a novel gain of function: suppression of apoptosis with concomitant cell proliferation. Cancer Res 56,2506-2509[Abstract/Free Full Text]
  11. Basolo, F., Fiore, L., Fusco, A., Giannini, R., Albini, A., Merlo, G. R., Fontanini, G., Conaldi, P. G., Toniolo, A. (1999) Potentiation of the malignant phenotype of the undifferentiated ARO thyroid cell line by insertion of the bcl-2 gene. Int. J. Cancer 81,956-962[Medline]
  12. Takaoka, A., Adachi, M., Okuda, H., Sato, S., Yawata, A., Hinoda, Y., Takayama, S., Reed, J. C., Imai, K. (1997) Anti-cell death activity promotes pulmonary metastasis of melanoma cells. Oncogene 14,2971-2977[Medline]
  13. Del Bufalo, D., Biroccio, A., Leonetti, C., Zupi, G. (1997) Bcl-2 overexpression enhances the metastatic potential of a human breast cancer line. FASEB J 11,947-953[Abstract]
  14. Folkman, J. (1986) How is blood vessel growth regulated in normal and neoplastic tissue? G. H. A. Clowes Memorial Award lecture. Cancer Res 46,467-473[Free Full Text]
  15. Gimbrone, M. A., Leapman, S. B., Cotran, R. S., Folkman, J. (1972) Tumor dormancy in vivo by prevention of neovascularization. J. Exp. Med. 136,261-276[Abstract]
  16. Fidler, I. J., Ellis, L. M. (1994) The implications of angiogenesis to the biology and therapy of cancer metastasis. Cell 79,185-188[Medline]
  17. Ellis, L. M., Fidler, I. J. (1996) Angiogenesis and metastasis. Eur. J. Cancer 32A,2451-2460
  18. Liotta, L. A., Kleinerman, J., Saidel, G. M. (1974) Quantitative relationships of intravascular tumor cells, tumor vessels, and pulmonary metastases following tumor implantation. Cancer Res 34,997-1003[Abstract/Free Full Text]
  19. Gasparini, G., Fox, S. B., Verderio, P., Bonoldi, E., Bevilacqua, P., Boracchi, P., Dante, S., Marubini, E., Harris, A. L. (1996) Determination of angiogenesis adds information to estrogen receptor status in predicting the efficacy of adjuvant tamoxifen in node-positive breast cancer patients. Clin. Cancer Res. 2,1191-1198[Abstract]
  20. Horak, E. R., Leek, R., Klenk, N., LeJeune, S., Smith, K., Stuart, N., Greenall, M., Stepniewska, K., Harris, A. L. (1992) Angiogenesis, assessed by platelet/endothelial cell adhesion molecule antibodies, as an indicator of node metastases and survival in breast cancer. Lancet 340,1120-1124[Medline]
  21. Folkman, J., Shing, Y. (1992) Angiogenesis. J. Biol. Chem. 267,10931-10934[Free Full Text]
  22. Folkman, J. (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1,27-31[Medline]
  23. Risau, W., Drexler, H., Mironov, V., Smits, A., Siegbahn, A., Funa, K., Heldin, C.-H. (1992) Platelet-derived growth factor is angiogenic in vivo. Growth Factors 7,261-266[Medline]
  24. Mukhopadhyay, D., Tsiokas, L., Zhou, X., Foster, D., Brugge, J. S., Sukhatme, V. P. (1995) Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation. Nature (London) 375,577-581[Medline]
  25. Grugel, S., Finkenzeller, G., Weindel, K., Barleon, B., Marme, D. (1995) Both v-H-ras and v-raf stimulate expression of the vascular endothelial growth factor in NIH 3T3 cells. J. Biol. Chem. 270,25915-25919[Abstract/Free Full Text]
  26. Kieser, A., Welch, H. A., Brandner, G., Marme, D., Kolch, W. (1994) Mutant p53 potentiates protein kinase C induction of vascular endothelial growth factor expression. Oncogene 9,963-969[Medline]
  27. Giaccia, A. J. (1996) Oncogenic transformation and hypoxia synergistically act to modulate vascular endothelial growth factor expression. Cancer Res 56,3436-3440[Abstract/Free Full Text]
  28. Plate, K. H., Breier, G., Weich, H. A., Risau, W. (1992) Vascular endothelial growth factor is a potential tumor angiogenesis factor in human gliomas in vivo. Nature (London) 359,845-848[Medline]
  29. Shweiki, D., Itin, A., Soffer, D., Keshet, E. (1992) Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature (London) 359,843-845[Medline]
  30. Graeber, T. G., Osmanian, C., Jacks, T., Housman, D. E., Koch, C. J., Giaccia, A. J. (1996) Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours. Nature (London) 379,88-91[Medline]
  31. Sapora, O., Barone, F., Belli, M., Maggi, A., Quintiliani, M., Tabocchini, M. A. (1991) Relationship between cell killing, mutation induction and DNA damage in X-irradiated V79 cells: influence of oxygen and DMSO. Int. J. Radiat. Biol. 60,467-482[Medline]
  32. Boocock, C. A., Charnock, D. S., Sharkey, A. M., McLaren, J., Barker, P. J., Wright, K. A., Twentyman, P. R., Smith, S. K. (1995) Expression of vascular endothelial growth factor and its receptors flt and KDR in ovarian carcinoma. J. Natl. Cancer Inst. 87,506-516[Abstract/Free Full Text]
  33. Viglietto, G., Maglione, D., Rambaldi, M., Cerutti, J., Romano, A., Trapasso, F., Fedele, M., Ippolito, P., Chiappetta, G., Botti, G., Fusco, A., Pesico, G. (1995) Upregulation of vascular endothelial growth factor (VEGF) and downregulation of placenta growth factor (PIGF) associated with malignancy in human thyroid tumors and cell lines. Oncogene 11,1569-1579[Medline]
  34. Leonetti, C., Biroccio, A., Candiloro, A., Citro, G., Fornari, C., Mottolese, M., Del Bufalo, D., Zupi, G. (1999) Increase of cisplatin sensitivity by c-myc antisense oligodeoxynucleotides in a human metastatic melanoma inherently resistant to cisplatin. Clin. Cancer Res. 5,2588-2595[Abstract/Free Full Text]
  35. Weidner, N., Semple, J. P., Welch, W. R., Folkman, J. (1991) Tumor angiogenesis and metastasis-correlation in invasive breast carcinoma. N. Engl. J. Med. 324,1-8[Abstract]
  36. Del Bufalo, D., Biroccio, A., Soddu, S., Laudonio, N., D’Angelo, C., Sacchi, A., Zupi, G. (1996) Lonidamine induces apoptosis in drug-resistant cells independently of the p53 gene. J. Clin. Invest. 98,1165-1173[Medline]
  37. Albini, A., Soldi, R., Giunciuglio, D., Giraudo, E., Benelli, R., Primo, L., Noonan, D., Salio, M., Camussi, G., Rockl, W., Bussolino, F. (1996) The angiogenesis induced by HIV-1 tat protein is mediated by the Flk-1/KDR receptor on vascular endothelial cells. Nat. Med. 2,1371-1375[Medline]
  38. Goldberg, M. A., Schneider, T. J. (1994) Similarities between the oxygen-sensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin. J. Biol. Chem. 269,4355-4361[Abstract/Free Full Text]
  39. Harris, A. L., Zhang, H., Moghddam, A., Fox, S., Scott, P., Pattison, A., Gatter, K., Stratford, I., Bicknell, R. (1996) Breast cancer angiogenesis-new approaches to therapy via antiangiogenesis, hypoxic activated drugs, and vascular targeting. Breast Cancer Res. Treat. 38,97-108[Medline]
  40. Ryan, J. J., Prochownik, E., Gottlieb, C. A., Apel, I. J., Merino, R., Nunez, G., Clarke, M. F. (1994) c-myc and bcl-2 modulate p53 function by altering p53 subcellular trafficking during the cell cycle. Proc. Natl. Acad. Sci. USA 91,5878-5882[Abstract/Free Full Text]
  41. Riccioni, T., Cirielli, C., Wang, X., Passaniti, A., Capogrossi, M. C. (1998) Adenovirus-mediated wild-type p53 overexpression inhibits endothelial cell differentiation in vitro and angiogenesis in vivo. Gene Ther 5,747-754[Medline]
  42. Bouvet, M., Ellis, L. M., Nishizaki, M., Fujiwara, T., Liu, W., Bucana, C. D., Fang, B., Lee, J. J., Roth, J. A. (1998) Adenovirus-mediated wild-type p53 gene transfer down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human colon cancer. Cancer Res 58,2288-2292[Abstract/Free Full Text]
  43. Biroccio, A., Del Bufalo, D., Fanciulli, M., Bruno, T., Zupi, G., Floridi, A. (1999) Bcl-2 inhibits mitochondrial metabolism and lonidamine-induced apoptosis in adriamycin-resistant MCF7 cells. Int. J. Cancer 82,125-130[Medline]
  44. Mandriota, S. J., Seghezzi, G., Vassalli, J.-D., Ferrara, N., Wasi, S., Mazzieri, R., Mignatti, P., Pepper, M. S. (1995) Vascular endothelial growth factor increases urokinase receptor expression in vascular endothelial cells. J. Biol. Chem. 270,9709-9716[Abstract/Free Full Text]
  45. Pepper, M. S., Montesano, R. (1990) Proteolytic balance and capillary morphogenesis. Cell Differ. Dev. 32,319-327[Medline]
  46. Wang, H., Keiser, J. A. (1998) Vascular endothelial growth factor upregulates the expression of matrix metalloproteinases in vascular smooth muscle cells: role of flt-1. Circ. Res. 83,832-840[Abstract/Free Full Text]
  47. Nör, J. E., Christensen, J., Mooney, D. J., Polverini, P. J. (1999) Vascular endothelial growth factor (VEGF)-mediated angiogenesis is associated with enhanced endothelial cell survival and induction of bcl-2 expression. Am. J. Pathol. 154,375-394[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
C. D. Curtis, V. S. Likhite, I. X. McLeod, J. R. Yates, and A. M. Nardulli
Interaction of the Tumor Metastasis Suppressor Nonmetastatic Protein 23 Homologue H1 and Estrogen Receptor {alpha} Alters Estrogen-Responsive Gene Expression
Cancer Res., November 1, 2007; 67(21): 10600 - 10607.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Kaneko, Z. Zhang, M. G. Mantellini, E. Karl, B. Zeitlin, M. Verhaegen, M. S. Soengas, M. Lingen, R. M. Strieter, G. Nunez, et al.
Bcl-2 Orchestrates a Cross-talk between Endothelial and Tumor Cells that Promotes Tumor Growth
Cancer Res., October 15, 2007; 67(20): 9685 - 9693.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Giorgini, D. Trisciuoglio, C. Gabellini, M. Desideri, L. Castellini, C. Colarossi, U. Zangemeister-Wittke, G. Zupi, and D. Del Bufalo
Modulation of bcl-xL in Tumor Cells Regulates Angiogenesis through CXCL8 Expression
Mol. Cancer Res., August 1, 2007; 5(8): 761 - 771.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Anai, S. Goodison, K. Shiverick, Y. Hirao, B. D. Brown, and C. J. Rosser
Knock-down of Bcl-2 by antisense oligodeoxynucleotides induces radiosensitization and inhibition of angiogenesis in human PC-3 prostate tumor xenografts
Mol. Cancer Ther., January 1, 2007; 6(1): 101 - 111.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Benimetskaya, K. Ayyanar, N. Kornblum, D. Castanotto, J. Rossi, S. Wu, J. Lai, B. D. Brown, N. Popova, P. Miller, et al.
Bcl-2 Protein in 518A2 Melanoma Cells In vivo and In vitro.
Clin. Cancer Res., August 15, 2006; 12(16): 4940 - 4948.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Del Bufalo, L. Ciuffreda, D. Trisciuoglio, M. Desideri, F. Cognetti, G. Zupi, and M. Milella
Antiangiogenic Potential of the Mammalian Target of Rapamycin Inhibitor Temsirolimus
Cancer Res., June 1, 2006; 66(11): 5549 - 5554.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. Trisciuoglio, A. Iervolino, G. Zupi, and D. Del Bufalo
Involvement of PI3K and MAPK Signaling in bcl-2-induced Vascular Endothelial Growth Factor Expression in Melanoma Cells
Mol. Biol. Cell, September 1, 2005; 16(9): 4153 - 4162.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Yagi, D. McBurney, and W. E. Horton Jr.
Bcl-2 Positively Regulates Sox9-dependent Chondrocyte Gene Expression by Suppressing the MEK-ERK1/2 Signaling Pathway
J. Biol. Chem., August 26, 2005; 280(34): 30517 - 30525.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Choi, K. Choi, E. N. Benveniste, Y.-S. Hong, J.-H. Lee, J. Kim, and K. Park
Bcl-2 Promotes Invasion and Lung Metastasis by Inducing Matrix Metalloproteinase-2
Cancer Res., July 1, 2005; 65(13): 5554 - 5560.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
W.-T. Chen, C.-J. Huang, M.-T. Wu, S.-F. Yang, Y.-C. Su, and C.-Y. Chai
Hypoxia-inducible Factor-1{alpha} is Associated with Risk of Aggressive Behavior and Tumor Angiogenesis in Gastrointestinal Stromal Tumor
Jpn. J. Clin. Oncol., April 1, 2005; 35(4): 207 - 213.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Milella, D. Trisciuoglio, T. Bruno, L. Ciuffreda, M. Mottolese, A. Cianciulli, F. Cognetti, U. Zangemeister-Wittke, D. Del Bufalo, and G. Zupi
Trastuzumab Down-Regulates Bcl-2 Expression and Potentiates Apoptosis Induction by Bcl-2/Bcl-XL Bispecific Antisense Oligonucleotides in HER-2Gene-Amplified Breast Cancer Cells
Clin. Cancer Res., November 15, 2004; 10(22): 7747 - 7756.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Fassina, R. Vene, M. Morini, S. Minghelli, R. Benelli, D. M. Noonan, and A. Albini
Mechanisms of Inhibition of Tumor Angiogenesis and Vascular Tumor Growth by Epigallocatechin-3-Gallate
Clin. Cancer Res., July 15, 2004; 10(14): 4865 - 4873.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Shao, S. Bao, X. Bai, C. Blanchette, R. M. Anderson, T. Dang, M. L. Gishizky, J. R. Marks, and X.-F. Wang
Acquired Expression of Periostin by Human Breast Cancers Promotes Tumor Angiogenesis through Up-Regulation of Vascular Endothelial Growth Factor Receptor 2 Expression
Mol. Cell. Biol., May 1, 2004; 24(9): 3992 - 4003.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Trisciuoglio, A. Iervolino, A. Candiloro, G. Fibbi, M. Fanciulli, U. Zangemeister-Wittke, G. Zupi, and D. Del Bufalo
bcl-2 Induction of Urokinase Plasminogen Activator Receptor Expression in Human Cancer Cells through Sp1 Activation: INVOLVEMENT OF ERK1/ERK2 ACTIVITY
J. Biol. Chem., February 20, 2004; 279(8): 6737 - 6745.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Tortora, R. Caputo, V. Damiano, R. Caputo, T. Troiani, B. M. Veneziani, S. De Placido, A. R. Bianco, U. Zangemeister-Wittke, and F. Ciardiello
Combined Targeted Inhibition of bcl-2, bcl-XL, Epidermal Growth Factor Receptor, and Protein Kinase A Type I Causes Potent Antitumor, Apoptotic, and Antiangiogenic Activity
Clin. Cancer Res., February 1, 2003; 9(2): 866 - 871.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.