|
|
||||||||
Physiologisches Institut, Ludwig Maximilians Universität, München, Germany; and
* Institut für Kardiovaskuläre Physiologie, Johann Wolfgang Goethe Universität, Frankfurt, Germany
1Correspondence: Physiologisches Institut, Ludwig Maximilians Universität, Schillerstrasse 44, D-80336 München. E-mail: bolz{at}lrz.uni-muenchen.de
| ABSTRACT |
|---|
|
|
|---|
Key Words: organ culture cytochrome P450 metabolites hyperpolarization endothelium acetylcholine
| INTRODUCTION |
|---|
|
|
|---|
In previous studies, several products of the cytochrome P450 pathway
(hydroxyeicosatrienoic, di-hydroxyeicosatrienoic, and
epoxyeicosatrienoic acids) have been shown to hyperpolarize vascular
smooth muscle cells by activation of different K+
channels (9
10
11
12)
. On the other hand, the CYP-epoxygenase
product of arachidonic acid 11,12-epoxyeicosatrienoic acid (11,12-EET)
activates calcium-dependent K+ channels
(KCa channels) (13)
and elicits
smooth muscle relaxation. 11,12-EET is synthesized by the CYP isoforms
2C8, 2C9, and 1A2 (14)
, and 2J (15)
. Of these
isoforms, CYP2C8 is a candidate EDHF synthase as it is expressed in
human endothelial cells (16)
.
The aim of the present study was to clarify the involvement of CYP2C8/9 in EDHF-mediated responses in small skeletal muscle resistance arteries using a novel nonpharmacological approach based on antisense oligonucleotide transfection. We determined whether the reduction of endothelial CYP 2C as a consequence of transfection with an antisense oligonucleotides against the coding region of CYP 2C8/9 would selectively affect EDHF-mediated effects in response to acetylcholine in resistance arteries.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Determination of oligonucleotide sequence
The sequence of the oligonucleotide was derived from the cDNA
sequences of the cytochrome P450 epoxygenases 2C8 and 2C9
(5'GAGGAGTGGGGCCAGGAGGGAG 3'). It is located 50 bp downstream of the
translation initiation site within the coding region. Comparison of the
oligonucleotide sequence with the database detected only homology to
cytochrome P450 sequences from the 2C family, including the 2C of the
Syrian hamster. To detect the localization within the vessel, the 5'
ends of the oligonucleotides were conjugated to
fluorescein-isothiocyanate (FITC). Sense and scrambled oligonucleotides
were synthesized for use as controls.
RNA isolation and reverse transcriptase-polymerase chain reaction
Arteries and heart tissue from Syrian hamster were frozen in
liquid nitrogen and RNA was extracted by guanidine isothiocyanate and
phenol (Trizol, Life Technologies, Inc., Eggenstein, Germany). Random
hexanucleotide primers were used for reverse transcription of equal
amounts of RNA, and the oligonucleotides used for polymerase chain
reaction (PCR) were derived against a human CYP2C8 sequence (genebank
accession no. Y00498; upstream primer: GATAGATGTTAAGGACATCT, downstream
primer: CTCCCTAATGTAACTTCGTG) that exhibited a high homology to the
Syrian hamster 2C25 sequence (genebank accession no. D11435). After
PCR, the fragments were separated on a 1.5% TAE agarose gel and
visualized by staining with ethidium bromide. To verify the DNA
fragment, PCR products were transferred to nylon membranes and
hybridized with 32P-labeled DNA fragments
encoding 2C8.
Organ culture and transfection
The segments were per- and superfused at a rate of 1 ml/h with
culture medium supplemented with 15% heat-inactivated cool calf serum,
20,000 u/l penicillin, and 20 mg/l streptomycin. The transmural
pressure was maintained at 45 mmHg. A 3 ml perfusion medium containing
2.5 µg/ml FITC-labeled antisense, sense, or scrambled
oligonucleotides and 20 µl/ml transfection reagent
(Superfect; Qiagen, Chatsworth, Calif.) was
applied to the segments and left in contact for 3 h. Thereafter,
the segments were kept in organ culture for 2432 h. The segments were
then transferred to the stage of a laser scanning microscope (Zeiss,
LSM 410) to localize FITC fluorescence within the vascular wall. The
segments were then incubated with the
Ca2+-sensitive dye fura 2 [2 µmol/l fura
2-acetoxymethylester (AM) and 0.5% bovine serum albumin (BSA) in
MOPS-buffered salt solution]. To facilitate selective measurements of
smooth muscle Ca2+i, fura 2-AM
was added to the organ bath; selective loading of the endothelium (EC)
could be achieved by perfusion of the segments with fura 2-AM.
Ca2+i in VSMC or EC was measured
as described previously in more detail (17)
. Video
microscopy was performed at wavelengths > 610 nm, which did not
interfere with the fluorescence signal emitted by fura 2.
Experimental protocol
All segments were treated with indomethacin (30 µmol/l) and
constricted with norepinephrine (NE, 0.3 µmol/l, 2 min) prior to the
addition of vasodilators. ACh was applied to the organ bath, and
subsequent changes of Ca2+ and outer diameter
were recorded for 2 min. To separate NO- and EDHF-mediated effects of
ACh, vascular responses were compared before and after treatment with
the inhibitor of NO synthase (NOS),
N
nitro-L-arginine (L-NA, 30 µmol/l). To
establish that the effects of ACh persisting after L-NA treatment were
mediated by EDHF, charybdotoxin (ChTX, 1 µmol/l), a specific
inhibitor of calcium-activated potassium channels
(KCa channels), was applied. Changes in
Ca2+i and diameter mediated by
EDHF in response to ACh were compared in segments treated with As-, S-,
or Scr-oligonucleotides. To exclude unspecific effects of the
transfection procedures, endothelium-independent vasodilatory effects
of sodium nitroprusside (SNP) were also studied. Moreover, the
responses of cultured vessels were compared with those of freshly
isolated resistance arteries to control for unspecific effects of the
organ culture protocol.
Drugs and solutions
The organ bath solution used for functional studies contained
(mol/l) 145 NaCl, 4.7 KCl, 1.5 CaCl2, 1.17
MgSO4, 1.2
NaH2PO4, 2.0 pyruvate, 0.02
EGTA, 3.0 MOPS, and 5.0 glucose. NE, ACh, L-NA, ChTX,
1,3-dihydro-1-[2-hydroxy-5-(trifluoromethyl)phenyl]-5-(trifluoromethyl)-2H-benzimidazol-2-one
(NS1619), and SNP were from Sigma Chemical (Deisenhofen, Germany),
MnCl2 from Merck (Darmstadt, Germany), and fura
2-AM from Molecular Probes (Eugene, Oreg.). Drugs were dissolved in
MOPS buffer, Na-acetate (SNP), or DMSO (fura 2-AM). Stock solutions
were further diluted to five times that of the final concentration. For
the application, one-fifth of the bath volume was exchanged to achieve
the final bath concentration to which we refer throughout in the text.
Statistical analysis
Dilations are expressed as % dilator capacity =
((diavasodilator-diaNE)/(diamax-diaNE)) x 100, where diavasodilator represents the
steady-state outer diameter 2 min after stimulation with the respective
vasodilator, where diaNE is the steady-state
outer diameter on stimulation with NE, and diamax
is the maximal diameter of the resistance arteries at 45 mmHg. Due to
potential errors associated with measurements in an intact vessel
(18
), Ca2+i in
vascular smooth muscle cells can only be estimated. We therefore used
ratio changes to describe % changes in
Ca2+i. According to calibration
curves obtained in a cell-free system, the range of ratios observed
here (0.436) fitted well into the linear range of the calibration
curve (42.2 to 1520 nmol/l), which is a prerequisite for calculating %
changes. Changes in Ca2+i are
expressed as
Ca2+i, from
((RNE-Rvasodilator)/(RNE-Rbasal)) x 100. The indices for the different R values correspond to those used
for the diameter measurements except for Rbasal,
which describes the calcium level under unstimulated conditions.
All results are presented as means ± SE of n experiments, n representing the number of vessels used per experiment. Steady-state values of different experimental groups were compared using Students t test. Differences were considered significant at error probabilities less than 0.05 (P<0.05).
| RESULTS |
|---|
|
|
|---|
|
NE-induced contractions as well as ACh-induced EDHF- and NO-mediated
dilations were not significantly different in freshly isolated segments
and segments kept under organ culture conditions for up to 48 h
(19)
.
Expression of CYP2C in aorta and A. gracilis
Reverse transcribed RNA from hamster aorta and A.
gracilis was analyzed for the expression of CYP2C-related genes.
PCR primers derived from a human CYP2C8 sequence homologous to hamster
2C2527 resulted in the amplification of a fragment with the expected
size of 616 bp (Fig. 2A
). A strong cross-hybridization with a DNA fragment encoding
CYP2C8 confirmed the identity of the amplification product (Fig. 2B
). Amplification of reverse transcribed RNA from hamster
liver and heart known to express large amounts of CYP2C8 with the same
oligonucleotides resulted in fragments of identical size (data not
shown).
|
Targeting of oligonucleotides to the endothelium
FITC-labeled oligonucleotides were used to assess the selectivity
and efficiency of the transfection protocol. Untreated resistance
arteries emitted no fluorescence when excited at 488 nm. In contrast,
marked fluorescence signals could be detected in resistance arteries
transfected with either FITC-labeled antisense, sense, or scrambled
oligonucleotides. The FITC-related fluorescence was homogenously
distributed and confined to the endothelial layer (Fig. 3A, B
). The labeled structures were spindle-shaped and
orientated along the longitudinal axis of the vessel, consistent with
the orientation of endothelial cells in a native segment. In a separate
series, de-endothelialized vessels were exposed to FITC-labeled
oligonucleotides. In these vessels, the labeled structures were
perpendicularly oriented as is typical for vascular smooth muscle cells
(data not shown).
|
Effects of oligonucleotide treatment on EDHF-mediated responses
To ensure the specific effect of the antisense oligonucleotide
treatment on EDHF-mediated responses, experiments were also performed
with sense (n=6) or scrambled (n=6)
oligonucleotides (Fig. 4
). The constriction induced by NE was similar in sense, scrambled, and
antisense-treated segments (41±2, 45±1, 43±1%, n=612)
as was the increase in smooth muscle
Ca2+i (41±3, 39±4, 43±5%).
ACh (1 µmol/l) reversed the NE-induced increase in smooth muscle
Ca2+i to a similar extent in
untreated segments as well as in those treated with sense and scrambled
oligonucleotides. Accordingly, the resulting dilations in sense
(86±3%) dilator capacity and scrambled (77±6%) treated segments
were not significantly different from those in untreated segments
(87±7%).
|
In contrast, treatment with antisense oligonucleotides significantly
reduced the EDHF-mediated decreases in smooth muscle
Ca2+i and subsequent dilations
whereas the responses to the specific KCa channel
activator NS1619 (100 µmol/l; Fig. 4
, left) were not altered.
SNP-induced dilations were also similar in antisense and sense
oligonucleotide-treated segments (Fig. 4
, left). Antisense
oligonucleotide treatment did not affect endothelial increases in
Ca2+i in response to ACh.
| DISCUSSION |
|---|
|
|
|---|
The inhibitory effect of the CYP2C8/9 antisense oligonucleotide was
selective, as it attenuated EDHF-mediated dilations and decreases in
smooth muscle Ca2+i without
affecting the responses to the KCa channel opener
NS1619, endothelial Ca2+ signaling, or vascular
reactivity to norepinephrine and SNP. Previous studies have suggested
that CYP metabolites play a determining role in the regulation of the
capacitative Ca2+ entry in endothelial cells
(23
, 24)
. As an increase in endothelial
Ca2+ is thought to precede the activation of
PLA2, liberation of arachidonic acid, and
activation of the EDHF synthase, it was essential to exclude an effect
of the antisense oligonucleotides on endothelial
Ca2+ signaling. Indeed, neither the sense nor the
antisense oligonucleotides had a significant effect on the
acetylcholine-induced increase in endothelial
Ca2+. Thus, an attenuated
Ca2+ response to acetylcholine cannot account for
the effects of CYP2C8/9 antisense oligonucleotides on EDHF-mediated
responses. The inhibition of EDHF-mediated dilation cannot be explained
by a general impairment of smooth muscle or KCa
channel function after oligonucleotide transfection. This statement is
based on the fact that the NE-induced constriction and NS1619- and
SNP-induced dilations were similar in all of the treatment groups, and
is further supported by the finding that no FITC fluorescence was found
in smooth muscle cells of vessels treated with FITC-labeled
oligonucleotides. The selective targeting of endothelial cells under
the experimental conditions used is not remarkable, since it is
possible to selectively load endothelial cells with lipophilic
compounds such as fluo-3 AM (25)
and di-ANEPPS-AM
(26
, 27)
.
In summary, we have used a novel organ culture technique in combination with oligonucleotide transfection to test the hypothesis that CYP2C8/9 is an EDHF synthase. Although our approach does not distinguish between a direct hyperpolarizing action of a CYP 2C8/9 metabolite or its possible permissive role for the actions of a different EDHF, it demonstrates that a product of CYP2C8/9 is an integral part of the signaling cascade leading to EDHF-mediated responses in resistance arteries.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Krotz, N. Hellwig, M. A. Burkle, S. Lehrer, T. Riexinger, H. Mannell, H.-Y. Sohn, V. Klauss, and U. Pohl A sulfaphenazole-sensitive EDHF opposes platelet-endothelium interactions in vitro and in the hamster microcirculation in vivo Cardiovasc Res, February 1, 2010; 85(3): 542 - 550. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Giannarelli, A. Virdis, F. De Negri, A. Magagna, E. Duranti, A. Salvetti, and S. Taddei Effect of Sulfaphenazole on Tissue Plasminogen Activator Release in Normotensive Subjects and Hypertensive Patients Circulation, March 31, 2009; 119(12): 1625 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Peter, D. Lidington, A. Harada, H. J. Bolz, L. Vogel, S. Heximer, S. Spiegel, U. Pohl, and S.-S. Bolz Role of Sphingosine-1-Phosphate Phosphohydrolase 1 in the Regulation of Resistance Artery Tone Circ. Res., August 1, 2008; 103(3): 315 - 324. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wray and D. Bishop-Bailey Epoxygenases and peroxisome proliferator-activated receptors in mammalian vascular biology Exp Physiol, January 1, 2008; 93(1): 148 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Mortensen, J. Gonzalez-Alonso, R. Damsgaard, B. Saltin, and Y. Hellsten Inhibition of nitric oxide and prostaglandins, but not endothelial-derived hyperpolarizing factors, reduces blood flow and aerobic energy turnover in the exercising human leg J. Physiol., June 1, 2007; 581(2): 853 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Hagedorn, C.-L. Cooke, J. R. Falck, B. F. Mitchell, and S. T. Davidge Regulation of Vascular Tone During Pregnancy: A Novel Role for the Pregnane X Receptor Hypertension, February 1, 2007; 49(2): 328 - 333. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Lu, D. Ye, X. Wang, J. M. Seubert, J. P. Graves, J. A. Bradbury, D. C. Zeldin, and H.-C. Lee Cardiac and vascular KATP channels in rats are activated by endogenous epoxyeicosatrienoic acids through different mechanisms J. Physiol., September 1, 2006; 575(2): 627 - 644. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Taddei, D. Versari, A. Cipriano, L. Ghiadoni, F. Galetta, F. Franzoni, A. Magagna, A. Virdis, and A. Salvetti Identification of a Cytochrome P450 2C9-Derived Endothelium-Derived Hyperpolarizing Factor in Essential Hypertensive Patients J. Am. Coll. Cardiol., August 1, 2006; 48(3): 508 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Feletou and P. M. Vanhoutte Endothelium-Derived Hyperpolarizing Factor: Where Are We Now? Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1215 - 1225. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Siegl, M. Koeppen, S. E. Wolfle, U. Pohl, and C. de Wit Myoendothelial Coupling Is Not Prominent in Arterioles Within the Mouse Cremaster Microcirculation In Vivo Circ. Res., October 14, 2005; 97(8): 781 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Watanabe, J. Suzuki, H. Yamawaki, V. K. Sharma, S.-S. Sheu, and B. C. Berk Losartan Metabolite EXP3179 Activates Akt and Endothelial Nitric Oxide Synthase via Vascular Endothelial Growth Factor Receptor-2 in Endothelial Cells: Angiotensin II Type 1 Receptor-Independent Effects of EXP3179 Circulation, September 20, 2005; 112(12): 1798 - 1805. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. You, E. M. Golding, and R. M. Bryan Jr. Arachidonic acid metabolites, hydrogen peroxide, and EDHF in cerebral arteries Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1077 - H1083. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, X. Wei, X. Xiao, R. Hui, J. W. Card, M. A. Carey, D. W. Wang, and D. C. Zeldin Arachidonic Acid Epoxygenase Metabolites Stimulate Endothelial Cell Growth and Angiogenesis via Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 522 - 532. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Koeppen, R. Feil, D. Siegl, S. Feil, F. Hofmann, U. Pohl, and C. de Wit cGMP-Dependent Protein Kinase Mediates NO- but not Acetylcholine-Induced Dilations in Resistance Vessels In Vivo Hypertension, December 1, 2004; 44(6): 952 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Clifford and Y. Hellsten Vasodilatory mechanisms in contracting skeletal muscle J Appl Physiol, July 1, 2004; 97(1): 393 - 403. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Bolz, L. Vogel, D. Sollinger, R. Derwand, C. de Wit, G. Loirand, and U. Pohl Nitric Oxide-Induced Decrease in Calcium Sensitivity of Resistance Arteries Is Attributable to Activation of the Myosin Light Chain Phosphatase and Antagonized by the RhoA/Rho Kinase Pathway Circulation, June 24, 2003; 107(24): 3081 - 3087. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Earley, A. Pastuszyn, and B. R. Walker Cytochrome P-450 epoxygenase products contribute to attenuated vasoconstriction after chronic hypoxia Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H127 - H136. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hillig, P. Krustrup, I. Fleming, T. Osada, B. Saltin, and Y. Hellsten Cytochrome P450 2C9 plays an important role in the regulation of exercise-induced skeletal muscle blood flow and oxygen uptake in humans J. Physiol., January 1, 2003; 546(1): 307 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Krotz, H. Y. Sohn, M. Keller, T. Gloe, S. S. Bolz, B. F. Becker, and U. Pohl Depolarization of Endothelial Cells Enhances Platelet Aggregation Through Oxidative Inactivation of Endothelial NTPDase Arterioscler Thromb Vasc Biol, December 1, 2002; 22(12): 2003 - 2009. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hoepfl, B. Rodenwaldt, U. Pohl, and C. de Wit EDHF, but not NO or prostaglandins, is critical to evoke a conducted dilation upon ACh in hamster arterioles Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H996 - H1004. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bauersachs, M. Christ, G. Ertl, U.R. Michaelis, B. Fisslthaler, R. Busse, and I. Fleming Cytochrome P450 2C expression and EDHF-mediated relaxation in porcine coronary arteries is increased by cortisol Cardiovasc Res, June 1, 2002; 54(3): 669 - 675. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Popp, R. P. Brandes, G. Ott, R. Busse, and I. Fleming Dynamic Modulation of Interendothelial Gap Junctional Communication by 11,12-Epoxyeicosatrienoic Acid Circ. Res., April 19, 2002; 90(7): 800 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Golding, S. P. Marrelli, J. You, and R. M. Bryan Jr Endothelium-Derived Hyperpolarizing Factor in the Brain: A New Regulator of Cerebral Blood Flow? Stroke, March 1, 2002; 33(3): 661 - 663. [Full Text] [PDF] |
||||
![]() |
L. A. Schildmeyer and R. M. Bryan Jr. Effect of NO on EDHF response in rat middle cerebral arteries Am J Physiol Heart Circ Physiol, February 1, 2002; 282(2): H734 - H738. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Roman P-450 Metabolites of Arachidonic Acid in the Control of Cardiovascular Function Physiol Rev, January 1, 2002; 82(1): 131 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fleming Cytochrome P450 and Vascular Homeostasis Circ. Res., October 26, 2001; 89(9): 753 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Tuttle and J. C. Falcone Nitric oxide release during {alpha}1-adrenoceptor-mediated constriction of arterioles Am J Physiol Heart Circ Physiol, August 1, 2001; 281(2): H873 - H881. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Coats, F. Johnston, J. MacDonald, J. J. V. McMurray, and C. Hillier Endothelium-Derived Hyperpolarizing Factor : Identification and Mechanisms of Action in Human Subcutaneous Resistance Arteries Circulation, March 27, 2001; 103(12): 1702 - 1708. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fleming, U. R. Michaelis, D. Bredenkotter, B. Fisslthaler, F. Dehghani, R. P. Brandes, and R. Busse Endothelium-Derived Hyperpolarizing Factor Synthase (Cytochrome P450 2C9) Is a Functionally Significant Source of Reactive Oxygen Species in Coronary Arteries Circ. Res., January 19, 2001; 88(1): 44 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Bolz, J. Galle, R. Derwand, C. de Wit, and U. Pohl Oxidized LDL Increases the Sensitivity of the Contractile Apparatus in Isolated Resistance Arteries for Ca2+ via a Rho- and Rho Kinase-Dependent Mechanism Circulation, November 7, 2000; 102(19): 2402 - 2410. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Bolz, S. Pieperhoff, C. De Wit, and U. Pohl Intact endothelial and smooth muscle function in small resistance arteries after 48 h in vessel culture Am J Physiol Heart Circ Physiol, September 1, 2000; 279(3): H1434 - H1439. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Popp, R. P. Brandes, G. Ott, R. Busse, and I. Fleming Dynamic Modulation of Interendothelial Gap Junctional Communication by 11,12-Epoxyeicosatrienoic Acid Circ. Res., April 19, 2002; 90(7): 800 - 806. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |