HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by ZHAO, W. Articles by ALKON, D. L. Search for Related Content PubMed PubMed Citation Articles by ZHAO, W. Articles by ALKON, D. L.

Spatial learning induced changes in expression of the ryanodine type II receptor in the rat hippocampus

WEIQIN ZHAO^*1, NOAM MEIRI, HUI XU^*, SEBASTIANO CAVALLARO^*,§,¶, ALESSANDRO QUATTRONE^*, LEI ZHANG and DANIEL L. ALKON^*

^* Laboratory of Adaptive Systems, National Institute of Neurological Disorders and Stroke, National Institutes of Health;
Behavioral Endocrinology Branch, National Institute of Mental Health, National Institutes of Health, Bethesda, Maryland 20892, USA;
Institute of Animal Science, ARO, The Volcani Center, Bet Dagan 50250, Israel;
^§ Institute of Bioimaging and Pathophysiology of the Central Nervous System, CNR Catania, Italy; and
^¶ Oasi Institute for Research on Mental Retardation and Brain Aging (IRCCS), Troina (EN), Italy

¹Correspondence: Laboratory of Adaptive Systems, NINDS, National Institutes of Health, Building 36, Room 4A22, 36 Convent Dr., Bethesda, MD 20892, USA. E-mail: wqzhao{at}helix.nih.gov

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Calcium signaling critical to neural functions is mediated through Ca²⁺ channels localized on both the plasma membrane and intracellular organelles such as endoplasmic reticulum. Whereas Ca²⁺ influx occurs via the voltage- or/and ligand-sensitive Ca²⁺ channels, Ca²⁺ release from intracellular stores that amplifies further the Ca²⁺ signal is thought to be involved in more profound and lasting changes in neurons. The ryanodine receptor, one of the two major intracellular Ca²⁺ channels, has been an important target for studying Ca²⁺ signaling in brain functions, including learning and memory, due to its characteristic Ca²⁺-induced Ca²⁺ release. In this study, we report regional and cellular distributions of the type-2 ryanodine receptor (RyR2) mRNA in the rat brain, and effects of spatial learning on RyR2 gene expression at mRNA and protein levels in the rat hippocampus. Using in situ hybridization, reverse transcription polymerase chain reaction, and ribonuclease protection assays, significant increases in RyR2 mRNA were found in the hippocampus of rats trained in an intensive water maze task. With immunoprecipitation and immunoblotting, protein levels of RyR2 were also demonstrated to be increased in the microsomal fractions prepared from hippocampi of trained rats. These results suggest that RyR2, and hence the RyR2-mediated Ca²⁺ signals, may be involved in memory processing after spatial learning. The increases in RyR2 mRNA and protein at 12 and 24 h after training could contribute to more permanent changes such as structural modifications during long-term memory storage. Zhao, W., Meiri, N., Xu, H., Cavallaro, S., Quattrone, A., Zhang, L., Alkon, D. A. Spatial learning induced changes in expression of the ryanodine type II receptor in the rat hippocampus.

Key Words: water maze task • learning and memory • calcium • mRNA • in situ hybridization

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
THE SPATIOTEMPORAL DISTRIBUTION of intracellular free Ca²⁺ levels is critically involved in higher brain activities including learning and memory (1 , 2) . During neuronal activation, elevation of cytoplasmic [Ca]_i is initially generated by Ca²⁺ influx through voltage- or ligand-gated Ca²⁺ channels. Subsequently, activation of IP3 (IP3R) and ryanodine (RyR) receptors on the endoplasmic reticulum membrane leads to Ca²⁺ release from intracellular stores, which further amplifies and/or prolongs Ca²⁺ signals in specific subcellular compartments (3 4 5) . The IP3R is activated by the second messenger IP3 produced via action of phospholipase C, a membrane-bound enzyme, activity of which is largely associated with activation of G protein-coupled receptors. The RyR, on the other hand, is primed by the Ca²⁺ signal per se, leading to Ca²⁺-induced Ca²⁺ release (CICR) (6 , 7) . Three different genes coding for isoforms of RyR have been identified and cloned (referred to as RyR-1, -2, and -3), among which the RyR2 gene appears to be the most ancient and conserved during evolution (8) . For all three isoforms of RyR, mRNA has been detected in the rabbit and mouse brain, with RyR2 mRNA showing the most abundant expression (9 , 10) . In addition, ryanodine binding studies have also demonstrated distribution of RyRs in the rat (11) and avian (12) brain.

Originally found in muscle, CICR has also been demonstrated in neurons where intracellular Ca²⁺ release from ryanodine receptors is found to be linked to Ca²⁺ influx through voltage-dependent channels (13 14 15) . In cerebellar Purkinje cells, for example, Ca²⁺ influx via activation of both ionotropic and metabotropic glutamate receptors is shown to be essential for subsequent RyR-mediated Ca²⁺ release (15) . In addition, Ca²⁺ release from intracellular stores via RyRs is reported to be required for induction of long-term potentiation in the hippocampus (16 , 17) and long-term depression in both the hippocampus and cerebellum (17 18 19) . Thus, as it is in muscle, CICR appears to play a vital role in neuronal functions including those that regulate synaptic efficacy.

Given the highly dynamic nature of Ca²⁺ signaling in neural cells, it is not surprising that expression of Ca²⁺ release channels is also subjected to change in response to neuronal activities. Indeed, using a differential display (RNA fingerprint) screening method, this laboratory (20) previously reported a temporary increase in RyR2 mRNA in regions of the rat hippocampus after a 1 day trial water maze training experience. Systematic distribution of RyR2 mRNA in the rat brain and the actual protein levels, however, were not examined, particularly as a function of intensive training. In this paper, we studied the regional and cellular distribution of RyR2 mRNA in the rat central nervous system (CNS), as well as expression of RyR2 mRNA after an intensive training experience in the Morris water maze (MWM) task, which produces long-lasting spatial memory (21) . Changes in RyR2 at the protein level were also investigated using immunoblotting and immunoprecipitation.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Water maze training
Male 60- to 90-day-old Wistar rats (200–250 g) were used in the MWM training paradigm. Rats were housed in standardized conditions described elsewhere (20) . To familiarize rats with the experimental environment and behavioral activity, all rats were subjected during the first day of experiments to 2 min of swimming in a 1.5 m (diameter) x 0.6 m (depth) pool, with water temperature set at 25 ± 1°C. On the following day, rats were divided into different groups and trained in a 4-trial MWM task, each trial lasting up to 2 min. During training rats learned to escape from water by finding an unseen rigid platform submerged ~1 cm below the water surface. For rats to locate the platform using spatial memory, the platform was placed in a fixed location in the pool during the course of training. The escape latency during each trial was measured. In some cases, rats unable to find the platform within 2 min in the first trial were guided to it by the experimenter. If, however, the escape latency for any rat exceeded 2 min after the first trial, the animal was eliminated from the experiment. This 4-trial training task was repeated for 4 consecutive days. For the purpose of histo- and biochemical examinations, a designated number of rats from each group were killed, by decapitation, at 12 or 24 h after the fourth training day; their brains were rapidly removed, frozen on dry ice, and stored at -80°C before use. Control animals were subjected to the same swimming trials except that the platform was removed from the pool. Those controls were also killed at 12 or 24 h after the last swimming trial.

To assess memory retention of rats after training, the rats remaining in each group were subjected to a quadrant test at 12 or 24 h after the fourth day of training. During testing, rats swam for 1 min in the pool where the platform was removed. A map of their swimming route was drawn by the experimenter, from which the number of crossings of each quadrant by each trained and control rat was counted.

The experiments were carried out under the guidelines of NIH regulations for the Care and Use of Animals for Scientific Purposes.

Preparation of brain slices
Brains from naive, trained, and swimming control rats were sectioned at 12 µm in a cryostat at -20°C. Sections were collected on silanated glass slides (DIGENE) and dried at room temperature before being returned to -80°C for storage.

Preparation of the RyR2 riboprobe for in situ hybridization
A fragment of cDNA corresponding to bases 1–360 of the previously characterized rat RyR2 mRNA (GeneBank accession no.: U95157) was synthesized by polymerase chain reaction (PCR) from the 1.6-kb RyR2 cDNA plasmid using specific primers (forward: AATCAAAGTGGCGGAATTTCTTG; reverse: TCTCCCTCAGCCTTCTCCGGTTC). This fragment, which was found to share no significant homology with cDNA sequences of the type 1 and 3 RyRs or with any other sequence expressed in the rat brain, was subcloned into the SrfI cloning site of pPCR-Script Amp SK(+) vector (Stratagene, San Diego, Calif.). The orientation of the insert was determined by DNA sequencing. After linearization with the restriction enzyme BamHI, the RyR2 cDNA-inserted vector was used as a template for riboprobe synthesis with the MAXIscript in vitro transcription kit (Ambion, Austin, Tex.). The sense and antisense riboprobes were synthesized with T7 or T3 RNA polymerase (Ambion), respectively, in the presence of 1 µg RyR2 DNA template, 0.5 mM ATP, 0.5 mM CTP, 0.5 mM GTP, and 2 mM [-³⁵S] UTP (>1000 Ci/mmol, NEN). The transcribed product was purified on a Sephadex G-25 spin column (5 Prime-3 Prime, Inc.), and the final labeling to the probe was assessed by scintillation counting.

In situ hybridization (ISH)
Brain slices were fixed for 5 min in 4% formaldehyde, acetylated, and dehydrated in graded ethanol. Fifty microliters of the RyR2 riboprobe (1x10⁶ cpm) was applied to each slide holding three sections and hybridized in a mixture containing 20 mM Tris-HCl, pH 7.4, 1 mM EDTA, 300 mM NaCl, 50% formamide, 10% dextran sulfate, 1x Denhardt’s solution, 4 µg/ml salmon sperm DNA, 10 µg/ml yeast total RNA, 10 µg/ml yeast tRNA, 100 mM DTT, 0.1% sodium dodecyl sulfate (SDS), 0.1% NTS. Hybridization was carried out at 55°C for 20 h. Sections pretreated with RNase or incubated with the sense probe during hybridization were used as negative controls. After high-stringency posthybridization washes and RNase treatment, brain sections were dehydrated in graded ethanol. Slides were then subjected to film autoradiography for brain regional resolution and to liquid emulsion autoradiography for analysis of hybridization signals at the cellular level.

Reverse transcription (RT)-PCR
Trained and control rats were killed 12 or 24 h after training by decapitation, and their hippocampi were rapidly dissected and frozen on dry ice. The hippocampal total RNA from each rat was extracted using the RNA Isolator (Genosys). Single-strand cDNAs were then synthesized in a reverse transcription reaction in the presence of 3 µg total RNA and the first-strand cDNA synthesis mix (Novagen, Madison, Wis.) containing 0.5 µg oligo (dT) 0.5 mM dNTPs, 60 µM [-³²P] dATP, 10 mM DTT and 100 U MMLV reverse transcriptase. Amplification of a 157 bp RyR2 cDNA fragment was performed on a DNA thermal cycler 480 (Perkin-Elmer, Norwalk, Conn.) through a 23 cycle PCR reaction (94°C 1 min, 55°C 1 min, and 74°C 2 s) with primers 5'-CTACTCAGGATGAGGTGCGA-3' (forward), and 5'-CTCTCTTCAGATCCAAGCCA-3' (reverse). To control for possible experimental errors crossing each individual sample, primers (forward: 5'-AGGTGCTCAACAACATGGAG-3'; reverse: 5'-TACCAGAGGCCACAGTAGCT-3') synthesizing a 183 bp rat phosphoglycerate kinase 1 (PGK1) cDNA fragment (20) were included in the PCR amplification. The final PCR products were separated on a 2% agarose gel and visualized with ethidium bromide. To quantify the results, optic density of the PCR product bands was measured using the NIH Image 1.6 program. Alternatively, the PGK1 or the RyR2 band was excised from the agarose gel, placed individually in 100 µl water and melted at 60°C. After addition with scintillation fluid, the radioactivity of each above band from each sample was counted in a scintillation counter.

Ribonuclease protection assays (RPA)
Hippocampal total RNA from control and trained rats were prepared as described above. The RyR2 cDNA fragment (bp 1–360) subcloned into the pPCR-Script Amp SK (+) vector was digested at base 657 of the vector with the KpnI restriction enzyme. Using this template, a 475 bp riboprobe (including the RyR2 fragment and a part of the vector sequence) was synthesized with T3 polymerase using the MAXIscript in vitro transcription kit (Ambion). For the positive control, the pTRI-Actin-Mouse vector provided with the MAXIscript kit was used to synthesize a 304 bp riboprobe complementary to the mouse ß-actin with T7 polymerase. Both RyR2 and ß-actin riboprobes were labeled with [-³²P] UTP during synthesis. The RPA experiments were performed using the RPA III kit (Ambion), following the standard protocol provided by the manufacturer. Optimal concentrations for both probes were predetermined, with 8 x 10⁵ cpm of RyR2 probe and 8 x 10⁴ cpm of pTRI-Actin-Mouse probe applied together to 10 µg total RNA from each rat for the hybridization. The protected fragments were separated by electrophoresis in a mini 6% denaturing polyacrylamide gel (Novex). The expected sizes for the protected RyR2 and ß-actin mRNA fragments are 360 bp and 245 bp, respectively. Signals were analyzed with autoradiography.

Preparation of microsomal fractions from hippocampal tissues
Hippocampal microsomes were prepared using differential centrifugation. Briefly, hippocampi from each animal were individually homogenated, using a Teflon-glass homogenizer, in a homogenizing buffer containing 5 mM HEPES, pH 7.4, 0.32 M sucrose, and the protease inhibitor mixture (Boehringer Mannheim, Mannheim, Germany). The homogenate was diluted to 10% of wet weight of the tissue in the homogenizing buffer and centrifuged at 900 x g for 5 min. The supernatant was preserved and the pellet was resuspended in the homogenizing buffer and centrifuged at 900 x g for 5 min. The supernatants from the above two steps were combined and centrifuged at 17,000 x g for 15 min. The resulting supernatant from this step was again subjected to centrifugation at 100,000 x g for 30 min. The pellet was harvested as the microsomal fraction and resuspended in 5 mM HEPES, pH 7.4, together with the protease inhibitor mixture (Boehringer Mannheim). Protein concentrations were measured using Bio-Rad protein assay reagent.

Immunoprecipitation of RyR
Hippocampal RyR proteins from each rat were immunoprecipitated with a monoclonal anti-RyR antibody, which reacts strongly with RyR2 but weakly with RyR1 (Research Diagnostics). Immunoprecipitation was carried out in a medium (0.5 ml) containing 50 mM Tris (pH 7.1), 300 mM NaCl, 10 mM EGTA, 2 mM EDTA, 1% Triton X-100, 0.3% ß-mercaptoethanol, a dose of the protease inhibitor mixture mix, 10 µg/ml microsomal protein, and 1 µg anti-RyR antibody. The mixture was rocked at 4°C overnight. The washed protein A-agarose (Gibco BRL, 30µl) was added and the mixture rocked at 4°C for two more hours. After washing with the above immunoprecipitation buffer three times, the protein A agarose bead–sample complex was mixed with 20 µl of SDS-PAGE (SDS-polyacrylamide gel electrophoresis) sample buffer, boiled for 10 min, and subjected to SDS-PAGE.

Immunoblotting
Hippocampal microsomes (10 µg total protein) or immunoprecipitated RyR from each rat was electrophoresed on a 4–20% mini-gradient SDS gel (Novex),, followed by transfer to a nitrocellulose membrane. For quantitation, microsomal fractions with a series of total protein concentrations were also separated with SDS-PAGE transferred to a nitrocellulose membrane. The membrane was then blocked with 5% milk in 10 mM phosphate-buffered saline (PBS), pH 7.4, at room temperature for 30 min and washed with PBS for 10 min. Incubation of the membrane with the anti-RyR antibody (1:2000) dissolved in PBS containing 0.1% Tween-20 (PBS-T) was performed at 4°C overnight with constant shaking. After application of a secondary antibody, the immunoreaction signal of RyR was detected with an indirect chemiluminescent process.

Data analysis
ISH signals in film autoradiography were quantified by measuring optical density of the target brain regions (CA1, CA3 of the hippocampus and dentate gyrus) using the NIH IMAGE 1.6 program. Integrated density in those areas of rat brains from each group was normalized as percent integrated density from naive animals. Data from five animals in each group were statistically analyzed using a 2-way analysis of variance (ANOVA). Slides processed in the liquid emulsion autoradiography were observed with a Zeiss Axioskop microscope and signals in target areas were photographed with an attached camera. Results were analyzed, using the NIH Image 1.6 program, by counting the reduced silver grains within cells that represent labeled mRNA signals. Grains in each individual cell were counted; results from 50 similar sized cells in each brain area from each animal were averaged and analyzed in a 1-way ANOVA.

Results from immunoblots, RT-PCR, and RPA were measured by densitometry using the NIH Image 1.6 program. Values for the protein, DNA, or RNA signal from each animal from both trained and swimming control groups were converted to percent of naive, and analyzed using 2-way ANOVA.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Distribution of RyR2 mRNA in the rat CNS
RyR2 mRNA was shown to be widely expressed in the rat CNS with high concentrations in the internal granular layer of the olfactory bulb, frontal cortex, pyriform cortex, hippocampal CA3 area, dentate gyrus, amygdalohippocampal area, cerebellar cortex, and the dorsal horn of the spinal cord gray matter (Fig. 1 ). In the olfactory area, RyR2 mRNA was shown to be concentrated in the internal granular layer (LGI), the anterior olfactory nucleus, and the olfactory tubercles (tu) (Fig. 1A ). The expression of RyR2 mRNA at the cellular level of LGI was shown in Fig. 2 (panel 1). In the neocortex, highly concentrated RyR2 mRNA signals were seen in the frontal cortex (Fig. 1A-C ); lower levels of the signal were present in the more posterior part (Fig. 1C, D ), where the signal was distributed mainly in the neurons of layers V-VI and moderately in the layers II-III. In the hippocampal formation, high levels of RyR2 mRNA signal were detected in the dentate gyrus and CA3. Moderate expression was seen in the CA1 and entorhinal cortex, (Fig. 1C, D ). Within the hippocampus, RyR2 mRNA signal is expressed predominately in granule cells of the dentate gyrus and pyramidal cells of the CA1 and CA3 area (Fig. 2 , panels 3–5). High-intensity labeling was also revealed in other areas such as pyriform cortex and amagdaloid complex, which have input to and/or output from the hippocampus. RyR2 mRNA was also highly concentrated in the cerebellar cortex (Fig. 1F ), expressed in both Purkinje and granule cells (Fig. 2 , panel 2). Neurons in the gray matter of the spinal cord were also shown to express RyR2 mRNA, with the dorsal horn area revealing the strongest labeling (Fig. 1G ).

View larger version (125K): [in this window] [in a new window]   Figure 1. Distribution of RyR2 mRNA in the rat CNS. A 360 bp riboprobe for RyR2 labeled with [-35S] UTP was hybridized with coronal sections of the rat forebrain, cerebellum, and spinal cord (C1-C3 part) as described in Materials and Methods. After hybridization, the labeled RyR2 mRNA signal was revealed with autoradiography. A–E) Distribution of RyR2 mRNA in the forebrain; F) labeling in the cerebellum; G) labeling in the spinal cord (C2). Results from experiment in which sagittal sections were hybridized with a sense RyR2 riboprobe or pretreated with RNase before incubating with the antisense probe are shown in panels H and I, respectively. Abbreviations: FPC, frontopolar cortex; AON, olfactory nucleus; LGI, internal granular layer of the olfactory bulb; CFm, frontal cortex, motor area; CFs, frontal cortex, somatosensory area; CCi, cingulate cortex, anterior part; Aop, anterior olfactory nucleus, CPf, pyriform cortex; tu, olfactory tubercle; HIA, anterior hippocampus; Ahi, amygdalohippocampal area; inc, insular(rhinal) cortex; CPm, parietal cortex, motor area; CPs, parietal cortex, somatosensory area; CA1, hippocampal CA1 area; CA3, hippocampal CA3 area; DG, dentate gyrus; CC, cingulate cortex, posterior part; CO, occipital cortex; Ce, entorhinal cortex; CTe, temporal (auditory) cortex; S, subiculum; CL, cerebellar lobules; PFI, parafloculus; FI, floculus; V, vermis; Py, pyramidal tract; DH, dorsal horn of the spinal cord gray matter; VH, ventral horn of the spinal cord gray matter.

View larger version (81K): [in this window] [in a new window]   Figure 2. Cellular distribution of RyR2 mRNA in particular brain areas. After emulsion autoradiography, brain sections were counterstained with cresyl violet (Sigma). Panel 1 shows a profile of internal granular layer of the olfactory bulb (LGI, 1A) and the reduced silver grains representing RyR2 mRNA within granule cells (1B). Panel 2A shows a part of the cerebellar lobules. Panel 2B demonstrates that RyR2 mRNA is distributed in both granule and Purkinje cells. The arrowheads point to Purkinje cells located above the granule cell layer. The white line around the second cell from left shows an approximate border of a Purkinje cell. Panels CA1 and CA3 show the distribution of RyR2 mRNA in the pyramidal cell of CA1 and CA3 areas, respectively, and panel DG demonstrates expression of RyR2 mRNA in the granule cell of dentate gyrus.

Panels H and I in Fig. 1 showed that RyR2 riboprobe incubated with RNase-pretreated sections and that brain sections incubated with the sense probe produced no labeling, indicating the specificity of the RyR2 antisense riboprobe. The overall distribution of RyR2 mRNA in the rat brain is listed in Table 1 .

Learning and memory retention
The escape latency was significantly reduced after the first trial (Fig. 3 ). By the fourth trial of the first training day, rats were able to find and reach the platform within 20 s. In the after 3 days of training, all rats were able to rapidly locate the platform for escape, demonstrating clear evidence of learning. A 1-way ANOVA showed that the escape latency in the first trial of day 1 of training was significantly different from that in all subsequent trials given on days 1, 2, 3, and 4 of training [F(15, 239)=6, P<0.001]. When tested in a quadrant test at 12 and 24 h after the fourth day of training, the trained rats spent a significantly longer time swimming in the quadrant where the platform was previously placed, whereas the swimming controls moved across all quadrants equally (Fig. 3B ). A one-way ANOVA yielded significant quadrant differences at both 12 h [F(7, 39)=10.30, P<0.001] and 24 h [F(7, 39)=17.45, P<0.001] after training. These results indicate that the rats have formed a clear spatial memory after the training experience.

View larger version (32K): [in this window] [in a new window]   Figure 3. Behavioral results in water maze training. Rats were trained on a MWM task receiving 4 trials/day for 4 consecutive days. A) The mean escape latency of rats in each training trial for each day. B) Results from a quadrant test at the end of experiments. During the 1 min test, the trained rats spent most of the time swimming within quadrant 4, where a platform for escape was previous located. n = 6, *P < 0.001.

Changes in RyR2 mRNA level after spatial leaning
Brain sections from trained and control rats hybridized with the RyR2 riboprobe showed a significant increase in the relative levels of RyR2 mRNA in the hippocampal CA1 and CA3 and the dentate gyrus (DG) area both 12 and 24 h after the MWM experience (Fig. 4A ). Two-way ANOVAs produced significant group effects in the CA1 [F(1, 48)=49.4, P<0.001], CA3 [F(1, 48)=32.23, P<0.001], and DG [F(1, 48)=43.92, P<0.001] area. Liquid emulsion autoradiography showed that the training-increased RyR2 mRNA signal was present in the pyramidal cells of the CA1 (Fig. 4B ) and CA3 (Fig. 4C ) area as well as the granule cells of dentate gyrus (Fig. 4D ).

View larger version (67K): [in this window] [in a new window]   Figure 4. Changes in hippocampal RyR2 mRNA after training measured by ISH. Rats trained on MWM task were killed 12 h or 24 h after training, respectively. Brain sections were prepared, followed by ISH process with the RyR2 riboprobe (see Materials and Methods). The labeled signal in the hippocampus was visualized with film (A) and liquid emulsion (B–D) autoradiography and quantified with NIH Image 1.6 program. For film autoradiography, the optical density values from trained and swimming controls were normalized against values from naive animals and subjected to a 2-way ANOVA. The pictures in panel A show the representative images from trained and control animal 12 and 24 h after training. The bar graph gives mean results of labeling in the CA1, CA3, and DG areas from each group of five animals. In the case of liquid emulsion autoradiography, the reduced silver grains representing RyR2 mRNA within the pyramidal or granule cell were counted. Values from 50 cells for each area from each animal were averaged, followed by 1-way ANOVA. B, C) RyR2 mRNA signals in the pyramidal cell of CA1 and CA3 area, respectively. RyR2 mRNA in the granule cell of DG is shown in panel D. The microscopic pictures are representative images from naive, swimming control, and trained rats killed at 12 h after training, whereas the scattered graphs show results from the total number of rats in each group. Naive rats: n=3; swimming control and trained groups: n=5.

This change in RyR2 mRNA was further examined by RT-PCR and RPA. Primers specific for RyR2 and PGK1 gave, respectively, a 157 bp (for RyR2) and a 183 bp (for PGK1) PCR amplificate. Samples from trained rats killed 12 or 24 h after training presented a small (23±6%) but significant increase in synthesized RyR2 cDNA fragment. A 2-way ANOVA yielded a significant group effect [F(1, 8)=54.35, P<0.001], but there was no obvious difference in PGK1 cDNA between trained and control rats (Fig. 5 Since the level of the PCR products reflected the amount of their mRNA from which single-strand cDNAs were reverse-transcribed, these results indicate that the mRNA level for RyR2 was increased after training.

View larger version (25K): [in this window] [in a new window]   Figure 5. Learning-induced change in RyR2 mRNA measured with RT-PCR and RPA. In RT-PCR experiments (A), total RNA from individual rats from each group was extracted, followed by a reverse transcription as described in Materials and Methods. Specific primers were used to synthesize, respectively, a 157 bp RyR2 and a 182 bp PGK1 cDNA fragment. The PCR products were separated on a 2% agarose gel and visualized with ethidium bromide staining. B) Results from RPA. The RyR2 and ß-actin riboprobes were coapplied to hippocampal total RNA during hybridization. Protected 360 bp RyR2 and 245 bp ß-actin mRNA bands were resolved on a 6% denaturing polyacrylamide gel, followed by autoradiography. Each DNA or RNA band from the above figures was measured with densitometry. Values from the control and trained animals were normalized against values from naive animals and presented as relative units. The top pictures show representative agarose or polyacrylamide gel results. M, DNA marker; N, naive rats; C, control rats; T, trained rats; 12, 12 h after training; 24, 24 h after training. The bar graphs summarize results from the total number of rats. n=3, *P < 0.01 (A); = 0.003 (B).

In RPA, a 360 bp protected mRNA band, was resolved with the RyR2 riboprobe. Consistent with both in situ hybridization and RT-PCR analyses, the densitometry measurement for RPA indicated that levels of hippocampal RyR2 mRNA from trained animals killed either 12 or 24 h after training were 18–20% higher than that from the swimming controls. A 2-way ANOVA produced a significant group effect [F(1, 8)=16.66, P=0.003]. For positive control as well as control for experimental errors across test tubes, the mouse pTRI-actin riboprobe was coapplied with RyR2 probed during hybridization. This probe resolved a major 245 bp protected band in the rat hippocampus, indicating a high homology in nucleotide sequence of the ß-actin gene between the mouse and the rat. This ß-actin mRNA band showed no apparent differences across samples from either the control or trained rats. In addition, a weak 160 bp protected band, which was not altered by training, was also produced by the pTRI-actin probe, probably due to cross-hybridization of the probe with a different mRNA in the rat hippocampus.

Changes in RyR2 protein level after spatial leaning
To test whether the training-induced increase in RyR2 mRNA level leads to a change in amount of the receptor protein, we used immunoblotting and immunoprecipitation to measure the levels of the RyR protein from hippocampal microsomes prepared from trained and control rats. The monoclonal anti-RyR antibody recognized a protein band with an apparent molecular mass of 550 kDa in the hippocampal microsomal homogenate. The intensity of the antibody-antigen reaction was basically linear with the amount of total protein loaded on the gel (Fig. 6A ). Samples from trained rats demonstrated significantly higher immunoreactivity compared with that from naive and the swimming control rats (Fig. 6B ), indicating a higher level of RyR protein present in microsomal tissues from trained animals. A 2-way ANOVA yielded a significant group effect [F(1, 8)=85.57, P<0.001]. Immunoprecipitation experiments also produced similar results (data not shown). Since the antibody used strongly reacts with the type 2 RyR, the protein band detected here by the antibody should represent mainly the RyR2 protein.

View larger version (18K): [in this window] [in a new window]   Figure 6. Immunoblotting results demonstrating changes in RyR2 protein level after training. Hippocampal microsomes were separated on 4–20% SDS-PAGE, followed by transfer to a nitrocellulose membrane. The RyR protein was detected, in an immuno-chemiluminescent process, by an anti-RyR antibody that strongly reacts with RyR2. The immunoreactive signal was measured by densitometry. A) Density of the signal is basically linear with the amount of the protein loaded on the gel. B) The gel picture shows results from a representative immunoblot and the bar graph summarizes the statistical results from the total number of rats. n = 3, *P < 0.01.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The present results describe the distribution of RyR2 mRNA in the rat brain and spinal cord, as well as changes in expression of RyR2 mRNA and protein in the rat hippocampus after spatial learning. The specific riboprobe for RyR2 mRNA produced clear and strong RyR mRNA signals in specific areas of the rat CNS. In the forebrain, RyR2 mRNA signal is particularly concentrated in the frontal cortex, olfactory regions, and the limbic system including amygdaloid complex, pyriform cortex, entorhinal cortex, and the hippocampus. The pattern of distribution of RyR2 mRNA in the forebrain is basically consistent with that in the rabbit and mouse forebrain reported previously (9 , 10) . Almost all the above areas are either directly or indirectly connected with the hippocampus. For example, the entorhinal cortex, which gives a major projection to dentate gyrus via the perforant path, receives input from the olfactory bulb, pyriform cortex, amygdala, amygdaloid complex, etc. Receiving input from dentate gyrus via mossy fibers, the CA3 area sends output to the CA1 area via the Schaffer collaterals. The CA1 then projects back to the entorhinal cortex and other regions, including the amygdala and specific areas of the frontal cortex (22 , 23) . Thus, given the major functions controlled by these brain regions, the pattern of RyR2 mRNA distribution suggests that this intracellular Ca²⁺ receptor/channel plays important roles in higher brain functions such as cognition, emotion, learning, and memory.

In the cerebellar cortex, the RyR2 mRNA signal was revealed in both Purkinje and granule cells, which is consistent with observations on RyR2 in the rabbit (9) . Since a GeneBank search shows no homology of the RyR2 cDNA sequence used to produce the riboprobe with cDNA of other isoforms of RyR, the result obtained is unlikely due to a cross-hybridization of the probe with mRNA of RyR1, which is found to be highly concentrated in the cerebellar Purkinje cell (9 , 10) . In the spinal cord, the RyR2 mRNA signal is localized mostly in the dorsal horn area where neurons give ascending projections to the brain (24) .

The second part of our results indicates that the expression of RyR2 mRNA and the levels of RyR2 receptor protein were both increased with correlation to spatial learning. After 4-trial training for four consecutive days, rats developed a clear spatial memory, as measured by the escape latency and quadrant test. Because the hippocampus has been demonstrated to be critically important for spatial learning by lesion, electrophysiology, and behavioral studies (25 26 27 28) , we focused our search for memory-related gene expression changes on this area. An increase in RyR2 mRNA level was detected in hippocampus at 12 and 24 h after training, as assessed by in situ hybridization, RT-PCR, and RNase protection assays. When rats were trained using a shorter training protocol (20) , RyR2 mRNA was increased at 6 and 12 h after a single day of 4-trial training experience and returned to the control level when measured 24 h after training. The results of both studies, therefore, indicate that changes in RyR2 mRNA levels are related to the intensity of training. More intense training tasks that produce stable long-term memory may lead to a longer lasting change in RyR2 mRNA level. This training-dependent correlation of the RyR appears to be in accord with existing results showing that expression of RyR in the muscle and the brain of both mammals and birds was increased after birth (7 , 29 , 30) .

As for all in situ hybridization, RT-PCR and RNase protection assay methods measure differences in the relative levels of labeling. It is not clear whether the increased RyR2 mRNA levels after training are due to an increase in transcription, mRNA stability, or both. The results with immunoblotting and immunoprecipitation, however, revealed an increase in the RyR2 protein levels after training, suggesting that the elevated RyR2 mRNA is translated into new receptor proteins.

Ca²⁺ signaling associated with RyR functions has been hypothesized to be an important mechanism underlying memory processing (2) , although the detailed and precise role of RyR2 in memory formation, particularly in different stages of memory processing, remains to be determined. Like other receptors, RyRs may undergo posttranslational modifications such as phosphorylation during neuronal activation without changes in its transcription and translation level. Several protein kinases are known to be activated during neuronal stimulation. These include protein kinase C, Ca²⁺/calmodulin-dependent protein kinase II, and cAMP-dependent protein kinase, some of which have been shown to be associated with learning and memory (31 32 33 34 35 36 37 38) . These kinases also phosphorylate RyR (39 , 40 , 33) . Through phosphorylation, properties of RyR (such as its sensitivity toward Ca²⁺ and the channel conductance) can be modulated, perhaps regulating thereby the activation of the receptor (5 , 39 40 41 42) .

Whereas posttranslational changes and the protein–protein interaction of RyR are likely to be associated with short-term changes immediately after learning, a permanent modification involving protein synthesis and structural changes in synapses may be induced during long-term memory storage. Amplified Ca²⁺ signals elicited during short-term memory by positive feedback mechanisms (e.g., CICR) may trigger new transcriptional processes in the nuclei via activation of particular signal transduction pathways such as Ras-Raf-MEK mitogen-activated protein kinase pathways. Specific learning-induced changes in mitogen-activated protein kinases have indeed been demonstrated in our lab recently (43). It is possible, therefore, that the intense training experience activates diverse signaling pathways leading to synthesis of new RyR, perhaps ultimately initiating more permanent changes during long-term memory storage.

	ACKNOWLEDGMENTS

 
The authors would like to thank Dr. Eva Mezey and Ms. Gyongyi Harta of In Situ Hybridization Facilities, BNP/NINDS/NIH, for their kind assistance with technical advice on our in situ hybridization experiments.

	FOOTNOTES

 
Received for publication May 19, 1999. Revised for publication October 19, 1999.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Finkbeiner, S., Greenberg, M. E. (1997) Spatial features of calcium-regulated gene expression. Bioessays 8,657-660
2. Alkon, D. L, Nelson, T. J., Zhao, W. Q., Cavallaro, S. (1998) Time domains of neuronal Ca²⁺ signaling and associative memory: steps through a calexcitin, ryanodine receptor K+ channel cascade. Trends Neurosci. 21,529-537[Medline]
3. Sorrentino, V., Volpe, P. (1993) Ryanodine receptors: how many, where and why?. Trends Pharmacol. Sci. 14,98-103[Medline]
4. Pozzan, T., Rizzuto, R., Volpe, P., Meldolesi, J. (1994) Molecular and cellular physiology of intracellular calcium stores. Physiol. Rev. 74,595-636[Free Full Text]
5. Sutko, J. L., Airey, J. A. (1996) Ryanodine receptor Ca²⁺ release channels: does diversity in form equal diversity in function?. Physiol. Rev. 76,1027-1071[Abstract/Free Full Text]
6. Meissner, G., Rousseau, E., Lai, F. A., Liu, Q. Y., Anderson, K. A. (1988) Biochemical characterization of the Ca²⁺ release channel of skeletal and cardiac sarcoplasmic reticulum. Mol. Cell Biochem. 82,59-65[Medline]
7. McPherson, P. S., Kim, Y. K., Valdivia, H., Knudson, C. M., Takekura, H., Franzini-Armstrong, C., Coronado, R., Campbell, K. P. (1991) The brain ryanodine receptor: a caffeine-sensitive calcium release channel. Neuron 7,17-25[Medline]
8. Tunwell, R. E. A., Wickenden, C., Bertrand, B. M. A., Shevchenko, V. I., Walsh, M. B., Allen, P. D., Lai, F. A. (1996) The human cardiac muscle ryanodine receptor-calcium release channel: identification, primary structure and topological analysis. Biochem. J. 318,477-487
9. Furuichi, T., Furutama, D., Hakamata, Y., Nakai, J., Takeshima, H., Mikoshiba, K. (1994) Multiple types of ryanodine receptor/Ca²⁺ release channels are differentially expressed in rabbit brain. J. Neruosci. 14,4794-4805
10. Giannini, G., Conti, A., Mammarella, S., Scrobogna, M. (1995) The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues. J. Cell Biol. 128,893-904[Abstract/Free Full Text]
11. Padua, R. A., Yamamoto, T., Fyda, D., Sawchuk, M. A., Geiger, J. D., Nagy, J. I. (1992) autoradiographic analysis of [3H] ryanodine binding sites in rat brain: regional distribution and the effects of lesions on sites in the hippocampus. J. Chem. Neruoanat. 5,63-73
12. Ellisman, M. H., Deerinck, T. J., Ouyang, Y., Beck, C. F., Tanksley, S. J., Walton, P. D., Airey, J. A., Sutko, J. L. (1990) Identification and localization of ryanodine binding proteins in the avian central nervous system. Neuron 5,135-146[Medline]
13. Murphy, S. N., Miller, R. J. (1989) Two distinct quisqualate receptors regulate Ca²⁺ homeostasis in hippocampal neurons in vitro. Mol. Pharmacol. 35,671-680[Abstract/Free Full Text]
14. Freil, D. D., Tsein, R. W. (1992) Phase-dependent contributions from Ca²⁺ entry and Ca²⁺ release to caffeine-induced [Ca²⁺]_i oscillations in bullfrog sympathetic neurons. Neuron 8,1109-1125[Medline]
15. Gruol, D. L., Netzeband, J. G., Parsons, K. L. (1996) Ca²⁺ signaling pathways linked to glutamate receptor activation in the somatic and dendritic regions of cultured cerebellar Purkinje neurons. J. Neurophysiol. 76,3325-3340[Abstract/Free Full Text]
16. Obenhaus, A., Mody, I., Baimbridge, K. G. (1989) Dantrolene-Na (Dantrium) blocks induction of long-term potentiation in hippocampal slices. Neurosci. Lett. 98,172-178[Medline]
17. Wang, Y., Wu, J., Rowan, M. J., Anwyl, R. (1996) Ryanodine produces a low frequency stimulation-induced NMDA receptor-independent long-term potentiation in the rat dentate gyrus in vitro. J. Physiol. 495,755-767
18. O’Mara, S. M., Rowan, M. J., Anwyl, R. (1995) Dantrolene inhibits long-term depression and depotentiation of synaptic transmission in the rat dentate gyrus. Lett. Neurosci. 68,621-624
19. Reyes, M., Stanton, P. K. (1996) Induction of hippocampal long-term depression requires release of Ca²⁺ from separate presynaptic and postsynaptic intracellular stores. J. Neurosci. 16,5951-5960[Abstract/Free Full Text]
20. Cavallaro, S., Meiri, N., Yi, C. L., Musco, S., Ma, W., Goldberg, J., Alkon, D. L. (1997) Late memory-related genes in the hippocampus revealed by RNA fingerprinting. Proc. Natl. Acad. Sci. USA 94,9669-9673[Abstract/Free Full Text]
21. Morris, R. G. M. (1981) Spatial localization does not require the presence of local cues. Learning Motivation 12,239-260
22. Traub, R. D., Milles, R. (1991) Neuronal networks of the hippocampus Cambridge University Press Cambridge, U.K..
23. Amaral, D. G., Witter, M. P. (1995) Hippocampal formation. Paxinos, G. eds. The Rat Nervous System 2nd Ed ,443-493 Academic Press New York.
24. Molander, C., Grant, G. (1995) Paxinos, G. eds. The Rat Nervous System 2nd Ed ,33-45 Academic Press New York.
25. O’Keefe, J., Nadel, L. (1978) The Hippocampus as a Cognitive Map Clarendon Oxford, U.K..
26. Morris, R. G. M., Garrud, J., Rawlins, N. T., O’Keefe, J. (1982) Place navigation impaired in rats with hippocampal lesions. Nature (London) 297,681-683[Medline]
27. McNaughton, B. L., Morris, R. G. M. (1987) Hippocampal synaptic enhancement and information storage. Trends Neurosci 10,408-415
28. Muller, R. U., Stead, M. (1996) Hippocampal place cells connected by Hebbian synapses can solve spatial problems. Hippocampus 6,709-719[Medline]
29. Airey, J. A., Beck, C. F., Murakami, K., Tanksley, S. J., Deerinck, T. J., Ellisman, M. H., Sutko, J. L. (1990) Identification and localization of two triad junctional foot protein isoforms in mature avian fast twitch skeletal muscle. J. Biol. Chem. 265,14187-14194[Abstract/Free Full Text]
30. Arai, M., Otsu, K., Maclennan, D. H., Periasamy, M. (1992) Regulation of sarcoplasmic reticulum gene expression during cardiac and skeletal muscle development. Am. J. Physiol. 262,H614-H620
31. Acosta-Urquidi, J., Alkon, D. L., Neary, J. T. (1984) Ca²⁺-dependent protein kinase injection in a photoreceptor mimics biophysical effects of associative learning. Science 224,1254-1257[Abstract/Free Full Text]
32. Sakakibara, M., Alkon, D. L., DeLorenzo, R., Goldenring, J. R., Neary, J. T., Heldman, E. (1986) Modulation of calcium-mediated inactivation of ionic currents by Ca²⁺/calmodulin-dependent protein kinase II. Biophys. J. 50,319-327[Abstract/Free Full Text]
33. Hanson, P. I., Schulman, H. (1992) Neuronal Ca²⁺/calmodulin-dependent protein kinases. Annu. Rev. Biochem. 61,559-601[Medline]
34. Fagnou, D. D., Tuchek, J. M. (1995) The biochemistry of learning and memory. Mol. Cell Biochem. 149–150,279-286
35. Van der Zee, E. A., Douma, B. R. (1997) Historical review of research on protein kinase C in learning and memory. Prog. Neuropsychopharmacol. Biol. Psychiatry 21,379-406[Medline]
36. Rosenzweig, M. R., Bennett, E. L., Colombo, P. J., Lee, D. W., Serrano, P. A. (1993) Short-term, intermediate-term, and long-term memories. Behav. Brain Res. 57,193-198[Medline]
37. Kornhauser, J. M., Greenberg, M. E. (1997) A kinase to remember: dual roles for MAP kinase in long-term memory [comment]. Neuron 18,839-842[Medline]
38. Zhao, W. Q., Lawen, A., and Ng, K. T. (1999) Changes in phosphorylation of Ca²⁺/calmodulin-dependent protein kinase II (CaMKII) in processing of short-term and long-term memories following passive avoidance learning. J. Neurosci. Res. In press
39. Takasago, T., Imagawa, T., Furukawa, K., Ogurusu, T., Shigekawa, M. (1991) Regulation of the cardiac ryanodine receptor by protein kinase dependent phosphorylation. J. Biochem. (Tokyo) 109,103-170
40. Witcher, D. R., Kovacs, R. J., Schulman, H., Cefali, D. C., Jones, L. R. (1991) Unique phosphorylation site on the cardiac ryanodine receptor regulates calcium channel activity. J. Biol. Chem. 266,11144-11152[Abstract/Free Full Text]
41. Coronado, R., Morrissette, J., Sukhareva, M., Baughan, D. M. (1994) Structure and function of ryanodine receptors. Am. J. Physiol. 266,C1485-C1504[Abstract/Free Full Text]
42. Meissner, G. (1994) Ryanodine receptor/Ca²⁺ release channels and their regulation by endogenous effectors. Annu. Rev. Physiol. 56,484-508
43. Zhao, W. Q., Chen, H., Xu, H., Moore, E., Meiri, N., Quon, M. J., Alkon, D. L. (1999) Brain insulin receptors and spatial memory: Correlated changes in gene expression, tyrosine phosphorylation, and signaling molecules in the hippocampus of water maze trained rats. J. Biol. Chem. 274,34893-34902[Abstract/Free Full Text]

This article has been cited by other articles:

				N. Galeotti, A. Quattrone, E. Vivoli, M. Norcini, A. Bartolini, and C. Ghelardini Different involvement of type 1, 2, and 3 ryanodine receptors in memory processes Learn. Mem., April 25, 2008; 15(5): 315 - 323. [Abstract] [Full Text] [PDF]

				S. Kim, H.-M. Yun, J.-H. Baik, K. C. Chung, S.-Y. Nah, and H. Rhim Functional Interaction of Neuronal Cav1.3 L-type Calcium Channel with Ryanodine Receptor Type 2 in the Rat Hippocampus J. Biol. Chem., November 9, 2007; 282(45): 32877 - 32889. [Abstract] [Full Text] [PDF]

				D. L. Alkon, H. Epstein, A. Kuzirian, M. C. Bennett, and T. J. Nelson Protein synthesis required for long-term memory is induced by PKC activation on days before associative learning PNAS, November 8, 2005; 102(45): 16432 - 16437. [Abstract] [Full Text] [PDF]

				A. Verkhratsky Physiology and Pathophysiology of the Calcium Store in the Endoplasmic Reticulum of Neurons Physiol Rev, January 1, 2005; 85(1): 201 - 279. [Abstract] [Full Text] [PDF]

				J. Gafni, P. W. Wong, and I. N. Pessah Non-coplanar 2,2',3,5',6-Pentachlorobiphenyl (PCB 95) Amplifies Ionotropic Glutamate Receptor Signaling in Embryonic Cerebellar Granule Neurons by a Mechanism Involving Ryanodine Receptors Toxicol. Sci., January 1, 2004; 77(1): 72 - 82. [Abstract] [Full Text] [PDF]

				S. Cavallaro, V. D'Agata, P. Manickam, F. Dufour, and D. L. Alkon Memory-specific temporal profiles of gene expression in the hippocampus PNAS, December 10, 2002; 99(25): 16279 - 16284. [Abstract] [Full Text] [PDF]

				L. M. Igaz, M. R. M. Vianna, J. H. Medina, and I. Izquierdo Two Time Periods of Hippocampal mRNA Synthesis Are Required for Memory Consolidation of Fear-Motivated Learning J. Neurosci., August 1, 2002; 22(15): 6781 - 6789. [Abstract] [Full Text] [PDF]

				Y. Liang, L.-L. Yuan, D. Johnston, and R. Gray Calcium Signaling at Single Mossy Fiber Presynaptic Terminals in the Rat Hippocampus J Neurophysiol, February 1, 2002; 87(2): 1132 - 1137. [Abstract] [Full Text] [PDF]

				M.-K. Sun, T. J. Nelson, and D. L. Alkon Functional switching of GABAergic synapses by ryanodine receptor activation PNAS, October 4, 2000; (2000) 210396697. [Abstract] [Full Text]

				M.-K. Sun, T. J. Nelson, and D. L. Alkon Functional switching of GABAergic synapses by ryanodine receptor activation PNAS, October 24, 2000; 97(22): 12300 - 12305. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by ZHAO, W. Articles by ALKON, D. L. Search for Related Content PubMed PubMed Citation Articles by ZHAO, W. Articles by ALKON, D. L.