FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GOLDMAN, E.
Right arrow Articles by MANDECKI, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GOLDMAN, E.
Right arrow Articles by MANDECKI, W.
(The FASEB Journal. 2000;14:603-611.)
© 2000 FASEB

Efficiencies of translation in three reading frames of unusual non-ORF sequences isolated from phage display

EMANUEL GOLDMAN*1, MALGORZATA KORUS* and WLODEK MANDECKI{dagger}

* Department of Microbiology, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey 07103, USA; and
{dagger} PharmaSeq, Inc., Monmouth Junction, New Jersey 08852, USA

1Correspondence: Department of Microbiology, New Jersey Medical School, University of Medicine & Dentistry of New Jersey, 185 South Orange Ave., Newark, NJ 07103, USA. E-mail: egoldman{at}umdnj.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
An unusual nucleotide sequence, called H10, was previously isolated by biopanning with a random peptide library on filamentous phage. The sequence encoded a peptide that bound to the growth hormone binding protein. Despite the fact that the H10 sequence can be expressed in Escherichia coli as a fusion to the gene III minor coat protein of the M13 phage, the sequence contained two TGA stop codons in the zero frame. Several mutant derivatives of the H10 sequence carried not only a stop codon, but also showed frameshifts, either +1 or -1 in individual isolates, between the H10 start and the gene III sequences. In this work, we have subcloned the H10 sequence and three of its derivatives (one requiring a +1 reading frameshift for expression, one requiring a -1 reading frameshift, and one open reading frame) in gene fusions to a reporter ß-galactosidase gene. These sequences have been cloned in all three reading frames relative to the reporter. The non-open reading frame constructs gave (surprisingly) high expression of the reporter (10–40% of control vector expression levels) in two out of the three frames. A site-directed mutant of the TGA stop codon (to TTA) in the +1 shifter greatly reduced the frameshift and gave expression primarily in the zero frame. By contrast, a site-directed mutant of the TGA in the -1 shifter had little effect on the pattern of expression, and alteration of the first TGA (of two) in H10 itself paradoxically reduced expression by half. We believe these phenomena to reflect a translational recoding mechanism in which ribosomes switch reading frames or read past stop codons upon encountering a signal encoded in the nucleotide sequence of the mRNA, because both the open reading frame derivative (which has six nucleotide changes from parental H10) and the site-directed mutant of the +1 shifter, primarily expressed the reporter only in the zero frame.—Goldman, E., Korus, M., Mandecki, W. Efficiencies of translation in three reading frames of unusual non-ORF sequences isolated from phage display.


Key Words: E. coli protein synthesis • recoding • programmed translational frameshifts • readthrough of UGA codons


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
THE INITIAL PRESUMPTION in considering DNA sequences for expression potential is the requirement for an open reading frame (ORF), starting with a methionine codon and ending with one of the three canonical stop codons. This presumption has had to be continually modified through the years, with discoveries such as intervening sequences, which required post-transcriptional splicing of mRNA (1) and more recent discoveries of RNA editing (reviewed in ref 2 ) and translational recoding (reviewed in ref 3 ). Escherichia coli mRNAs are not presently known to contain introns or to be subject to RNA editing. They are subject to translational recoding, however, including +1 and -1 frameshifts, readthrough of stop codons, ribosome hops, and selenocysteine incorporation in response to UGA codons in specialized circumstances.

In previous work, a large number of sequences from a random peptide library were isolated by phage display technology during drug discovery protocols and determined to contain non-open reading frame (non-ORF) and frameshifted sequences, which were nevertheless apparently being expressed (4 , 5) . However, it was unclear whether expression of these sequences was a rare event.

The peptide library consisted of ~40 residue-long random peptides encoded by NNK codons (N=A,C,G or T; K=G or T) of a synthetic gene on a phagemid. The peptide sequences were flanked by the FLAG and the epitope tag (E-tag) linear epitopes, and were fused to the minor coat protein of filamentous phage (encoded by gene III). The diversity of the library was 1.5 x 1010 clones. Phage were prepared in an amber suppressor host, thus UAG stop codons were translated as glutamine. On occasion, seemingly as a result of chemical modification in synthetic oligonucleotides used, deletions, insertions, or point mutations were observed in the genes from phage display. Such sequence changes at times resulted in TGA or TAA stop codons.

Among ~150 different clones that were sequenced and shown to express peptides specific for different receptors (5) , three general types of DNA sequences were obtained. What was originally expected was an ORF corresponding to the full length of the peptide and (in this library) the E-tag that follows. This class of sequence was observed only in ~50% of all sequences identified in biopanning as binding to a target (4) . Two other types of sequences, qualitatively very different, were also observed. The second type of sequence contained a nonsuppressed stop codon (i.e., TAA or TGA) within the nucleic acid sequence encoding the peptide. The third type of sequence contained a nonsuppressed stop codon and, in a different reading frame, the E-tag sequence (4) . In a few instances, some clones did not have a 0-frame stop codon, but encoded the E-tag in a different reading frame.

One of the sequences, named ‘H10’, was chosen for further study (5) . H10 was selected by phage display as producing a peptide that bound to GHBP (growth hormone binding protein). The sequence exhibited two in-frame TGA stop codons upstream of the sequence encoding the E-tag epitope (and the fusion to M13 gene III protein) in the same reading frame. A secondary peptide library on filamentous phage, designed to average ~four mutations per sequence, was obtained by a doped mutagenesis procedure and again subjected to biopanning against the GHBP target. A number of additional clones were thus obtained, most of which exhibited frameshifts, both +1 and -1, in the placement of the E-tag sequence relative to the translation start, as well as retention of the 5' proximal TGA stop codon of parental H10. Because the 3' proximal third of the sequence yielded almost no mutations after phage display selection, it was possible to infer the amino acid sequence (and hence the reading frame) of the portion of the peptide that bound to GHBP; this was proved by independent synthesis of the putative peptide fragment, which did in fact display the appropriate binding properties (5) .

In the work described here, the H10 sequence and several of the secondary derivatives have been subcloned into a reporter system and tested for expression in E. coli. The results show that this sequence facilitates high-frequency readthrough (or bypass) of UGA stop codons, and with minor modifications, high-frequency +1 or -1 frameshifting. In most of the tested clones, expression was obtained in two of the three reading frames, although it is possible that one of these frames represents reinitiation at an internal AUG (6 , 7) . We believe this phenomenon to be translational in origin, because two of the clones in which the stop codons were altered to sense codons primarily displayed translation only in the zero frame.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
Host strain and plasmid vectors
The host strain chosen to test expression of reporter constructs was MY411 ({Delta}[lac-pro], supE, thi/F’lacIQZ{Delta}M15, proA+B+); this strain (8) , generously provided by Jim Curran, is a lac deletion strain possessing an F' factor that carries a gene for lac repressor. This strain also contains a glutamine amber suppressor, so that any of the original isolates containing suppressed amber codons will still be expressed in the reporter constructs as well.

The vector into which the H10 derivatives were cloned was pJC27 (9) , also supplied by Jim Curran, and used previously in this laboratory (10 , 11) . This vector contains a chloramphenicol resistance gene, a p15A origin of replication, and a pseudo-wild type lacZ gene under control of the lacUV5 promoter, with a HindIII site at nucleotides 12–17 and a BamHI site at nucleotides 32–37 (where nucleotide 1 is the A of the initiating ATG codon of lacZ).

Plasmids carrying the H10 sequence or its derivatives (5) were obtained from DGI Biotechnologies (Edison, N.J.).

PCR amplification and cloning procedures
The following oligonucleotides were used to polymerase chain reaction (PCR) amplify the H10 and related sequences from the host phagemid, pCANTAB5E:

WM11.1: CCCAACAAGCTTCGACTACAAAGAC.

WM11.2 (frame 0): AACCAAGGATCCCCGGCGCACCTGC (25 nt).

WM11.3 (frame +1): AACCAAGGATCCACCGGCGCACCTGC (26 nt).

WM11.4 (frame -1): AACCAAGGATCCCGGCGCACCTGC (24 nt).

Control oligo: CGACTACAAAGACGCGGCCGCAGGTGCGCCGG.

To obtain a DNA fragment for the fusion to the ß-galactosidase gene in the 0 reading frame, oligonucleotides WM11.1 (5'-end primer) and oligonucleotide WM11.2 (3'-end primer) were used. Similarly, to obtain gene fusions in either +1 or -1 reading frames, oligonucleotides WM11.1 and either WM11.3 or WM11.4, respectively, were used.

The 5'-end primer facilitated introduction into the PCR product, after the 4th codon of lacZ, the FLAG sequence (GACTACAAAGAC), at the same time adding a HindIII (AAGCTT) site. The 3'-end primers added a part of the E-tag sequence (GCAGGTGCGCCG) in front of the lacZ gene in all three reading frames (relative to the E-tag frame), and at the same time introduced a BamHI (GGATCC) site. The control oligonucleotide was used to construct pJC27 derivatives that do not carry any H10 sequences for the purpose of establishing the expression levels without the H10 insertions.

The PCR products obtained were digested with HindIII and BamHI restriction enzymes, purified by gel electrophoresis, and ligated into precut (with HindIII and BamHI) plasmid pJC27.

All sequences used in this work were verified by DNA sequencing carried out by the New Jersey Medical School Molecular Resource Facility or by DGI Biotechnologies.

Site-directed mutagenesis
Codon 13 (TGA) of H10, 221, and 210 sequences was mutated to TTA in a PCR reaction involving one of WM11.2, WM11.3, or WM11.4 primers and one of the following three primers:

H10–8T: CCCAACAAGCTTCGACTACAAAGACTTTCCGTTAGTGTGTTGGAGGGCG.

221–8T: CCCAACAAGCTTCGACTACAAAGACTTTCCGTTAGTGTCTTGGAGGGGG.

210–8T: CCCAACAAGCTTCGACTACAAAGACTTTCCGTTAGTGTGTTCGTGGCGC.

As a result, nine mutated variants were obtained. The PCR products were digested with HindIII and BamHI restriction enzymes, purified by gel electrophoresis, and ligated into precut (with HindIII and BamHI) plasmid pJC27.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
Experimental design
Because the isolates from phage display selection apparently had expression of non-ORF and frameshifted sequences, we decided to clone these in all three reading frames in their attachment to a reporter ß-galactosidase gene. Phage display required synthesis of the M13 phage gene III protein in the same reading frame as the E-tag sequence; therefore, the primers used at the 3' junction either connected to the reporter in the E-tag frame (clones designated with the suffix ‘.1’), the frame +1 to the E-tag frame (designated with the suffix ‘.2’), or the frame -1 to the E-tag frame (designated with the suffix ‘.3’) (note that the E-tag frame was not always in the same frame as the initiating methionine). This design is outlined schematically in Fig. 1 .



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Schematic diagram of experimental design. Description is in the text.

Three control derivatives of vector pJC27 were constructed (Fig. 2 ) containing the sequences encoding the FLAG (AspTyrLysAsp) and partial E-tag (AlaAlaAlaGlyAlaPro) epitopes, with the fusion to reporter following in all three reading frames, respectively. These controls allowed us to monitor expression levels from the pJC27 plasmid itself, without any H10-series inserts. In pJC27.1, ß-galactosidase follows the FLAG and partial E-tag sequences in the 0-frame (this construct shows expression comparable to pJC27), whereas in pJC27.2 the reporter is in the +1-frame relative to the translation start, and in pJC27.3, the reporter is in the -1-frame. After 1 h of isopropyl-ß-D-thiogalactopyranoside induction, expression of ß-galactosidase in pJC27.1 was high, whereas pJC27.2 expressed the reporter 3% as well, and pJC27.3 showed the same level of activity as the lac deletion background, strain MY411 (Table 1 , lines 1–4).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Control vector derivatives of pJC27. Sequences inserted at the cloning site of vector pJC27 (9) replace sequences between the HindIII (aagctt) and BamHI (ggatcc) sites. The continuing ß-galactosidase reporter reading frame (IPDPV) is followed by an arrow (->) for each construct. The amino-terminal FLAG epitope (DYKD), and the (segment) carboxy-terminal partial E-tag epitope (AAAGAP) are underlined (and are contiguous in these control constructs). Insertions are indicated by an "!", with the added base above the line. Deletions are indicated by an empty space, with the deleted nucleotide shown above the line with a slash through it. The nucleotide sequence (lowercase) is represented on the line immediately below the construct name, and the amino acid translation in the 0-frame is represented on the next line below that, followed by (for the control constructs) relevant +1 and -1 translations on the next two lines, respectively. The 21 (±1) nucleotides at the right ends of the segments, and their translations, show the transition to the reporter sequence and reading frame.


View this table:
[in this window]
[in a new window]
 
Table 1. Expression of various fusions to ß-galactosidase

Bypass or readthrough of two UGA codons in clone H10
We constructed several clones containing the H10 sequence and its derivatives 117, 221, and 210 (5) in plasmid pJC27 in different reading frames with respect to ß-galactosidase (Fig. 3 ).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Non-open reading frame clone H10 and its derivatives. The conventions used are described in the legend to Fig. 2 . The nucleotide sequence for the parental H10 segment, cloned in the 0-frame, is given in full, as are amino acid translations for all three reading frames below the nucleotide sequence. The host strain contains an amber suppressor, so TAG codons in the 0-frame (indicated) are translated as Q. TGA stop codons are shown as solid circles in the amino acid translations. Nucleotides and amino acids unchanged from H10 are indicated by dashes. Only changes in nucleotides and amino acids (0-frame changes in italics) are shown for the H10 derivatives. For all constructs, the nucleotide sequence (lowercase) is represented on the line immediately below the construct name; the amino acid translation in the 0-frame is represented on the next line below that, followed by relevant portions of +1 and -1 translations on the following two lines, respectively. Dots above sequence lines denote nucleotide positions in the parental H10 sequence.

The H10 sequence has two 0-frame TGAs at codons 13 and 34 in the reporter construct, where codon 1 is the initiating ATG (Fig. 3) . In the original isolations of the segments, the partial E-tag epitope (AAAGAP) delineates the reading frame of the fused M13 protein needed for the phage display selection. This frame must be accessed at least by codon 36 of the H10 sequence, because phage binding depends on expression of the amino acid sequence LGCYFVAGVVACV (ref 5 ; see Fig. 3 ). Expression of ß-galactosidase was high, 19% of control pJC27.1, when this sequence was joined to the reporter in the 0-frame in clone H10.1. There was no expression above background when this sequence was joined to the reporter in the +1-frame (H10.2), but even higher synthesis, 43% of the control when the sequence was joined to the reporter in the -1-frame (H10.3) (Table 1 , lines 5–7).

One of the phage display-selected derivatives from H10, clone 117, had six nucleotide changes (Fig. 3) , including changes in the two TGA codons (to TGC [Cys], at codon 13, and AGA [Arg], at codon 34), as well as a change from TGG (Trp) to TAG (amber, suppressed as Gln) at codon 35. This derivative showed reporter synthesis essentially only in the 0-frame (117.1), albeit with a reduced level of 37% compared to pJC27.1, probably reflecting the efficiency of suppression of the UAG at codon 35 (Table 1 , lines 8–10). When normalized to the sum of expression in all 3 frames, synthesis in the 0-frame was >96%.

+1 and -1 frameshifting in clones 221 and 210
In the isolates from the secondary library of H10, clone 221 had the E-tag in the +1-frame relative to the translation start as a result of insertion of a C residue into codon 31. This clone also had five other nucleotide substitutions (Fig. 3) . Because of the insertion, the TGA at codon 34 was no longer in the 0-frame; however, the codon 13 TGA was still present. Significant expression of the reporter, almost 10% of pJC27.1, was obtained when ß-galactosidase was joined in both the +1 (221.1) and the 0 (221.3) frames relative to the translation start (Table 1 , lines 11–13).

In clone 210, the E-tag was in the -1-frame relative to the translation start as a result of deletion of an A residue in codon 17. This clone also had seven other nucleotide substitutions (Fig. 3) . Because of the deletion, the TGA at codon 34 was no longer in the 0-frame, but the TGA at codon 13 was still present. Significant expression of the reporter, ~10% of pJC27.1, was obtained when ß-galactosidase was joined in the -1-frame (210.1), and ~20% when the reporter was joined in the +1-frame (210.3), relative to the translation start (Table 1 , lines 14–16).

A graphical representation of the relative expression levels obtained in all three reading frames for H10, 117, 221, and 210 is shown in Fig. 4 .



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Graphical representation of relative expression levels of H10 and its derivatives 117, 221, and 210. The top line in each panel represents translation in the 0-frame, the second line, translation in the +1-frame, and the third line, translation in the -1-frame. UGA codons in the respective reading frames are indicated as well as the frame encoding the partial E-tag epitope. Translation is expected to begin at the first AUG just upstream of the indicated FLAG epitope. Relative expression levels taken from Table 1 .

Site-directed mutants that eliminate the UGA at codon 13
We constructed a number of site-directed mutants of our H10 series sequences in order to test possible involvement of the first TGA stop codon in the unusual expression patterns. Clones H10, 221, and 210 all contain a TGA stop at codon 13 in our reporter constructs. The G of the TGA was changed to T (making a TTA leucine codon) by PCR (see Materials and Methods). These derivatives are designated H10–8T, 221–8T, and 210–8T, respectively (reflecting the G->T transversion at the 8th nucleotide after the FLAG-encoding sequence). As with all the other sequences, these mutants were also prepared with the reporter in all three reading frames. The sequences of the site-directed mutants of 221 and 210 are shown in Fig. 5 (the parental H10 sequence is in Fig. 3 ; note that the TGA at codon 34 is still present in the ‘8T’ mutants of H10).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Site-directed mutants of frameshifted derivatives 221 and 210. Conventions used are described in the legends to Figs. 2 and 3 . The G -> T change is indicated by a down arrow ({downarrow}).

Abolishing the first TGA (of two) in H10 diminished expression of the reporter by about half in both the 0-frame (H10–8T.1) and the -1-frame (H10–8T.3), but expression was still substantial and the normalized (i.e., relative) expression of each frame was unchanged (Table 1 , lines 17–19).

By contrast, abolishing the TGA at codon 13 of clone 221 essentially prevented the +1 (221–8T.1) frameshift, whereas greatly increasing 0-frame (221–8T.3) expression (Table 1 , lines 20–22).

For clone 210, there was no reduction of ß-galactosidase expression by changing the codon 13 TGA to sense for the -1 (210–8T.1) or the +1 (210–8T.3) connections to the reporter. Further, there was only modest expression for the construct where the reporter was joined in the 0-frame (210–8T.2), even though no 0-frame stop codon was present (Table 1 , lines 23–25). These results were so unexpected that the plasmids were resequenced; even though the sequences were verified, construction of the 210–8T series was also independently repeated. Nevertheless, the same patterns of expression were obtained.

A graphical representation of the changes in relative expression levels obtained in all three reading frames for the site-directed mutants is shown in Fig. 6 .



View larger version (24K):
[in this window]
[in a new window]
 
Figure 6. Graphical representation of changes in relative expression levels in all three reading frames for site-directed mutants of H10, 221, and 210. Conventions are the same as in legend to Fig. 4 . Arrows at the far right of each panel represent expression in the site-directed mutant, whereas the arrows immediately to the left of these reflect parental expression, as shown in Fig. 4 .

During the PCR cloning, one of the isolated colonies from the construction of 210–8T.3 was found to have a deletion of a T in codon 8 (2nd codon of the sequence encoding the FLAG epitope). This changed the connection to the reporter into the 0 reading frame. Expression of this variant, called 210–8T.3({Delta}-9T) (Fig. 5) , was substantially higher (Table 1 , line 26) than the other 0-frame derivative of 210 (Table 1 , line 24).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
The case for a translational mechanism
It remains theoretically possible that the expression of these non-ORF sequences is a result of RNA editing, splicing, or a transcriptional anomaly where an unrecognized signal in the DNA sequence triggers RNA polymerase to hop over the TGA codon(s) and/or out-of-frame nucleotides and land such that the reading frame will join the reporter in the 0-frame. To our knowledge, there is no precedent for these kinds of behaviors in E. coli. There is ample precedent, however, for ribosomes responding to recoding signals in mRNA resulting in readthrough of UGA stop codons (12 13 14) , incorporation of selenocysteine in response to UGA codons (15) (generally under anaerobic conditions; ref 16 ), translational frameshifts (reviewed in refs 3 , 17 18 19 20 ), and even ribosome hops (or slides) (21 22 23 24 25) . This interpretation is buttressed by the results obtained with clones 117 and 221–8T, both of which have no (nonsuppressed) 0-frame stop codons and both of which express the reporter primarily in the 0-frame (Table 1 , lines 8–10 and 20–22). The results with clone 117 are somewhat less persuasive since there are six mutations from the parental H10 sequence. However, clone 221–8T was a single nucleotide site-directed alteration that abolished the only 0-frame TGA in that construct. Although the results with clone 210–8T did not show significant changes in expression when the stop codon was changed to sense, and in fact were puzzling in that 0-frame expression improved only modestly, these results do not rule out a translational mechanism. Rather, the results with clone 210 suggest the possibility of a mechanism involving secondary and/or higher order RNA structures directing the ribosome movement.

Potential RNA secondary structures
Subjecting the entire H10 sequence to an RNA folding program results in a highly ordered structure with many long-range interactions. However, this is not particularly specific: a scrambled version of H10 with the same nucleotide composition also gave a highly ordered structure that even showed some resemblance to the structure generated for the native H10 sequence. A more informative approach appeared to be to generate a structure based on the 51 nucleotides encompassing the UGA at codon 13. This suggested a stem-loop with a stability of about -5 kcal immediately downstream of the UGA (Fig. 7 ), which is similar to the configuration of several known recoding elements (e.g., 26 27 28 29 30 31 ). This putative stem-loop is preserved in all three non-ORF constructs, H10, 221, and 210. Two alternate stem-loops were suggested by the folding program for 221, but structure ‘a’ for 221 in Fig. 7 conformed to the structures obtained for H10 and 210. This stem-loop in 221 showed the same primary and secondary structure as H10 except for a compensating GC to CG base pair in the stem. The stem-loop in 210 had the identical stem as in H10, but two base changes and a one base deletion in the loop. The existence and potential function of these putative structures remain to be established.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 7. Potential stem-loops after UGA at codon 13 in H10 series of expression clones. Arrows indicate base changes from parental H10 sequence. H10 structure: -5.1 kcal. 221 structure "a": -4.5 kcal; alternate structure "b": -5.3 kcal. 210 structure: -4.5 kcal.

Expression in two of the three reading frames
H10, 221, and 210 all showed reporter expression not only in the E-tag frame (designated by the ‘.1’ suffix), consistent with the phage display selections, but also in the frame -1 to the E-tag frame (designated by the ‘.3’ suffix). Expression in this frame would not have been detected in the phage display selections. The FLAG epitope at the NH2 terminus of the phage-displayed peptides is only recognized by antibody when it is positioned precisely at the amino-terminal end. In our constructs, the FLAG sequence is after codon 6 in the fusion protein, and therefore cannot be assayed immunologically.

Inspection of the H10 sequence reveals that the A of the codon 34 TGA is followed by TG, and that 6 nt upstream is the sequence GGAGG (Fig. 3) ; in other words, the -1-frame harbors a potential AUG initiation codon with an excellent Shine-Dalgarno appropriately spaced just upstream. This nucleotide sequence is preserved in both 221 and 210 (see Fig. 5 ), in both cases in the frame -1 to the E-tag frame. In the case of clone 117, one of the mutations changed the G of the ATG to an A (Fig. 3) , severely reducing or eliminating this potential start site. In the cases of 221–8T.3 and 210–8T.3({Delta}-9T), both of which show reporter expression in the 0-frame, initial and internal ATGs are in the same reading frame. Thus, it seems plausible that expression in frames -1 to the E-tag frame results from initiation or reinitiation at the internal AUG.

This suggestion is further strengthened by other experiments in which H10.1, H10.3, 221.1, 221.3, 210.1, and 210.3 were all placed individually in an su- lac deletion host that does not contain a lac repressor allele. In these conditions, transcription from the lac promoter is constitutive, but amber codons are not suppressed. Nevertheless, all of these constructs did express ß-galactosidase at about the same relative levels compared to control pJC27.1, as is observed in Table 1 (data not shown). Since there are in-frame TAG stops upstream of the putative downstream ATG start in both H10.3 and 210.3, but none after the ATG, these results also favor downstream initiation as the explanation for expression in this frame.

By contrast, expression in the E-tag frame cannot be accounted for by a downstream initiation. If this were the case, the start would have to be within the reporter sequence; therefore, expression would have been observed regardless of the reading frame in which the H10 fusions were attached. However, expression in the frame +1 to the E-tag (designated by the ‘.2’ suffix) was always insignificant after the H10 fusions (Table 1) .

Further, we have made a preliminary attempt to determine the amino-terminal amino acid sequence of some of the H10 fusions. Sonicated lysates of induced cultures, in the presence of a mixture of protease inhibitors, were passed over an APTG (4-aminophenyl-ß-D-thiogalactopyranoside) agarose (Boehringer Mannheim, Mannheim, Germany) column (an affinity column for ß-galactosidase), and the eluate showed a significant degree of purification of ß-galactosidase as judged by staining sodium dodecyl sulfate-polyacrylamide gels. The ß-galactosidase fusion protein was transferred to ProBlott PVDF-type membrane (Applied Biosystems, Foster City, Calif.) by Western blotting and microsequencing was performed by the New Jersey Medical School Molecular Resource Facility. The protein isolated from cells with clone 221.1 (which shifts +1 to express reporter) gave an amino-terminal sequence of VVACVAAAGAPG, which matches exactly a sequence starting five residues upstream of the partial E-tag through the residue following (see Figs. 3 and 5 ), in the E-tag frame. This most likely represents a proteolytic product from which the true NH2 terminus has been cleaved. Recombinant hybrid proteins derived from fusions to ß-galactosidase are known to be highly unstable and subject to proteolytic degradation (32) . Although this result does not help us determine the start or shift sites, it does demonstrate that a protein of about the molecular weight of ß-galactosidase that purifies on a ß-galactosidase affinity column expresses E-tag in a frame +1 relative to the ATG start in the DNA sequence. This is strong evidence against a downstream initiation event as being responsible for expression, at least for this +1 shifting clone.

Weak expression of one of the background control vectors
The small but significant level of expression of control vector pJC27.2 (Table 1 , line 2) was consistent even though the reporter was in the +1-frame relative to the translation start. Since, in general, expression of our fusion constructs with the reporter in the +1-frame relative to the E-tag frame (designated by the ‘.2’ suffix) was not significantly higher than the lac deletion host (Table 1) , this observation was of little concern for interpreting our experiments.

One possible speculation about the origin of this weak frameshifted expression comes from inspection of the pJC27.2 sequence (Fig. 2) : codons 19 and 20 in the 0-frame are CCC CGA. The CGA (Arg) codon is one of the rarest in E. coli (33) , and in fact is used so infrequently that cells can tolerate missense suppressors of this codon at the astonishingly high level of 8% efficiency (34) . Thus, it is possible that the CGA codon in the A site of the ribosome facilitates a prolonged vacancy of this site, allowing the peptidyl-tRNAPro in the P site to slide to the right one base (still paired with a CCC triplet), shifting to the reporter frame. This may be similar to the recoding sequence CCC UGA, which shifts to the +1 frame at a frequency of 2–4% (35) . It is known in other systems that the extent of vacancy of the A site facilitates +1 frameshifts (10 , 11 , 19 , 20 , 36 , 37) . The window of opportunity for the +1 shift in pJC27.2 is not extensive: the ribosome will encounter a UGA at codon 28 or a UAA at codon 38 in the 0-frame.


   CONCLUDING REMARKS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 
When we began this study, it seemed possible that the non-ORF sequences isolated by phage display were generated by rare events and simply picked up by the exquisite sensitivity of the phage display technology. By subcloning these sequences into a reporter construct, we were able to quantitate expression, and have determined that expression of these sequences is not a rare event and that it occurs in two of the three reading frames (although it is possible that one of these frames reflects initiation at an internal translation start). These results are reminiscent of the kinds of results found for known translational recoding elements. The fact that an ORF derivative from the secondary library and a site-directed ORF variant from a +1 shifting sequence were expressed primarily in the 0-frame further supports our suggestion that we are dealing with a recoding phenomenon.

Experiments are under way to determine the amino acid sequence of these constructs so as to determine where the frameshifts and/or hops occur. Once we obtain these results, we will be in a position to identify the minimal sequence required for the recoding, and we will be able to use site-directed mutagenesis to identify essential nucleotides and/or structures involved in the recoding. Pending those results, we can only speculate as to what features in this unusual nucleotide sequence lead to such striking expression patterns. The bias in the design of the initial random peptide library, which was 67% G+T, may be responsible for a greater degree of structure in the message than usual, since G-U base pairs are permissible in RNA structures. Nascent peptides are also known in some instances to affect ribosome movement (3 , 38) . Whatever the mechanism turns out to be, this unusual sequence has underscored again the remarkable flexibility of the biosynthetic (most likely, translational) apparatus in implementing gene expression.


   ACKNOWLEDGMENTS
 
We gratefully acknowledge Bob Donnelly, of the New Jersey Medical School Molecular Resource Facility, for helpful discussions and suggestions, and Jennifer Zemsky for critical reading of the manuscript. This work was supported by NSF grant MCB-9513127 as well as a grant from DGI Biotechnologies.


   FOOTNOTES
 
Received for publication May 21, 1999. Revised for publication October 12, 1999.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUDING REMARKS
REFERENCES
 

  1. Sharp, P. A. (1981) Speculations on RNA splicing. Cell 23,643-646[Medline]
  2. Stuart, K, Allen, T. E., Heidmann, S., Seiwert, S. D. (1997) RNA editing in kinetoplastid protozoa. Microbiol. Mol. Biol. Rev. 61,105-120[Abstract]
  3. Gesteland, R. F., Atkins, J. F. (1996) Recoding: dynamic reprogramming of translation. Annu. Rev. Biochem. 65,741-768[Medline]
  4. Ravera, M. W., Carcamo, J., Brissette, R., Alam-Moghé, A., Dedova, O., Cheng, W., Hsiao, K. C., Klebanov, D., Shen, H., Tang, P., Blume, A., Mandecki, W. (1998) Identification of an allosteric binding site on the transcription factor p53 using a phage-displayed peptide library. Oncogene 16,1993-1999[Medline]
  5. Carcamo, J., Ravera, M. W., Brissette, R., Dedova, O., Beasley, J. R., Alam-Moghé, A., Wan, C., Blume, A., Mandecki, W. (1998) Unexpected frameshifts from gene to expressed protein in a phage-displayed peptide library. Proc. Natl. Acad. Sci. USA 95,11146-11151[Abstract/Free Full Text]
  6. Adhin, M. R., van Duin, J. (1990) Scanning model for translational reinitiation in eubacteria. J. Mol. Biol. 213,811-818[Medline]
  7. Manley, J. L. (1978) Synthesis of internal re-initiation fragments of beta-galactosidase in vitro and in vivo. J. Mol. Biol. 125,449-466[Medline]
  8. Curran, J. F., Yarus, M. (1986) Base substitutions in the tRNA anticodon arm do not degrade the accuracy of reading frame maintenance. Proc. Natl. Acad. Sci. USA 83,6538-6542[Abstract/Free Full Text]
  9. Curran, J. F., Yarus, M. (1988) Use of tRNA suppressors to probe regulation of Escherichia coli release factor 2. J. Mol. Biol. 203,75-83[Medline]
  10. Sipley, J., Goldman, E. (1993) Increased ribosomal accuracy increases a programmed translational frameshift in Escherichia coli. Proc. Natl. Acad. Sci. USA 90,2315-2319[Abstract/Free Full Text]
  11. Gao, W., Jakubowski, H., Goldman, E. (1995) Evidence that uncharged tRNA can inhibit a programmed translational frameshift in Escherichia coli. J. Mol. Biol. 251,210-216[Medline]
  12. Wenthzel, A. M., Stancek, M., Isaksson, L. A. (1998) Growth phase dependent stop codon readthrough and shift of translation reading frame in Escherichia coli. FEBS Lett 421,237-242[Medline]
  13. Chittum, H. S., Lane, W. S., Carlson, B. A., Roller, P. P., Lung, F. D., Lee, B. J., Hatfield, D. L. (1998) Rabbit beta-globin is extended beyond its UGA stop codon by multiple suppressions and translational reading gaps. Biochemistry 37,10866-10870[Medline]
  14. Hofstetter, H., Monstein, H.-J., Weissmann, C. (1974) The read-through protein A1 is essential for the formation of viable Qß particles. Biochim. Biophys. Acta 374,238-251[Medline]
  15. Böck, A., Forchhammer, K., Heider, J, Leinfelder, W., Sawers, G., Veprek, B., Zinoni, F. (1991) Selenocysteine: the 21st amino acid. Mol. Microbiol. 5,515-520[Medline]
  16. Chen, G. T., Axley, M. J., Hacia, J., Inouye, M. (1992) Overproduction of a selenocysteine-containing polypeptide in Escherichia coli: the fdhF gene product. Mol. Microbiol. 6,781-785[Medline]
  17. Atkins, J. F., Weiss, R. B., Gesteland, R. F. (1990) Ribosome gymnastics-degree of difficulty 9.5, style 10.0. Cell 62,413-423[Medline]
  18. Atkins, J. F., Weiss, R. B., Thompson, S., Gesteland, R. F. (1991) Towards a genetic dissection of the basis of triplet decoding, and its natural subversion: programmed reading frame shifts and hops. Annu. Rev. Genet. 25,201-228[Medline]
  19. Farabaugh, P. J. (1996) Programmed translational frameshifting. Annu Rev Genet 30,507-528[Medline]
  20. Farabaugh, PJ (1996) Programmed translational frameshifting. Microbiol Rev 60,103-134[Free Full Text]
  21. Weiss, RB, Dunn, DM, Atkins, JF, Gesteland, RF (1987) Slippery runs, shifty stops, backward steps, and forward hops: -2, -1, +1, +2, +5, and +6 ribosomal frameshifting. Cold Spring Harb Symp Quant Biol 52,687-693[Abstract/Free Full Text]
  22. Weiss, RB, Dunn, DM, Atkins, JF, Gesteland, RF (1990) Ribosomal frameshifting from -2 to +50 nucleotides. Prog Nucleic Acids Res. Mol Biol 39,159-183[Medline]
  23. Huang, WM, Ao, SZ, Casjens, S, Orlandi, R, Zeikus, R, Weiss, R, Winge, D, Fang, M. (1988) A persistent untranslated sequence within bacteriophage T4 DNA topoisomerase gene 60. Science 239,1005-1012[Abstract/Free Full Text]
  24. Kane, JF, Violand, BN, Curran, DF, Staten, NR, Duffin, KL, Bogosian, G. (1992) Novel in-frame two codon translational hop during synthesis of bovine placental lactogen in a recombinant strain of Escherichia coli. Nucleic Acids Res 20,6707-6712[Abstract/Free Full Text]
  25. Gallant, JA, Lindsley, D. (1998) Ribosomes can slide over and beyond "hungry" codons, resuming protein chain elongation many nucleotides downstream. Proc. Natl. Acad. Sci. USA 95,13771-13776[Abstract/Free Full Text]
  26. Jacks, T, Madhani, HD, Masiarz, FR, Varmus, HE (1988) Signals for ribosomal frameshifting in the Rous sarcoma virus gag-pol region. Cell 55,447-458[Medline]
  27. Tsuchihashi, Z. (1991) Translational frameshifting in the Escherichia coli dnaX gene in vitro. Nucleic Acids Res 19,2457-2462[Abstract/Free Full Text]
  28. Chen, GF, Fang, L, Inouye, M. (1993) Effect of the relative position of the UGA codon to the unique secondary structure in the fdhF mRNA on its decoding by selenocysteinyl tRNA in Escherichia coli. J Biol Chem 268,23128-23131[Abstract/Free Full Text]
  29. Brierley, I. (1995) Ribosomal frameshifting viral RNAs. J Gen Virol 76,1885-1892[Abstract/Free Full Text]
  30. Matsufuji, S, Matsufuji, T, Miyazaki, Y, Murakami, Y, Atkins, JF, Gesteland, RF, Hayashi, S. (1995) Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme. Cell 80,51-60[Medline]
  31. Larsen, B, Gesteland, RF, Atkins, JF (1997) Structural probing and mutagenic analysis of the stem-loop required for Escherichia coli dnaX ribosomal frameshifting: programmed efficiency of 50%. J Mol Biol 271,47-60[Medline]
  32. Ullmann, A. (1984) One-step purification of hybrid proteins which have ß-galactosidase activity. Gene 29,27-31[Medline]
  33. Zhang, SP, Zubay, G, Goldman, E. (1991) Low-usage codons in Escherichia coli, yeast, fruit fly and primates. Gene 105,61-72[Medline]
  34. Tsai, F, Curran, JF (1998) tRNA(2Gln) mutants that translate the CGA arginine codon as glutamine in Escherichia coli. RNA 4,1514-1522[Abstract]
  35. de Smit, MH, van Duin, J, van Knippenberg, PH, van Eijk, HG (1994) CCC.UGA: a new site of ribosomal frameshifting in Escherichia coli. Gene 143,43-47[Medline]
  36. Lindsley, D, Gallant, J. (1993) On the directional specificity of ribosome frameshifting at a "hungry" codon. Proc. Natl. Acad. Sci. USA 90,5469-5473[Abstract/Free Full Text]
  37. Dinman, JD, Kinzy, TG (1997) Translational misreading: mutations in translation elongation factor 1alpha differentially affect programmed ribosomal frameshifting and drug sensitivity. RNA 3,870-881[Abstract]
  38. Lovett, PS, Rogers, EJ (1996) Ribosome regulation by the nascent peptide. Microbiol Rev 60,366-385[Abstract/Free Full Text]
  39. Sambrook, J, Fritsch, EF, Maniatis, T. (1989) Molecular cloning: a laboratory manual 2nd edition ,17. 35 Cold Spring Harbor Laboratory Cold Spring Harbor, NY.



This article has been cited by other articles:


Home page
FASEB J.Home page
L. SONG, W. MANDECKI, and E. GOLDMAN
Expression of non-open reading frames isolated from phage display due to translation reinitiation
FASEB J, September 1, 2003; 17(12): 1674 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Cai, M. Xaymardan, J. M. Holm, J. Zheng, J. R. Kizer, and J. M. Edelberg
Age-associated impairment in TNF-{alpha} cardioprotection from myocardial infarction
Am J Physiol Heart Circ Physiol, July 11, 2003; 285(2): H463 - H469.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by GOLDMAN, E.
Right arrow Articles by MANDECKI, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by GOLDMAN, E.
Right arrow Articles by MANDECKI, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS