|
|
||||||||



* Department of Immunology and Oncology, Centro Nacional de Biotecnología, UAM Campus de Cantoblanco, Madrid E-28049;
Servicio de Genética, Hospital Universitario La Paz, Madrid E-28046; and
Departamento de Biología Celular y Desarrollo, CIB/CSIC, Veláquez 144, Madrid E-28006, Spain
1Correspondence: Department of Immunology and Oncology, Centro Nacional de Biotecnología, UAM Campus de Cantoblanco, Madrid E-28049 Spain. E-mail jlbarbero{at}cnb.uam.es
| ABSTRACT |
|---|
|
|
|---|
Key Words: stromal antigens stromalin meiosis cohesins
| INTRODUCTION |
|---|
|
|
|---|
WBS is a developmental disorder with multi-system manifestations,
including distinctive facies, mental retardation with unique cognitive
and personality profiles, cardiovascular stenoses, connective tissue
anomalies, short stature, and occasional transient infantile
hypercalcemia (11
12
13)
. There are a few reports of
affected parents and children confirming autosomal dominant
inheritance, but the great majority of WBS cases are sporadic, with an
estimated incidence of 1 in 20,000 live births, indicating a very high
mutation rate (approx. 0.5x10-4). The spectrum
of clinical manifestations is caused by a heterozygous deletion at
chromosome band 7q11.23 (14)
. Genetic and physical mapping
of the deletions is consistent with clustering of common breakpoints in
relatively small genomic regions at both sides of the elastin locus in
the majority of informative patients (15
, 16)
. Meiotic
recombination between polymorphic markers proximal and distal to the
deleted interval was documented in most informative families,
suggesting unequal crossing-over between misaligned homologous regions
as the most frequent mutational mechanism (17
, 18)
. In
some cases, no evidence for unequal interchromosomal exchange was found
(18)
, indicating that intrachromosomal meiotic or mitotic
rearrangements may also be responsible. A large genomic duplication
flanking the deleted interval has been proposed as the predisposing
factor to misalignment of homologous regions during chromosome pairing
(19)
. There is also evidence for the existence of low copy
number repeats in the region, which are additional putative
contributions to the genomic instability (15
, 20)
.
The cloning and characterization of STAG3 proteins and the location of duplicated copies of STAG3-related genes in the WBS deletion breakpoints may aid in understanding the evolution of the genomic duplication in humans and elucidating the possible role of STAG3 in the WBS mechanism of deletion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Chromosomal mapping of human STAG3
Somatic cell hybrid lines containing a single human chromosome
on a rodent background were obtained from the NIGMS Human Genetic
Mutant Cell Repository (Coriell Institute for Medical Research, Camden,
N.J.). DNA from the hybrid cell panel was screened by PCR using primers
designed from several regions of the gene. To define the chromosomal
localization of STAG3 loci, the Stanford G3 radiation hybrid panel,
consisting of 83 hybrid cells containing human chromosome fragments on
a hamster background, was used for PCR screening. Amplification results
were submitted to the Stanford Human Genome Center (RHMAP Program,
version 2.01; http://www.shgc.stanford.edu/RH/index.html), which
returns framework markers linked to the subject locus with a LOD score
higher than 6.0. STAG3-specific primers were STAG3E33F:
5'-CCTCTTAGATTCTACAGAGCTGG-3'; and STAG3E34R:
5'-ATTGAGCGAATCATTAGGAC-3'. Primers for the 24mer repeat in the first
exon of STAG3-related transcripts were STAG3LE1F:
5'-GTCGTGGTCTGGCGTGTATT-3'; and STAG3LE1R: 5'-GGTGGCGCGTGCCAGACAC-3'.
Mapping of the orthologous murine gene
To map the murine locus, we used the EUCIB interspecific
backcross panel consisting of two parental strain animals of Mus
spretus and M. musculus C57BL/6J and 50 animals from
the F2 generation (21)
. Two primers
were designed to amplify the 3' untranslated region of the cDNA:
mStag3f: 5' CCTCTCCCCTTCTCCACTTA 3' and mStag3r: 5'
CCTCCCTACCCAACTCCTAT 3'. The amplification products from the parental
samples were sequenced to identify differences that could be typed by
restriction analysis. The 50 progeny animals were then subjected to PCR
amplification, followed by restriction analysis with AluI.
Screening of human and mouse cDNA libraries
We obtained by PCR a fragment of ~140 bp from the human
sequence reported as the EST (Acc. No. Z45306), corresponding to
sequence homologous to previously described STAG1 and STAG2 sequences
(6)
. The oligonucleotides used to amplified this fragment
from human thymus cDNA were HSTAG31, 5'-ACAGGCTTTTGTCTTATTAAG-3' and
HSTAG32, 5'-GGTCCATGAGGAAGCTGGCTAG-3'. This fragment was used as a
32P-labeled probe to screen a
gt11 cDNA human
libraries (Clontech, Palo Alto, Calif.). To screen a Uni-ZAP mouse
testis cDNA library (Stratagene, La Jolla, Calif.), we amplified 476 bp
from the reported murine EST sequence (Acc. No. AA097991) as a probe.
The specific mouse testis cDNA primers used were mStag31,
5'-CAGTGCTCTCGGATCCTGCTC-3' and mStag32, 5'-GGGGCCTTCAACACACCTC-3'.
cDNA library screening was performed according to standard protocols
(22)
.
Nucleic acid sequencing and sequence analysis
Inserts from positive
gt11 clones were subcloned in pUC18
plasmid vector (New England Biolabs, Beverly, Mass.) and the inserts
from positive Uni-ZAP murine cDNA library phages were excised to
plasmid using the protocol recommended by the supplier. Nucleic acid
sequencing was performed in an ABI Prism 377 automatic DNA sequencer.
Nucleic acid and translated amino acid sequences were analyzed using
Gene Works (Intelligenetics, Oxford, U.K.) and Megalign (DNA STAR,
Madison, Wis.) software. The GeneBank and EMBL nucleic acid databases
were searched using the FASTA and TFASTA programs (23)
.
Northern blot analysis
For human STAG3 tissue expression, Human II Multiple Tissue
Northern membrane (Clontech) was hybridized with the PCR HSTAG31/2
fragment. For murine expression, total RNA was isolated from different
mouse tissues with Tri-reagent (Sigma, St. Louis, Mo.) following the
manufacturers instructions. Approximately 20 µg of RNA was
separated electrophoretically in each lane of a 0.8% agarose gel in
the presence of formaldehyde and blotted onto a nylon membrane, which
was hybridized with the murine PCR mStag31/2 fragment. Membranes were
stained to confirm equal RNA loading in each lane (not shown). Northern
hybridizations were performed at 65°C using RapydHyb (Amersham,
Aylesbury, U.K.), and the membranes were exposed to X-ray film at
-80°C with an intensifying screen.
STAG3 antibody production
Using PCR, we amplified a 411 bp fragment of the human STAG3
cDNA sequence that codes for a 137 amino acid polypeptide from the
central region of the human STAG3 sequence (Fig. 2)
. The primers used
for the amplification were NSTAG31,
5'-GCTCATATGCTGGAGCTGTTCCTGCA-3' and NSTAG32,
5'-GCTGTCGACTTATAGTGTCCAGAGAATGGA-3'. Primers introduced ATG
initiation and TAA stop codons as well as
NdeI-SalI sites (in boldface), which were used to
clone the fragment in the pET12a Escherichia coli expression
vector (Novagen, Abingdon, U.K.). Sequencing confirmed the correct
peptide coded sequence. The STAG3 polypeptide band expressed in
E. coli was excised and extracted from a preparative gel and
used to immunize New Zealand rabbits with injections of 250 µg of
recombinant STAG3 peptide in PBS emulsified in complete Freunds
adjuvant. Booster injections were administered 3 wk later. Antisera
were affinity purified using the hSTAG3 polypeptide antigen
(24)
.
|
Immunofluorescence location of STAG3
Testis cells from 7- to 8-wk-old male mice were prepared and
fixed for 20 min at -20°C in methanol, rinsed with PBS at room
temperature, and incubated with 5% goat serum (Life Technologies,
Inc.-BRL, Gaithersburg, Md.). They were then incubated with primary
antibodies diluted in 5% goat serum/PBS, followed by two washes in
PBS. Cells were incubated 1 h with secondary antibodies in 5%
goat serum/PBS, 5 min in 0.8 µg/ml Hoechst 33258 (Molecular Probes,
Eugene, Oreg.) in PBS, and washed twice in PBS before mounting in 0.1%
p-phenylenediamine dihydrochloride (Sigma), 90% glycerol,
0.1% NaN3 in PBS. Samples were analyzed under a
Leitz DMIRB epifluorescence microscope and a Leica TCSNT confocal laser
scanning microscope. Images were noise-filtered, corrected for
background, and processed using Adobe Photoshop (San Jose, Calif.).
Monkey testis slides (The Binding Site, Birmingham, U.K.) were stained
as above, increasing the goat serum concentration to 10%. TO-PRO-3
iodide (1 µM, Molecular Probes) was used for DNA staining and
captured with a confocal laser scanning microscope.
Accession numbers
The human and murine STAG3 nucleotide sequences have been
deposited in the EMBL database with accession numbers AJ007798 and
AJ005678, respectively.
| RESULTS |
|---|
|
|
|---|
|
Northern blot hybridization using a STAG3-specific probe shows
expression of a specific RNA band of ~4.5 kb in human testis
(Fig. 3A
); a similar testis-specific band was found in mouse (Fig. 3B
). Prior screening of human fetal brain and thymus
cDNA libraries with the same probe yielded positive phages in which the
sequence of the inserts always contained exons and unprocessed introns
of STAG3 gene. Similar results were obtained when we
performed reverse transcriptase (RT) -PCR on human fetal brain and
thymus cDNA. Preliminary analyses of the human STAG3
downstream genomic sequence indicate that there is a new human gene in
the 3' region of STAG3 that partially overlaps
STAG3, which is transcribed in the opposite direction
(unpublished results). We therefore consider that the cDNA fragments
obtained by screening commercial libraries and RT PCR on tissues other
than testis may have been derived from this new transcript. These
results suggest that, in contrast to STAG1 and STAG2, the STAG3 mRNA
sequence is expressed only in testis. The murine STAG3 expression
pattern was more precisely characterized during male germ cell
development. Northern blot analysis indicates that STAG3 mRNA is
expressed mainly in germ cells undergoing the first meiotic division,
with maximum expression at 18 to 20 days postpartum (pp), and is
undetectable before day 14 pp (Fig. 3C
). Pachytene cells
appear in mouse testes on day 1214 pp and increase rapidly from days
1620 pp (25)
, the period of maximum STAG3 mRNA
expression.
|
Immunofluorescence location of STAG3
To correlate specific STAG3 transcription in testis
with STAG3 protein expression in germline cells during spermatogenesis,
we examined seminiferous tubule cross sections by immunofluorescence.
The meiotic process occurs in an orderly fashion within the
seminiferous tubules, with spermatogonia situated peripherically near
the basal region of tubules, whereas maturing germ cells move gradually
inward until elongating spermatids are released into the lumen. This
spatial arrangement and the morphological features of distinct meiotic
stages allow us to trace STAG3 expression throughout the
differentiation process. A rabbit antibody against a human STAG3
fragment (hSTAG3 ORF amino acids 626 to 757) expressed in E.
coli (Fig. 2)
was applied to paraformaldehyde-fixed sections of
monkey testes (Fig. 4
). As a reference, centromeres were visualized using a human autoimmune
serum (26)
. Preimmune serum gave no signal (Fig. 4B
). STAG3 was undetectable in Leydig cells, Sertoli cells,
and spermatogonia. Preleptotene cells were also negative. Zygotene
cells, with most centromeres paired, showed high STAG3 expression
levels (Fig. 4A
). In pachytene cells, in which homologue
chromosomes are fully synapsed and centromere signals are fused, STAG3
signals were less intensive and concentrated on bivalent chromosomes in
a structure compatible with the SC (Fig. 4C
, D
). Finally,
after the first meiotic division, all subsequently generated haploid
cells were negative for STAG3 staining. The STAG3 expression pattern,
specifically on bivalent chromosomes, therefore conforms well with its
involvement in chromosome synapsis during meiotic prophase I.
|
To study the presence of STAG3 in the SC, we analyzed colocalization of
STAG3 and of a protein immunologically related to MAP1B, associated
with the SC (27)
. Adult mouse spermatocytes were studied
in immunofluorescence confocal microscopy. The 3-dimensional
reconstruction of a pachytene cell stained with anti-STAG3 and
anti-centromere antibodies shows autosomes and XY bivalents (Fig. 5A
) and the presence of STAG3 along the length of the bivalent
chromosome (Fig. 5A
, inset). Figure 5B
shows a
single optical section of a pachytene cell stained with anti-STAG3 and
anti-MAP1B antibodies, indicating discontinuous STAG3 staining that
only partially colocalizes with MAP1B, suggesting heterogeneous STAG3
protein distribution along the SC. STAG3 thus shows a spatial-temporal
expression, suggesting its participation in the bivalent and chromosome
synapsis.
|
Chromosomal mapping and genomic structure of human
STAG3 and STAG3-like genes
Southern blot hybridization with a STAG3 cDNA probe on
genomic DNA suggested the existence of several loci with related
sequences (unpublished data). In addition, several BAC clones
containing STAG3-related sequences were identified in public
databases (high throughput genome sequence). The complete genomic
structure of the cloned STAG3 gene was characterized by PCR
from genomic clones and genomic DNA, using a combination of primers
designed from the cDNA sequence. It consists of 34 exons with 33
introns and encompasses more than 30 kb of the genomic DNA, although
the size of the large intron 4 is still undetermined (Fig. 6
). Table 1
shows the intron/exon boundaries and the size of the exons and introns
in pairs of bases. Partial sequence analysis of various cDNA and
genomic clones, as well as database comparisons, allowed the
identification of additional multiple STAG3-related
sequences that displayed 9098% identity. Further characterization
revealed that the low copy number repeats correspond to truncated
copies of STAG3 (Fig. 6)
with a similar degree of homology
in exonic and intronic sequences. STAG3 is therefore
probably the ancestral gene, and the truncated copies may have
originated through genomic duplications. Most STAG3-like
(STAG3L) genes are transcribed and processed normally,
resulting in messengers of distinct sizes, detected ubiquitously on
Northern blots (unpublished data). All cloned STAG3L
transcripts initiate with a first exon with homology to the first exon
of JTV1, a gene overlapping the PMS2 gene and
transcribed from the opposite strand on chromosome 7p22
(28)
. These JTV1-related exons contain a 24mer repeat that
is variable among the different STAG3L genes. There is no
additional homology between the remainder of the JTV1 cDNA
or genomic sequences and the STAG3L genes. As with the
original JTV1, however, all STAG3L genes overlap
PMS2-related genes (29)
, which are transcribed
from the opposite strand. The longest ORF of STAG3L1,
STAG3L2 and STAG3L3 cDNAs predict the generation
of identical 134 amino acid proteins, which share 85% similarity to
the middle part of STAG3, including the entire SCD. STAG3L4
and STAG3L5 has a very short potential ORF, and
STAG3L6 cDNA contains an ORF predicting a 150 amino acid
protein with 85% identity to the STAG3 amino-terminal region that
includes the mammalian consensus sequence. It is not known whether any
of these transcripts actually encodes a functional protein.
|
|
PCR screening of DNA from a human/rodent somatic hybrid cell panel
(Coriell repositories) using primers from several STAG3
regions produced the expected products in a single hybrid containing
human chromosome 7, indicating that all related loci map to chromosome
7. To define the STAG3 gene location within chromosome 7,
the Stanford G3 radiation hybrid panel was PCR amplified with
STAG3-specific primers designed from the last two exons.
Amplification specificity was verified by sequencing. Two-point linkage
analysis in the on-line Stanford Human Genome Center server revealed
that the STAG3 locus is located on chromosome region 7q22,
linked to several markers in the region and near the EPO and
CUTL1 genes. Primers for the 24mer repeat in the
JTV-related exon used in the same radiation hybrid panel
permitted assignment of STAG3L1, STAG3L2, and
STAG3L3 (5, 4, and 5 repeats, respectively) to 7q11.23 and
of STAG3L4 (2 repeats) and STAG3L5 to 7q22, very
close to the ancestral STAG3 gene. STAG3L6 does
not contain the sequence of primer STAG3LE1D and was not mapped in the
radiation hybrids. No STAG3-like sequences have been
identified in the vicinity of the PMS2-JTV1 locus
in 7p22. The human genomic BAC clone RG161A02 has been completely
sequenced as part of the Human Genome Project and contains the nine
last exons of the ancestral STAG3 gene, as well as the
entire STAG3L4-like gene. STAG3L5 is located on
BAC RG313A17, which also contains the CUTL1 gene. No physical
contiguity has been established between STAG3/STAG3L4 and
STAG3L5 loci, although they must be very close according to
the radiation hybrid data. STAG3L6 is located on BAC
NH0166A04, which also contains the dinucleotide repeat locus D7S645
that has been assigned to 7q11.22. STAG3L1, STAG3L2, and
STAG3L3 are located on large genomic blocks of low copy
repeat elements that flank the region commonly deleted in WBS, which
include the GTF2I (19)
and NCF1 loci
(middle blocks) as well as the respective pseudogenes
GTF2IP1 and NCF1P1 (centromeric blocks),
GTF2IP2, and NCF1P2 (telomeric blocks) (19
, 30)
. STAG3L1 and STAG3L2 contain the
polymorphic loci D7S489C and A, respectively, which have previously
been mapped close to the WBS deletion breakpoints immediately outside
the deleted interval (15)
.
Mapping of the murine Stag3 gene
An AluI PCRFLP in the 3'UTR was identified between the
Mus musculus C57BL/6J strain and M. spretus. By
typing 50 random samples from the F2 progeny of the EUCIB backcross
panel, the Stag3 locus was assigned to mouse chromosome 5 at
cM 67 (Fig. 7
). This region harbors other polymorphic markers and genes such as
Epo and Pcolce, thus extending the region of
conserved synteny between mouse distal chromosome 5 and human 7q22
(Fig. 7)
. In contrast to humans, the Stag3 gene appears to
be encoded by a single locus in the mouse. This further supports the
hypothesis that STAG3 is the ancestral gene, given its
evolutionarily conserved functions and its orthologous map location
relative to the unique mouse Stag3 gene. Recent evolutionary
genomic duplications have thus led to a family of adjacent (7q22) and
relatively dispersed (7q11.22/7q11.23) truncated copies of the
ancestral gene in humans.
|
| DISCUSSION |
|---|
|
|
|---|
Given its expression pattern, it appears that STAG3 is a
meiosis-specific member of the highly conserved family of stromalin
nuclear proteins. The S. cerevisiae stromalin homologue has
recently been characterized as a subunit of the cohesin complex in
yeast, and has been renamed Scc3p (10)
. Cohesin complexes
in yeast and Xenopus are reported to be necessary for sister
chromatid cohesion during mitosis. In yeast, the cohesin complex
mediates cohesion until the metaphase-anaphase transition
(10)
, whereas in vertebrates ~95% of the cohesin
subunits dissociate from chromatin at the onset of mitosis
(37)
. Based on amino acid similarity between Scc3p and the
stromalins STAG1 and STAG2 (7
, 10)
and on the expression
pattern of these two mammalian proteins, we suggested that the role of
STAG1 and STAG2 in the mammalian cell cycle is similar to that of Scc3p
(C. Carreiro et al., unpublished results). The degree of
sequence identity between STAG3 and STAG1/STAG2, as well as our results
on STAG3 expression throughout meiosis, are compatible with a model in
which STAG3 is involved in chromosome cohesion in zygotene, different
from cohesion between sister chromatids in the mitotic chromosome; it
also participates in this cohesion in chromosome synapsis in pachytene.
In addition to the previously mentioned mismatch repair genes, an
autosomal recessive mutation, morc, has recently been
described. This mutation results in spermatogenesis arrest early in
meiosis prophase I in mouse, generating specific male infertility
(38)
. In humans, infertility is a common clinical problem,
affecting ~10% of couples. It has a significant familial component,
with autosomal recessive inheritance estimated for half of male cases
(39)
. Due to the complex regulation of germ cell line
maturation, many genes are likely to be involved in human infertility.
The DAZ (deleted in azoospermia) gene on the long arm of
the human Y chromosome has been identified as a strong candidate for
the azoospermia factor (AZF) (40)
. Its role
in spermatogenesis is supported by its exclusive expression in testis,
its deletion in a large percentage of males with azoospermia or severe
oligospermia, and its homology with a Drosophila male
infertility gene boule. Several forms are known in which
a deficiency in synapsis during meiosis is evidenced by a deficiency of
chiasmas in meiotic preparations from the testis (oligosynapsis
infertility, OMIM #258150) (41)
. The only autosomal locus
proposed as a candidate for autosomal recessive male infertility is
that encoding DAZLA (DAZ-like autosomal)
(42)
.
In a family with probable autosomal recessive inheritance, 3
azoospermatic brothers out of 13 sibs from a consanguineous marriage
were found to have a unique pattern of testicular histology, with
arrest of spermatogenesis at the pachytene stage of primary
spermatocytes and an otherwise normal phenotype (43)
.
Based on the specific expression pattern and predicted function of
STAG3, it is a good candidate for genetic forms of male infertility in
which spermatogenesis arrest at the first spermatocyte level is the
principal feature.
We characterized the STAG3-derived low copy number
repeat elements in the vicinity of the breakpoint hotspots that cause
WBS deletions at chromosome band 7q11.23, as well as in 7q11.22 and
chromosome band 7q22. The regions 7q11.23 and 7q22 are involved in
germline and somatic cytogenetic aberrations with relatively high
frequency (44
, 45)
, and there is little data addressing
the mechanisms of these rearrangements. WBS is a haploinsufficiency
disorder with multi-system manifestations and sporadic occurrence in
the majority of cases, indicating a very high mutation rate, close to
5 x 10-5 per gamete/generation. Most WBS deletions
arise as a consequence of unequal meiotic crossover events
(17)
. The fact that deletion breakpoints in WBS patients
appear to cluster in genomic regions that are part of a duplication and
close to STAG3L copies indicates that unequal
recombination occurs in a very precise manner in multiple unrelated WBS
chromosomes, and further supports the concept of a common mechanism for
the deletions. Since STAG3 may be implicated in some of the mechanisms
of meiotic recombination that include reciprocal breakage, exchange of
DNA segments, and rejoining of chromatids, it is intriguing to find
STAG3-related genes located in genomic regions involved
in frequent, precise rearrangements. It is thus tempting to speculate
that the large duplicated regions flanking the WBS deleted interval,
which are a hotspot for misalignment during meiosis, may also serve as
Z-elements or affect local chromatin structure and mediate some of the
unequal crossover events that cause the WBS deletions.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.A. Brieno-Enriquez, P. Robles, R. Garcia-Cruz, I. Roig, L. Cabero, F. Martinez, and M. Garcia Caldes A new culture technique that allows in vitro meiotic prophase development of fetal human oocytes Hum. Reprod., January 1, 2010; 25(1): 74 - 84. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ianzini, E. A. Kosmacek, E. S. Nelson, E. Napoli, J. Erenpreisa, M. Kalejs, and M. A. Mackey Activation of Meiosis-Specific Genes Is Associated with Depolyploidization of Human Tumor Cells following Radiation-Induced Mitotic Catastrophe Cancer Res., March 15, 2009; 69(6): 2296 - 2304. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Peters, A. Tedeschi, and J. Schmitz The cohesin complex and its roles in chromosome biology Genes & Dev., November 15, 2008; 22(22): 3089 - 3114. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Kehoe, M. Oka, K. E. Hankowski, N. Reichert, S. Garcia, J. R. McCarrey, S. Gaubatz, and N. Terada A Conserved E2F6-Binding Element in Murine Meiosis-Specific Gene Promoters Biol Reprod, November 1, 2008; 79(5): 921 - 930. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hamer, H. Wang, E. Bolcun-Filas, H. J. Cooke, R. Benavente, and C. Hoog Progression of meiotic recombination requires structural maturation of the central element of the synaptonemal complex J. Cell Sci., August 1, 2008; 121(15): 2445 - 2451. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Jones Meiosis in oocytes: predisposition to aneuploidy and its increased incidence with age Hum. Reprod. Update, March 1, 2008; 14(2): 143 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Wilson, J. Cheung, D. W. Martindale, S. W. Scherer, and B. F. Koop Comparative analysis of the paired immunoglobulin-like receptor (PILR) locus in six mammalian genomes: duplication, conversion, and the birth of new genes Physiol Genomics, November 21, 2006; 27(3): 201 - 218. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hamer, K. Gell, A. Kouznetsova, I. Novak, R. Benavente, and C. Hoog Characterization of a novel meiosis-specific protein within the central element of the synaptonemal complex J. Cell Sci., October 1, 2006; 119(19): 4025 - 4032. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Storre, A. Schafer, N. Reichert, J. L. Barbero, S. Hauser, M. Eilers, and S. Gaubatz Silencing of the Meiotic Genes SMC1{beta} and STAG3 in Somatic Cells by E2F6 J. Biol. Chem., December 16, 2005; 280(50): 41380 - 41386. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Revenkova and R Jessberger Keeping sister chromatids together: cohesins in meiosis Reproduction, December 1, 2005; 130(6): 783 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chelysheva, S. Diallo, D. Vezon, G. Gendrot, N. Vrielynck, K. Belcram, N. Rocques, A. Marquez-Lema, A. M. Bhatt, C. Horlow, et al. AtREC8 and AtSCC3 are essential to the monopolar orientation of the kinetochores during meiosis J. Cell Sci., October 15, 2005; 118(20): 4621 - 4632. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Antonell, O. de Luis, X. Domingo-Roura, and L. A. Perez-Jurado Evolutionary mechanisms shaping the genomic structure of the Williams-Beuren syndrome chromosomal region at human 7q11.23 Genome Res., September 1, 2005; 15(9): 1179 - 1188. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Trelles-Sticken, C. Adelfalk, J. Loidl, and H. Scherthan Meiotic telomere clustering requires actin for its formation and cohesin for its resolution J. Cell Biol., July 18, 2005; 170(2): 213 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
I Roig, P Robles, R Garcia, I Martinez-Flores, L. Cabero, J Egozcue, B Liebe, H Scherthan, and M Garcia Chromosome 18 pairing behavior in human trisomic oocytes. Presence of an extra chromosome extends bouquet stage Reproduction, May 1, 2005; 129(5): 565 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Parra, A. Viera, R. Gomez, J. Page, R. Benavente, J. L. Santos, J. S. Rufas, and J. A. Suja Involvement of the cohesin Rad21 and SCP3 in monopolar attachment of sister kinetochores during mouse meiosis I J. Cell Sci., March 1, 2004; 117(7): 1221 - 1234. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Liebe, M. Alsheimer, C. Hoog, R. Benavente, and H. Scherthan Telomere Attachment, Meiotic Chromosome Condensation, Pairing, and Bouquet Stage Duration Are Modified in Spermatocytes Lacking Axial Elements Mol. Biol. Cell, February 1, 2004; 15(2): 827 - 837. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Wang, J. Yoder, I. Antoshechkin, and M. Han Caenorhabditis elegans EVL-14/PDS-5 and SCC-3 Are Essential for Sister Chromatid Cohesion in Meiosis and Mitosis Mol. Cell. Biol., November 1, 2003; 23(21): 7698 - 7707. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Molyneaux, H. Zinszner, P. S. Kunwar, K. Schaible, J. Stebler, M. J. Sunshine, W. O'Brien, E. Raz, D. Littman, C. Wylie, et al. The chemokine SDF1/CXCL12 and its receptor CXCR4 regulate mouse germ cell migration and survival Development, September 15, 2003; 130(18): 4279 - 4286. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Voet, B. Liebe, C. Labaere, P. Marynen, and H. Scherthan Telomere-independent homologue pairing and checkpoint escape of accessory ring chromosomes in male mouse meiosis J. Cell Biol., September 1, 2003; 162(5): 795 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Page and R. S. Hawley Chromosome Choreography: The Meiotic Ballet Science, August 8, 2003; 301(5634): 785 - 789. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eijpe, H. Offenberg, R. Jessberger, E. Revenkova, and C. Heyting Meiotic cohesin REC8 marks the axial elements of rat synaptonemal complexes before cohesins SMC1{beta} and SMC3 J. Cell Biol., March 3, 2003; 160(5): 657 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hirano The ABCs of SMC proteins: two-armed ATPases for chromosome condensation, cohesion, and repair Genes & Dev., February 15, 2002; 16(4): 399 - 414. [Full Text] [PDF] |
||||
![]() |
E. Revenkova, M. Eijpe, C. Heyting, B. Gross, and R. Jessberger Novel Meiosis-Specific Isoform of Mammalian SMC1 Mol. Cell. Biol., October 15, 2001; 21(20): 6984 - 6998. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pelttari, M.-R. Hoja, L. Yuan, J.-G. Liu, E. Brundell, P. Moens, S. Santucci-Darmanin, R. Jessberger, J. L. Barbero, C. Heyting, et al. A Meiotic Chromosomal Core Consisting of Cohesin Complex Proteins Recruits DNA Recombination Proteins and Promotes Synapsis in the Absence of an Axial Element in Mammalian Meiotic Cells Mol. Cell. Biol., August 15, 2001; 21(16): 5667 - 5677. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sumara, E. Vorlaufer, C. Gieffers, B. H. Peters, and J.-M. Peters Characterization of Vertebrate Cohesin Complexes and Their Regulation in Prophase J. Cell Biol., November 13, 2000; 151(4): 749 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Losada, T. Yokochi, R. Kobayashi, and T. Hirano Identification and Characterization of Sa/Scc3p Subunits in the Xenopus and Human Cohesin Complexes J. Cell Biol., August 7, 2000; 150(3): 405 - 416. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |