| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Experimental Chemotherapy Laboratory, Regina Elena Cancer Institute, Rome, Italy;
Pathology Department, Regina Elena Cancer Institute, Rome; Italy;
Comparative Toxicology Laboratory, Istituto Superiore di Sanità, Rome; Italy; and
§ Advanced Biotechnology Center, National Institute for Research on Cancer, Genova, Italy
1Correspondence: Experimental Chemotherapy Lab., Regina Elena Cancer Institute, Via delle Messi d’Oro N.156, 00158 Rome, Italy. E-mail: delbufalo{at}ifo.it
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: in vivo matrigel assay • MCF7 ADR • metastasis
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. This family of proteins has been
demonstrated to regulate apoptosis in response to chemotherapy both
in vitro and in vivo (2)
. Even
though several studies have indicated bcl-2 may not always function as
a suppressor of apoptosis (3
4
5)
, enforced overexpression
of bcl-2 has been demonstrated to block or delay apoptosis and to
provide a true survival advantage after diverse stimuli such as
chemotherapeutic agents (2)
. With the discovery of the
antiapoptotic function of the bcl-2 oncogene (6)
, the
concept emerged that an elevated threshold for apoptosis represents a
central step in tumorigenesis (7)
. The oncogenic potential
of bcl-2 has been demonstrated in NIH3T3 cells (8)
and
verified in bcl-2 transgenic mice (7)
. Synergy between
bcl-2 and myc in tumorigenesis, first noted in vitro
(6)
, has been demonstrated for lymphoma and breast cancer
in bitransgenic mice (9)
. Under the limiting growth
conditions present in vivo, bcl-2 overexpression encourages
the cell cycle exit into quiescence, as well as survival
(10)
. Potentiation of the malignant phenotype of the
undifferentiated thyroid tumor cells by insertion of the bcl-2 gene has
also been demonstrated (11)
. In addition, a role for bcl-2
in tumor metastasis has been found. Takaoka et al. and our group
(12
, 13)
have recently demonstrated the ability of bcl-2
overexpression to enhance the metastatic potential of murine and human
tumors. In particular, we demonstrated that bcl-2 overexpression
enhances both tumorigenicity and metastatic potential of the MCF7 ADR
human breast cancer cell line resistant to adriamycin (ADR) by inducing
metastasis-associated properties such as in vitro invasion
and migration (13)
. To consider whether other mechanisms
may explain the effect of bcl-2 transfection on MCF7 ADR metastatic
ability, the objective of this study was to evaluate whether the
overexpression of bcl-2 can be associated with the angiogenic process.
It is now well known that angiogenesis, the process leading to the
formation of new blood vessels, plays a central role in the growth of
both primary and metastatic tumors (14)
. So far, no
studies evaluating the role of bcl-2 on angiogenesis have been
performed. Rapid primary tumor growth and local invasiveness generally
accompany the switch from the avascular to the vascular phase.
Furthermore, angiogenesis is necessary at both the beginning and the
end of the development of distant metastasis, and is implicated in the
phenomenon of dormant metastases (15
16
17)
. The increase in
vasculature enhances the probability of tumor cells entering the
circulation and may give rise to metastasis (18)
. In
addition, angiogenesis index is a useful prognostic factor in
early-stage breast cancer (19
, 20)
. The switch to the
angiogenic phenotype is strongly associated with increased expression
of angiogenic-promoting cytokines such as tumor necrosis 
and growth
factor mitogens such as fibroblast growth factor, platelet-derived
growth factor, and vascular endothelial growth factor (VEGF)
(21
22
23)
. Among these, VEGF is one of the most important
factors involved in the angiogenesis of breast cancer
(21)
. Previous studies have demonstrated that oncogenic
transformation with activated forms of the Src, Ras, and Raf-1
oncogenes and the loss of the wild-type p53 tumor suppressor gene could
increase the expression of VEGF, suggesting a link between
tumorigenesis and angiogenesis (24
25
26
27)
. Studies have
shown that hypoxia is also a potent activator of VEGF and many
proangiogenic mitogens (28
, 29)
. Thus, if oncogenes and
antioncogenes prime cells for increased VEGF expression, tumor hypoxia
would provide the necessary signal to increase or maintain this state
of angiogenic growth factor production. A recent study has indicated
that the oncogene activation observed during tumor development and the
tumor microenvironment play critical and perhaps synergistic roles in
regulating cell viability (30)
.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The
tumor lines were maintained in RPMI 1640 medium containing 10 µM ADR
and supplemented with 10% fetal calf serum, 2 mM L-glutamine, and
antibiotics in a humidified atmosphere with 5%
CO2 at 37°C. The cells were grown for 2 wk in
drug-free medium prior to each experiment.
Hypoxic treatment
Cells were seeded at 1 x 106
cells/60 mm in tissue culture glass dishes and grown for 24 h in
complete medium. Then medium was removed, cells were washed with
phosphate-buffered saline, and serum-free medium was added. The cells
were cultured in a humidified atmosphere with 95% air/5%
CO2 (normoxia) or incubated in specially designed
aluminum chambers flushed with a gas mixture containing 5%
CO2 and 95% N2 (hypoxia,
ref 31
). After 24 h, cell supernatants were
collected, centrifuged at 14,000 rpm for 10 min, and stored at
-80°C. Concomitantly cells were harvested, counted, and used for
total RNA extraction.
ELISA, RT-PCR, and Northern blot analysis
The amount of VEGF protein in the supernatant was determined
with an ELISA kit (R & D Systems, Minneapolis, Minn.) according to the
manufacturer’s instructions. The sensitivity of the VEGF assay was
31.2 pg/ml.
The levels of VEGF mRNA were determined by reverse
transcriptase-polymerase chain reaction (RT-PCR). Total RNA was
isolated by Trizol (Life Technologies, Inc.-BRL, Gaithersburg, Md.),
following standard protocol, and quantified spectrophotometrically.
First-strand cDNA synthesis and amplification of specific DNA sequence
were performed according to the manufacturer’s instructions (GeneAmp,
RNA PCR Kit, Perkin Elmer Cetus, Emeryville, Calif.). Briefly, 1 µg
of total RNA was used for cDNA synthesis using oligo(dT) primer in the
presence of Moloney murine leukemia virus reverse transcriptase. cDNA
encoding VEGF was amplified for 25 cycles (95°C for 30 s, 60°C
for 30 s, and 72°C for 30 s). The following primers were
used: 5' GGCTCTAGATCGGGCCTCCGAAACCAT 3' (forward, base -16 to +2 in
exon 1); 5' GGCTCTAGAGCGCAGAGTCTCCTCTTC 3' (reverse, bases 804 to 821
in the 3' untranslated region) as described by Boocock et al.
(32)
. Expression of GAPDH was used as an internal standard
for RNA loading. Experiments were repeated three times.
Northern blot analysis was performed after 24 h of hypoxia for
MCF7 ADR cells and bcl-2 transfectants. Total RNA (30 µg) was
size-fractionated on denaturing formaldhyde agarose gel, blotted onto
nylon filters, and hybridized with a 600 bp fragment of the plasmid
specific for human VEGF (kindly provided by Dr. G. Persico; ref
33
). Filters were exposed to autoradiographic film for 7
days.
Xenograft experiments and immunohistochemistry
MCF7 ADR line, a control clone, and two bcl-2-overexpressing
clones were injected in nude mice as described previously
(13)
. Animals were killed 30 and 60 days after tumor
implantation; the tumors were weighed and processed for Western blot
and immunohistochemical analysis of VEGF expression,
neovascularization, and TUNEL assay. VEGF expression was analyzed on
paraffin sections stained with anti-VEGF monoclonal antibody (mAb)
(C-1, Santa Cruz Biotechnology, Santa Cruz, Calif.), whereas the mouse
tumor vasculature was examined on frozen sections stained with a rat
anti-mouse CD31 antibody, (MEC 13.3, gift from Prof. Alberto Mantovani,
Istituto di Ricerche Farmacologiche Mario Negri, Milan, Italy). Frozen
and paraffin sections were processed with a three-step streptavidin
biotin immunoperoxidase staining system (LSAB kit, Dako, Milan, Italy).
The enzymatic activity was developed using 3-amino-9-ethylcarbazole
(Dako) as chromogenic substrate. After counterstaining with Mayer
hematoxylin, sections were mounted in aqueous mounting medium
(Glycergel, Dako). Negative controls consisted of parallel sections in
which the primary antibody was omitted. The immunohistochemical
detection of apoptosis in formalin-fixed, paraffin-embedded tumor
tissues was performed by TUNEL assay (in situ cell death
detection kit, fluorescein; Boehringer Mannheim, Milan, Italy) as
previously reported (34)
.
Assessment of microvessel density
The method of Weidner et al. (35)
, partially
modified, was used to measure intratumoral microvessel density. All
blood vessels were highlighted by staining endothelial cells for CD31
using a standard immunoperoxidase technique (described above). Any
brown-stained endothelial cell or endothelial cell cluster, clearly
separate from adjacent microvessels and tumor cells, was considered a
single, countable microvessel. Since the size of frozen tumor biopsy
was small, the microvessel density was determined by counting the
immunohistochemically stained endothelial cells in all the cryostat
sections. Vascular counts were estimated using an eyepiece graticule at
high-power fields (HPF: 400x magnification). At this magnification,
the graticule covered an area of 0.125 mm2. The
average number of microvessels in all the fields scanned at HPF by two
observers was calculated, taking into account three independent
experiments.
Western blotting
The expression of p53 protein in cell lysates was evaluated by
Western blot as previously reported (36)
. For analysis of
VEGF protein expression in xenografted tumors, 100 mg of homogenized
tumor was incubated at 4°C for 30 min in lysis buffer with ionic
detergent (2% sodium dodecyl sulfate; 20 mM Tris pH 8.0; 2 mM PMSF).
Total proteins (60 µg) were loaded from each sample and separated on
a 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis in
nonreducing conditions. Anti-VEGF mAb (VEGF Ab-3, clone 14–124,
Calbiochem, Cambridge, Mass.), which recognizes the four isoforms of
VEGF (121, 165, 189, 206 amino acid residues long), was
used at 1:500 dilution.
To check the amount of proteins transferred to nitrocellulose membrane, heat shock protein (HSP) was used as control and detected by an anti-human HSP 72/73 mAb (Ab-1, clone W27, Calbiochem). The relative amounts of the transferred proteins were quantified by scanning the autoradiographic films with a gel densitometer scanner (Bio-Rad, Milan, Italy) and normalized to the related HSP 72/73 amounts. Western blot analysis was performed in three different experiments.
In vivo matrigel assay
To evaluate the ability of bcl-2 to modulate the
neovascularization within matrigel plugs containing heparin, the method
described by Albini et al. was used (37)
. Briefly, cell
supernatants were concentrated 10X with Centricon-3 concentrators
(Amicon, Danvers, Mass). Matrigel (600 µl) (Collaborative Research,
Becton Dickinson, Bedford, Mass.) supplemented with heparin (19.2 U,
Schwarz Pharma S.p.A., Milan, Italy) and 60 µl of supernatant
concentrated were injected subcutaneously (s.c.) into the flank of
8-wk-old C57BL/6 mice (furnished by the Animal Care Unit of Regina
Elena Cancer Institute, Rome), where it rapidly forms a gel. Within
days, cells from the surrounding tissues migrate into the matrigel and
formed vascular structures connected to the mouse blood vessels. After
5 days, the angiogenic response was evaluated by macroscopic analysis
at autopsy, and by measurement of the hemoglobin content into the
pellet of matrigel. Hemoglobin was mechanically extracted from the
pellets in water and measured using the Drabkin method by
spectrophotometrical analysis (Sigma, Chemical Co., St Louis, Mo.). The
values were expressed as optical density/100 mg matrigel. Each group
consisted of four animals. The experiments were repeated four times.
Statistical analysis
A two-sample t test was performed to compare VEGF
protein secretion in cell lines exposed under various conditions,
hemoglobin content into matrigel plug, and vessel density within
tumors.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 22)
. To investigate whether the
transfection of MCF7 ADR cells with a bcl-2 expression vector modulates
the in vitro secretion of VEGF protein, we compared the
levels of VEGF protein in the supernatants of the parental line (MCF7
ADR), a control clone (MAN9), and 4 bcl-2 transfectants (MAB25, MAB26,
MAB27, MAB31). The conditioned medium of the cells was collected
24 h after serum deprivation, and VEGF protein levels were
determined (Fig. 1
). The mean ± SD of the VEGF protein was
40 ± 2 pg/106 cells/24 h in the MCF7 ADR
parental line. No significant increase in VEGF secretion was found in
the bcl-2 transfectants (the VEGF protein ranged from 50±3 to 60±5
pg/106 cells/24 h for the different clones
(P>0.05).
|
Since hypoxia is the most potent activator of VEGF and solid tumors
grow in lowered oxygen pressure (28
, 29
, 38)
, in order to
mimic the in vivo situation, VEGF secretion was also
evaluated 24 h after exposure to hypoxic conditions. As
demonstrated in several tumor histotypes (28
, 38)
, hypoxia
increased secretion of VEGF in all the lines. In particular, MCF7 ADR
parental line and the control clone show about a threefold increase in
the steady-state expression of VEGF after 24 h exposure to hypoxia
(Fig. 1)
. Bcl-2 transfectants at the same experimental conditions
exhibited an eightfold induction of VEGF secretion compared to the
bcl-2 transfectants grown in normoxia. The statistical analysis
demonstrated a significant difference in VEGF secretion between control
lines and bcl-2 transfectants grown in hypoxia (P<0.01).
cDNA sequence analysis of a variety of human VEGF had indicated that
VEGF may exist as one of four different molecular species
(21)
. To analyze whether bcl-2 transfection is able to
modulate the expression of different VEGF isoforms, VEGF mRNA levels
were determined by RT-PCR. MCF7 ADR cells, MAN9 control clone and two
representative bcl-2 transfectants (MAB25 and MAB31) were analyzed. As
reported in Fig. 2
, amplification in normoxia of VEGF cDNA with VEGF-specific primers
generated similar levels of VEGF121 isoform in
all the lines tested. VEGF165,
VEGF189, and VEGF206
isoforms were not detectable in the experimental conditions used. After
24 h hypoxic exposure, we found that the level of the
VEGF121 isoform was higher in the
bcl-2-overexpressing clones than in the parental line (~sixfold).
Moreover, appreciable levels of VEGF165 isoform
in both bcl-2 clones were detected, while no bands corresponding to
this isoform were evident either in MCF7 ADR parental or
neo-transfected lines. To confirm the increased VEGF mRNA production
observed by RT-PCR in bcl-2 transfectants, Northern blot analysis of
VEGF mRNA was performed (Fig. 3
). After 24 h of hypoxic exposure, MCF7 ADR parental line and MAN9
control clone do not express detectable levels of VEGF specific
transcript. Interestingly, VEGF mRNA expression is clearly evident in
both bcl-2 transfectants at the same experimental conditions.
|
|
Since breast cancer cell lines and primary human breast tumors express
a wide range of vascular growth factors (39)
, we evaluated
whether the overexpression of bcl-2 was also able to modulate the
expression of basic fibroblast growth factor (bFGF) and tumor growth
factor beta 1 (TGF-ß1), two important molecules involved in the
angiogenesis of breast tumor. Neither of the proteins were detected in
the conditioned media of all the clones grown in normoxia and hypoxia
(data not shown). The sensitivity of the bFGF assay was 30 pg/ml, while
that of TGF-ß1 was 10 pg/ml.
Bcl-2 increases angiogenesis in vivo
To evaluate whether the increase in VEGF secretion induced by
bcl-2 in hypoxic conditions was associated with an increase in the
angiogenic process, an in vivo angiogenesis assay was
performed. Matrigel plugs containing the different cell supernatants
were injected s.c. in mice and the degree of vascularization into
matrigel plugs evaluated after 5 days (Fig. 4
). Supernatants of the MAN9 control clone show only a slight angiogenic
response (Fig. 4A
). In contrast, supernatants of the bcl-2
transfectants showed a stronger angiogenic response as compared with
the response seen by macroscopic analysis in the MAN9 control clone.
Quantification of the angiogenic response by determination of the
hemoglobin content in the matrigel plugs demonstrated that the matrigel
plugs containing bcl-2-transfected cell supernatants had a
significantly higher (three- to sixfold, P<0.001) level of
vascularization (Fig. 4B
) than those containing the MAN9
control supernatants. The MCF7 ADR parental line showed a similar
angiogenic response in vivo as the MAN9 clone (data not
shown).
|
Bcl-2 overexpression increases VEGF expression and vessel density
in tumors
Since low pressure of oxygen is a feature of solid tumors, we
evaluated whether bcl-2 overexpression is able to modulate VEGF
expression in tumor xenografts. The VEGF expression was first analyzed
by Western blot. We found an increased level of VEGF protein expression
in tumors formed by four bcl-2-overexpressing clones as compared to
tumors of the MAN9 control and MCF7 ADR parental cell lines (Fig. 5
). Quantitative analysis of VEGF signal after normalization to HSP
reveals that the MAB25, MAB31, MAB26, and MAB27 bcl-2-overexpressing
clones showed very high levels of the VEGF121
isoform, while this isoform was not detectable in the control clone. No
significant differences in the expression of the
VEGF165 isoform were observed between the four
lines. The expression of VEGF isoforms in MCF7 ADR tumors was similar
to that of the MAN9 control clone (data not shown).
|
To analyze the tissue distribution of VEGF, we performed an
immunohistochemical staining of tumors obtained injecting MCF7 ADR,
MAN9, MAB25, and MAB31 lines in nude mice. Figure 6
shows VEGF expression in MCF7 ADR line (panel A) and MAB25
clone (panel B). The intensity of VEGF staining was
significantly higher and more homogeneous in the tumor originating from
the bcl-2-overexpressing clone than in the tumor obtained from the
parental line. The immunohistochemical staining appeared confined in
both the plasma membrane and the cytoplasm of tumor cells, indicating
that cells synthesize VEGF protein. MAN9 and MAB31 showed a VEGF
expression similar to that observed, respectively, in MCF7 ADR and
MAB25 (data not shown).
|
To evaluate whether the higher VEGF expression observed in tumors from
the bcl-2 transfectants was associated with a higher vascular density
compared to the parental line, we evaluated neovascularization in the
tumor xenografts. Visualization of the tumor vessels using anti-CD31
mAb permitted an assessment of the vascular density of the tumors
obtained 60 days after implantation in mice. Figure 6C, D
shows a striking difference in the vascularization of tumors formed
from the bcl-2 transfectants (panel D) compared with those
from MCF7 ADR cells (panel C). Vessel counting demonstrated
that all tumors formed from bcl-2 transfectants were significantly more
vascular than those formed by implantation of MCF7 ADR cells
(P<0.01). Thus, the number of vessels per 0.125
mm2 field was 15 ± 1.3 (mean ±
SD) for MCF7 ADR cells, and 24 ± 1.5 (mean
± SD) and 25 ± 1.7 (mean ±
SD) for MAB25 and MAB31, respectively. Similar
results were obtained when assessing microvessel density in tumors
obtained 30 days after implant, and using factor VIII-related antigen
and anti-CD34 antibodies (data not shown). To determine whether
differences exist in terms of apoptosis in the tumors from control and
bcl-2 transfectants, in situ apoptosis was evaluated (Fig. 6E, F
). No differences in apoptosis were observed
between bcl-2 (Fig. 6F
) and control (Fig. E)
xenografts on day 60 after tumor implant.
Bcl-2 overexpression does not affect p53 expression
Since the p53 protein has been demonstrated to be down-regulated
by bcl-2 (40)
and also found to inhibit angiogenesis
through down-regulation of VEGF (41
, 42)
, we examined
whether the increased angiogenic properties of the bcl-2-overexpressing
clones were mediated by the p53 protein. The expression of p53 was
evaluated by immunoblot analysis in the MCF7 ADR line, the two bcl-2
transfectants, and a control clone grown in hypoxic conditions
(Fig. 7
). Densitometric analysis revealed similar expression of the p53 protein
in all the lines tested.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Since growth, progression, and metastasis of breast cancer (as well as for most of the other tumors) are angiogenesis-dependent processes, the objective of this study was to determine whether the overexpression of bcl-2 could also be associated with the development or increase of the angiogenic phenotype.
Using four bcl-2 transfectants obtained after transfection of the MCF7
ADR line (13)
, we demonstrated that bcl-2 overexpression
substantially enhances the angiogenesis process. Because regions of low
oxygen tension are a unifying feature of solid tumors, we performed
in vitro experiments in hypoxic conditions in order to mimic
the in vivo situation. We demonstrated an enhancement of
in vitro VEGF induction under hypoxic conditions. In
particular, bcl-2 overexpression induced an increase of VEGF protein
secretion when cells were cultured in hypoxic conditions, which was
paralleled by enhancement of mRNA for VEGF121 and
VEGF165 isoforms, which are more efficiently
secreted by the cells. Increased neovascularization was also found when
matrigel containing supernatants of bcl-2 transfectants grown in
hypoxic conditions was injected in mice and compared with that of the
parental line.
Bcl-2 modulation of VEGF expression and matrigel neovascularization did not appear to be due to the ability of bcl-2 to protect cells from hypoxia-induced apoptosis, as hypoxia was not found to induce apoptosis in MCF7 ADR cells, with the apoptotic population no more than 10% of the total population (data not shown). Moreover, no differences in apoptosis were observed between bcl-2 and control xenografts.
We also demonstrated that the increased VEGF expression and matrigel neovascularization observed in hypoxic conditions occurs in tumor xenografts. Increased expression of the VEGF121 isoform and vascular density was also observed in tumors obtained after injection of bcl-2 transfectants in nude mice.
These results are consistent with a mechanism by which bcl-2 overexpression enhances metastatic potential of MCF7 ADR line; in addition to increasing the metastasis-associated properties, it also increases the tumor angiogenesis.
It is also possible that bcl-2 contribute to enhance the metastatic
potential of MCF7 ADR line through alterations in energy metabolism.
Bcl-2 overexpression may not only prime cells to the switch for the
angiogenic phenotype, but may also facilitate their growth in the
adverse and changing conditions of the tumor microenvironment by
reducing energy metabolism. In fact, we recently demonstrated a lower
CO2 production and oxygen consumption in bcl-2
transfectants than in the parental line (43)
.
This is the first evidence indicating that bcl-2 overexpression in a cancer cell line is correlated with an enhanced in vivo angiogenic response. Our results indicate that this effect could be due to the increase of VEGF expression after bcl-2 overexpression in hypoxic conditions.
We exclude the possibility that bcl-2 could increase angiogenesis through enhancement of bFGF and TGF-ß1, two important vascular growth factors involved in the angiogenesis of breast cancer. In fact, these proteins were not detectable in the supernatants of all cell lines used in our study grown in normoxia and hypoxia.
There are several explanations for the role of bcl-2 protein in the
acquisition of the angiogenic phenotype in our model system. The bcl-2
protein product could be involved in angiogenesis through several
mechanisms. The possibility that bcl-2 could increase angiogenesis
through down-regulation of p53 (40)
and consequent
up-regulation of VEGF (41)
, was excluded by our studies,
since we observed no modulation of p53 protein expression after bcl-2
overexpression.
We suggest that bcl-2 overexpression, which acts to increase the
metastatic potential of MCF7ADR line through enhancement of in
vitro cell invasion and migration and gelatinases production, can
also prime cells for a switch to the angiogenic phenotype in response
to low oxygen conditions. Since hypoxia represents a characteristic of
solid tumors, this microenvironmental stress may provide a common
signal that induces a prolonged increase in angiogenic gene expression
during tumorigenesis (30)
. Thus, if tumor hypoxia primes
cells for increased VEGF expression, bcl-2 overexpression would provide
the necessary signal to increase or maintain this state of angiogenic
growth factor production.
It is also possible that a VEGF increase induced by bcl-2 in hypoxic
conditions could enhance expression and/or activity of proteinases
involved in the extracellular proteolytic processes. It has been
demonstrated that VEGF-induced angiogenesis is accompanied by an
increased urokinase receptor and plasminogen activator inhibitor
expression and by urokinase-type plasminogen activator activity on the
endothelial cell surface (44
, 45)
. The ability of VEGF to
up-regulate the expression of matrix metalloproteinases in vascular
smooth muscle cells has also been demonstrated (46)
.
Recently, Nor et al. (47)
demonstrated that the angiogenic
activity and the induction of endothelial cells survival attributed to
VEGF may be due to its ability to enhance bcl-2 expression.
Further analyses to evaluate whether bcl-2 enhances the switch to the angiogenic phenotype—either modulating HIF-1, other hypoxic regulatory elements in the VEGF promoter, or the stability of VEGF mRNA—will be necessary to clarify the role of bcl-2 on angiogenesis.
A better understanding of the molecular basis of angiogenesis allows the development of new therapeutic strategies. Perhaps therapy with antiangiogenic factors or molecules able to down-regulate bcl-2 expression will be indicated in those patients having solid malignancies with high vascularization and high levels of bcl-2 protein.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  N. Sasi, M. Hwang, J. Jaboin, I. Csiki, and B. Lu Regulated cell death pathways: New twists in modulation of BCL2 family function Mol. Cancer Ther., June 1, 2009; 8(6): 1421 - 1429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. D. Zeitlin, I. J. Zeitlin, and J. E. Nor Expanding Circle of Inhibition: Small-Molecule Inhibitors of Bcl-2 as Anticancer Cell and Antiangiogenic Agents J. Clin. Oncol., September 1, 2008; 26(25): 4180 - 4188. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. D. Curtis, V. S. Likhite, I. X. McLeod, J. R. Yates, and A. M. Nardulli Interaction of the Tumor Metastasis Suppressor Nonmetastatic Protein 23 Homologue H1 and Estrogen Receptor {alpha} Alters Estrogen-Responsive Gene Expression Cancer Res., November 1, 2007; 67(21): 10600 - 10607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kaneko, Z. Zhang, M. G. Mantellini, E. Karl, B. Zeitlin, M. Verhaegen, M. S. Soengas, M. Lingen, R. M. Strieter, G. Nunez, et al. Bcl-2 Orchestrates a Cross-talk between Endothelial and Tumor Cells that Promotes Tumor Growth Cancer Res., October 15, 2007; 67(20): 9685 - 9693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Giorgini, D. Trisciuoglio, C. Gabellini, M. Desideri, L. Castellini, C. Colarossi, U. Zangemeister-Wittke, G. Zupi, and D. Del Bufalo Modulation of bcl-xL in Tumor Cells Regulates Angiogenesis through CXCL8 Expression Mol. Cancer Res., August 1, 2007; 5(8): 761 - 771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Anai, S. Goodison, K. Shiverick, Y. Hirao, B. D. Brown, and C. J. Rosser Knock-down of Bcl-2 by antisense oligodeoxynucleotides induces radiosensitization and inhibition of angiogenesis in human PC-3 prostate tumor xenografts Mol. Cancer Ther., January 1, 2007; 6(1): 101 - 111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Benimetskaya, K. Ayyanar, N. Kornblum, D. Castanotto, J. Rossi, S. Wu, J. Lai, B. D. Brown, N. Popova, P. Miller, et al. Bcl-2 Protein in 518A2 Melanoma Cells In vivo and In vitro. Clin. Cancer Res., August 15, 2006; 12(16): 4940 - 4948. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Del Bufalo, L. Ciuffreda, D. Trisciuoglio, M. Desideri, F. Cognetti, G. Zupi, and M. Milella Antiangiogenic Potential of the Mammalian Target of Rapamycin Inhibitor Temsirolimus Cancer Res., June 1, 2006; 66(11): 5549 - 5554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Trisciuoglio, A. Iervolino, G. Zupi, and D. Del Bufalo Involvement of PI3K and MAPK Signaling in bcl-2-induced Vascular Endothelial Growth Factor Expression in Melanoma Cells Mol. Biol. Cell, September 1, 2005; 16(9): 4153 - 4162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Yagi, D. McBurney, and W. E. Horton Jr. Bcl-2 Positively Regulates Sox9-dependent Chondrocyte Gene Expression by Suppressing the MEK-ERK1/2 Signaling Pathway J. Biol. Chem., August 26, 2005; 280(34): 30517 - 30525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Choi, K. Choi, E. N. Benveniste, Y.-S. Hong, J.-H. Lee, J. Kim, and K. Park Bcl-2 Promotes Invasion and Lung Metastasis by Inducing Matrix Metalloproteinase-2 Cancer Res., July 1, 2005; 65(13): 5554 - 5560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-T. Chen, C.-J. Huang, M.-T. Wu, S.-F. Yang, Y.-C. Su, and C.-Y. Chai Hypoxia-inducible Factor-1{alpha} is Associated with Risk of Aggressive Behavior and Tumor Angiogenesis in Gastrointestinal Stromal Tumor Jpn. J. Clin. Oncol., April 1, 2005; 35(4): 207 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Milella, D. Trisciuoglio, T. Bruno, L. Ciuffreda, M. Mottolese, A. Cianciulli, F. Cognetti, U. Zangemeister-Wittke, D. Del Bufalo, and G. Zupi Trastuzumab Down-Regulates Bcl-2 Expression and Potentiates Apoptosis Induction by Bcl-2/Bcl-XL Bispecific Antisense Oligonucleotides in HER-2Gene-Amplified Breast Cancer Cells Clin. Cancer Res., November 15, 2004; 10(22): 7747 - 7756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Fassina, R. Vene, M. Morini, S. Minghelli, R. Benelli, D. M. Noonan, and A. Albini Mechanisms of Inhibition of Tumor Angiogenesis and Vascular Tumor Growth by Epigallocatechin-3-Gallate Clin. Cancer Res., July 15, 2004; 10(14): 4865 - 4873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Shao, S. Bao, X. Bai, C. Blanchette, R. M. Anderson, T. Dang, M. L. Gishizky, J. R. Marks, and X.-F. Wang Acquired Expression of Periostin by Human Breast Cancers Promotes Tumor Angiogenesis through Up-Regulation of Vascular Endothelial Growth Factor Receptor 2 Expression Mol. Cell. Biol., May 1, 2004; 24(9): 3992 - 4003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Trisciuoglio, A. Iervolino, A. Candiloro, G. Fibbi, M. Fanciulli, U. Zangemeister-Wittke, G. Zupi, and D. Del Bufalo bcl-2 Induction of Urokinase Plasminogen Activator Receptor Expression in Human Cancer Cells through Sp1 Activation: INVOLVEMENT OF ERK1/ERK2 ACTIVITY J. Biol. Chem., February 20, 2004; 279(8): 6737 - 6745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Tortora, R. Caputo, V. Damiano, R. Caputo, T. Troiani, B. M. Veneziani, S. De Placido, A. R. Bianco, U. Zangemeister-Wittke, and F. Ciardiello Combined Targeted Inhibition of bcl-2, bcl-XL, Epidermal Growth Factor Receptor, and Protein Kinase A Type I Causes Potent Antitumor, Apoptotic, and Antiangiogenic Activity Clin. Cancer Res., February 1, 2003; 9(2): 866 - 871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bottini, A. Berruti, A. Bersiga, M. P. Brizzi, G. Allevi, G. Bolsi, S. Aguggini, A. Brunelli, E. Betri, D. Generali, et al. Changes in Microvessel Density As Assessed by CD34 Antibodies after Primary Chemotherapy in Human Breast Cancer Clin. Cancer Res., June 1, 2002; 8(6): 1816 - 1821. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Ciardiello and G. Tortora Inhibition of bcl-2 as cancer therapy Ann. Onc., April 1, 2002; 13(4): 501 - 502. [Full Text] [PDF]
|
|
|
|
|
|
A. J. Guidi, D. A. Berry, G. Broadwater, B. Helmchen, I. J. Bleiweiss, D. R. Budman, I. C. Henderson, L. Norton, and D. F. Hayes Association of Angiogenesis and Disease Outcome in Node-Positive Breast Cancer Patients Treated With Adjuvant Cyclophosphamide, Doxorubicin, and Fluorouracil: A Cancer and Leukemia Group B Correlative Science Study From Protocols 8541/8869 J. Clin. Oncol., February 1, 2002; 20(3): 732 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Nör, J. Christensen, J. Liu, M. Peters, D. J. Mooney, R. M. Strieter, and P. J. Polverini Up-Regulation of Bcl-2 in Microvascular Endothelial Cells Enhances Intratumoral Angiogenesis and Accelerates Tumor Growth Cancer Res., March 1, 2001; 61(5): 2183 - 2188. [Abstract] [Full Text]
|
|
|
|
|
|
K. Inoue, J. W. Slaton, T. Karashima, C. Yoshikawa, T. Shuin, P. Sweeney, R. Millikan, and C. P. N. Dinney The Prognostic Value of Angiogenesis Factor Expression for Predicting Recurrence and Metastasis of Bladder Cancer after Neoadjuvant Chemotherapy and Radical Cystectomy Clin. Cancer Res., December 1, 2000; 6(12): 4866 - 4873. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
