FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BOLZ, S.-S.
Right arrow Articles by POHL, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BOLZ, S.-S.
Right arrow Articles by POHL, U.
(The FASEB Journal. 2000;14:255-260.)
© 2000 FASEB

Antisense oligonucleotides against cytochrome P450 2C8 attenuate EDHF-mediated Ca2+ changes and dilation in isolated resistance arteries

STEFFEN-SEBASTIAN BOLZ1, BEATE FISSLTHALER*, SUSANNE PIEPERHOFF, COR DE WIT, INGRID FLEMING*, RUDI BUSSE* and ULRICH POHL

Physiologisches Institut, Ludwig Maximilians Universität, München, Germany; and
* Institut für Kardiovaskuläre Physiologie, Johann Wolfgang Goethe Universität, Frankfurt, Germany

1Correspondence: Physiologisches Institut, Ludwig Maximilians Universität, Schillerstrasse 44, D-80336 München. E-mail: bolz{at}lrz.uni-muenchen.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Using a novel vessel culture technique in combination with antisense oligonucleotide transfection, we tested whether the endothelium-derived hyperpolarizing factor (EDHF) is a cytochrome P450 (CYP)-related compound. Isolated resistance arteries from hamster gracilis muscle (n=19) were perfused and exposed to antisense (As), sense (S), or scrambled (Scr) oligonucleotides against the coding region of CYP2C8/9, an isoform expressed in endothelial cells. Thereafter, NO- and prostaglandin-independent, EDHF-mediated vascular responses associated with hyperpolarization [i.e., decrease in smooth muscle calcium (Fura 2) and vasodilation] were studied after the application of acetylcholine (ACh). These EDHF-mediated responses were markedly attenuated (by 70%) by As- but not by S- or Scr-oligonucleotide treatment. However, the responses to norepinephrine (0.3 µmol/l), the NO donor sodium nitroprusside (1 µmol/l), and the KCa channel activator NS1619 (100 µmol/l) were unaltered. As treatment, which specifically targeted the endothelial layer (as assessed by confocal microscopy), had no inhibitory effect on increases in endothelial calcium to ACh. It is concluded that a CYP2C8/9-related isoform functions as an EDHF synthase in hamster resistance arteries and that a product of this enzyme is an EDHF, or at least an integral part of the signaling cascade leading to EDHF-mediated responses.—Bolz, S.-S., Fisslthaler, B., Pieperhoff, S., de Wit, C., Fleming, I., Busse, R., Pohl, U. Antisense oligonucleotides against cytochrome P450 2C8 attenuate EDHF-mediated Ca2+ changes and dilation in isolated resistance arteries.


Key Words: organ culture • cytochrome P450 metabolites • hyperpolarization • endothelium • acetylcholine


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE ENDOTHELIUM-DEPENDENT DILATION in response to acetylcholine (ACh) is partially due to a hyperpolarization of vascular smooth muscle cells that is not mediated by nitric oxide (NO) or prostacyclin (PGI2). This NO/PGI2-independent vascular response, which is especially prominent in resistance arteries, is generally attributed to the release of a separate ‘endothelium-derived hyperpolarizing factor’ (EDHF) (1) . From the experimental data published to date, it is evident that several EDHFs exist in different species (2 , 3) . However, the majority of reports characterizing EDHF in the microcirculation support the concept that this EDHF is a cytochrome P450 (CYP)-related product. This hypothesis was based on the observation that CYP inhibitors such as 17-ODYA (4) and a number of anesthetics (5 , 6) markedly attenuate EDHF-mediated dilations. However, these conclusions are limited by the fact that the above-mentioned CYP inhibitors cannot discriminate between the different CYP isoforms, and that imidazole-containing CYP inhibitors can directly interfere with K+ channels (7) , which are the main targets of EDHF in vascular smooth muscle cells (8) .

In previous studies, several products of the cytochrome P450 pathway (hydroxyeicosatrienoic, di-hydroxyeicosatrienoic, and epoxyeicosatrienoic acids) have been shown to hyperpolarize vascular smooth muscle cells by activation of different K+ channels (9 10 11 12) . On the other hand, the CYP-epoxygenase product of arachidonic acid 11,12-epoxyeicosatrienoic acid (11,12-EET) activates calcium-dependent K+ channels (KCa channels) (13) and elicits smooth muscle relaxation. 11,12-EET is synthesized by the CYP isoforms 2C8, 2C9, and 1A2 (14) , and 2J (15) . Of these isoforms, CYP2C8 is a candidate ‘EDHF synthase’ as it is expressed in human endothelial cells (16) .

The aim of the present study was to clarify the involvement of CYP2C8/9 in EDHF-mediated responses in small skeletal muscle resistance arteries using a novel nonpharmacological approach based on antisense oligonucleotide transfection. We determined whether the reduction of endothelial CYP 2C as a consequence of transfection with an antisense oligonucleotides against the coding region of CYP 2C8/9 would selectively affect EDHF-mediated effects in response to acetylcholine in resistance arteries.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Preparation of small resistance arteries
Female golden Syrian hamsters (149±2 g body weight) were anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/kg). Segments of small resistance arteries (resting outer diameter 234±8 µm) were excised under sterile conditions from the gracilis muscle, cannulated with glass micropipettes and transferred to an organ bath.

Determination of oligonucleotide sequence
The sequence of the oligonucleotide was derived from the cDNA sequences of the cytochrome P450 epoxygenases 2C8 and 2C9 (5'GAGGAGTGGGGCCAGGAGGGAG 3'). It is located 50 bp downstream of the translation initiation site within the coding region. Comparison of the oligonucleotide sequence with the database detected only homology to cytochrome P450 sequences from the 2C family, including the 2C of the Syrian hamster. To detect the localization within the vessel, the 5' ends of the oligonucleotides were conjugated to fluorescein-isothiocyanate (FITC). Sense and scrambled oligonucleotides were synthesized for use as controls.

RNA isolation and reverse transcriptase-polymerase chain reaction
Arteries and heart tissue from Syrian hamster were frozen in liquid nitrogen and RNA was extracted by guanidine isothiocyanate and phenol (Trizol, Life Technologies, Inc., Eggenstein, Germany). Random hexanucleotide primers were used for reverse transcription of equal amounts of RNA, and the oligonucleotides used for polymerase chain reaction (PCR) were derived against a human CYP2C8 sequence (genebank accession no. Y00498; upstream primer: GATAGATGTTAAGGACATCT, downstream primer: CTCCCTAATGTAACTTCGTG) that exhibited a high homology to the Syrian hamster 2C25 sequence (genebank accession no. D11435). After PCR, the fragments were separated on a 1.5% TAE agarose gel and visualized by staining with ethidium bromide. To verify the DNA fragment, PCR products were transferred to nylon membranes and hybridized with 32P-labeled DNA fragments encoding 2C8.

Organ culture and transfection
The segments were per- and superfused at a rate of 1 ml/h with culture medium supplemented with 15% heat-inactivated cool calf serum, 20,000 u/l penicillin, and 20 mg/l streptomycin. The transmural pressure was maintained at 45 mmHg. A 3 ml perfusion medium containing 2.5 µg/ml FITC-labeled antisense, sense, or scrambled oligonucleotides and 20 µl/ml transfection reagent (Superfect; Qiagen, Chatsworth, Calif.) was applied to the segments and left in contact for 3 h. Thereafter, the segments were kept in organ culture for 24–32 h. The segments were then transferred to the stage of a laser scanning microscope (Zeiss, LSM 410) to localize FITC fluorescence within the vascular wall. The segments were then incubated with the Ca2+-sensitive dye fura 2 [2 µmol/l fura 2-acetoxymethylester (AM) and 0.5% bovine serum albumin (BSA) in MOPS-buffered salt solution]. To facilitate selective measurements of smooth muscle Ca2+i, fura 2-AM was added to the organ bath; selective loading of the endothelium (EC) could be achieved by perfusion of the segments with fura 2-AM. Ca2+i in VSMC or EC was measured as described previously in more detail (17) . Video microscopy was performed at wavelengths > 610 nm, which did not interfere with the fluorescence signal emitted by fura 2.

Experimental protocol
All segments were treated with indomethacin (30 µmol/l) and constricted with norepinephrine (NE, 0.3 µmol/l, 2 min) prior to the addition of vasodilators. ACh was applied to the organ bath, and subsequent changes of Ca2+ and outer diameter were recorded for 2 min. To separate NO- and EDHF-mediated effects of ACh, vascular responses were compared before and after treatment with the inhibitor of NO synthase (NOS), N{omega}nitro-L-arginine (L-NA, 30 µmol/l). To establish that the effects of ACh persisting after L-NA treatment were mediated by EDHF, charybdotoxin (ChTX, 1 µmol/l), a specific inhibitor of calcium-activated potassium channels (KCa channels), was applied. Changes in Ca2+i and diameter mediated by EDHF in response to ACh were compared in segments treated with As-, S-, or Scr-oligonucleotides. To exclude unspecific effects of the transfection procedures, endothelium-independent vasodilatory effects of sodium nitroprusside (SNP) were also studied. Moreover, the responses of cultured vessels were compared with those of freshly isolated resistance arteries to control for unspecific effects of the organ culture protocol.

Drugs and solutions
The organ bath solution used for functional studies contained (mol/l) 145 NaCl, 4.7 KCl, 1.5 CaCl2, 1.17 MgSO4, 1.2 NaH2PO4, 2.0 pyruvate, 0.02 EGTA, 3.0 MOPS, and 5.0 glucose. NE, ACh, L-NA, ChTX, 1,3-dihydro-1-[2-hydroxy-5-(trifluoromethyl)phenyl]-5-(trifluoromethyl)-2H-benzimidazol-2-one (NS1619), and SNP were from Sigma Chemical (Deisenhofen, Germany), MnCl2 from Merck (Darmstadt, Germany), and fura 2-AM from Molecular Probes (Eugene, Oreg.). Drugs were dissolved in MOPS buffer, Na-acetate (SNP), or DMSO (fura 2-AM). Stock solutions were further diluted to five times that of the final concentration. For the application, one-fifth of the bath volume was exchanged to achieve the final bath concentration to which we refer throughout in the text.

Statistical analysis
Dilations are expressed as % dilator capacity = ((diavasodilator-diaNE)/(diamax-diaNE)) x 100, where diavasodilator represents the steady-state outer diameter 2 min after stimulation with the respective vasodilator, where diaNE is the steady-state outer diameter on stimulation with NE, and diamax is the maximal diameter of the resistance arteries at 45 mmHg. Due to potential errors associated with measurements in an intact vessel (18 ), Ca2+i in vascular smooth muscle cells can only be estimated. We therefore used ratio changes to describe % changes in Ca2+i. According to calibration curves obtained in a cell-free system, the range of ratios observed here (0.4–36) fitted well into the linear range of the calibration curve (42.2 to 1520 nmol/l), which is a prerequisite for calculating % changes. Changes in Ca2+i are expressed as {Delta} Ca2+i, from ((RNE-Rvasodilator)/(RNE-Rbasal)) x 100. The indices for the different R values correspond to those used for the diameter measurements except for Rbasal, which describes the calcium level under unstimulated conditions.

All results are presented as means ± SE of n experiments, n representing the number of vessels used per experiment. Steady-state values of different experimental groups were compared using Student’s t test. Differences were considered significant at error probabilities less than 0.05 (P<0.05).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
EDHF-mediated responses elicited by acetylcholine in resistance arteries
Acetylcholine induced dose-dependent dilations of resistance arteries preconstricted using NE to 35 ± 1% of their maximal diameter (n=8). These dilations were preceded by a marked decrease in smooth muscle Ca2+i. Treatment with L-NA reduced the dilation elicited by lower ACh doses without affecting the Ca2+ decrease in vascular smooth muscle cells (Fig. 1 ). The dilation induced by the highest concentration of ACh was, however, completely insensitive to L-NA. Again, decreases in Ca2+i as well as ACh-induced hyperpolarizations (data not shown) remained unaffected by L-NA. All of the L-NA/indomethacin-insensitive responses were abolished by the inclusion of ChTX, a specific inhibitor of KCa channels (Fig. 1) , or by the removal of the endothelium (n=5, data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Effects of increasing concentrations of acetylcholine (ACh, 0.01–1 µmol/l) on smooth muscle calcium ({Delta}Ca2+i, top) and vascular diameter ({Delta} diameter, bottom) in indomethacin-treated resistance arteries (n=8) that were preconstricted with norepinephrine (NE, 0.3 µmol/l). The same arteries were studied before and after treatment with the NOS inhibitor L-NA and subsequently the KCa channel inhibitor charybdotoxin (ChTX, 1 µmol/l). {Delta}Ca2+i (%) refers to the reversal of NE-induced increase in smooth muscle Ca2+. {Delta} diameter refers to % of dilator capacity. Values are means ± SE. *P < 0.05, significantly different from dilations and decreases in Ca2+i in untreated vessels.

NE-induced contractions as well as ACh-induced EDHF- and NO-mediated dilations were not significantly different in freshly isolated segments and segments kept under organ culture conditions for up to 48 h (19) .

Expression of CYP2C in aorta and A. gracilis
Reverse transcribed RNA from hamster aorta and A. gracilis was analyzed for the expression of CYP2C-related genes. PCR primers derived from a human CYP2C8 sequence homologous to hamster 2C25–27 resulted in the amplification of a fragment with the expected size of 616 bp (Fig. 2A ). A strong cross-hybridization with a DNA fragment encoding CYP2C8 confirmed the identity of the amplification product (Fig. 2B ). Amplification of reverse transcribed RNA from hamster liver and heart known to express large amounts of CYP2C8 with the same oligonucleotides resulted in fragments of identical size (data not shown).



View larger version (113K):
[in this window]
[in a new window]
 
Figure 2. CYP2C-related genes are expressed in hamster resistance arteries and aorta. RT-PCR was used to amplify CYP2C-related mRNA (A) and GAPDH (C) from segments of the aorta (aorta) and the A. gracilis (A.g.). Hybridization with a DNA fragment encoding CYP2C8 confirmed the identity of the PCR amplification product (B). After size fractionation of the PCR fragments, the agarose gel was stained with ethidium bromide. n.c. = negative control.

Targeting of oligonucleotides to the endothelium
FITC-labeled oligonucleotides were used to assess the selectivity and efficiency of the transfection protocol. Untreated resistance arteries emitted no fluorescence when excited at 488 nm. In contrast, marked fluorescence signals could be detected in resistance arteries transfected with either FITC-labeled antisense, sense, or scrambled oligonucleotides. The FITC-related fluorescence was homogenously distributed and confined to the endothelial layer (Fig. 3A, B ). The labeled structures were spindle-shaped and orientated along the longitudinal axis of the vessel, consistent with the orientation of endothelial cells in a native segment. In a separate series, de-endothelialized vessels were exposed to FITC-labeled oligonucleotides. In these vessels, the labeled structures were perpendicularly oriented as is typical for vascular smooth muscle cells (data not shown).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 3. Distribution of FITC-labeled antisense oligonucleotides (green fluorescence) within the vascular wall. Confocal slices were taken at the bottom (A) and midline (B) of the vessel. Fluorescence images (green) were projected on the video image of the vessel. The distribution of FITC-labeled oligonucleotides was similar in sense and scrambled oligonucleotide-treated vessels.

Effects of oligonucleotide treatment on EDHF-mediated responses
To ensure the specific effect of the antisense oligonucleotide treatment on EDHF-mediated responses, experiments were also performed with sense (n=6) or scrambled (n=6) oligonucleotides (Fig. 4 ). The constriction induced by NE was similar in sense, scrambled, and antisense-treated segments (41±2, 45±1, 43±1%, n=6–12) as was the increase in smooth muscle Ca2+i (41±3, 39±4, 43±5%). ACh (1 µmol/l) reversed the NE-induced increase in smooth muscle Ca2+i to a similar extent in untreated segments as well as in those treated with sense and scrambled oligonucleotides. Accordingly, the resulting dilations in sense (86±3%) dilator capacity and scrambled (77±6%) treated segments were not significantly different from those in untreated segments (87±7%).



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Left: Effects of oligonucleotide treatment (antisense, sense, and scrambled) on acetylcholine (ACh 1 µmol/l), NS1619 (100 µmol/l), and sodium nitroprusside (SNP 1 µmol/l) -induced decreases in smooth muscle Ca2+i and dilations (n=6–7). Vessels were pretreated with indomethacin (30 µmol/l) and L-NA (30 µmol/l). Values are means ± SE. *P < 0.05, significantly different from control (sham). Right: Original recordings showing the effect of antisense (top) or sense (bottom) oligonucleotides on the acetylcholine (ACh, 1 µmol/l) -induced increase in endothelial Ca2+i in intact segments. Similar results were obtained in two additional experiments.

In contrast, treatment with antisense oligonucleotides significantly reduced the EDHF-mediated decreases in smooth muscle Ca2+i and subsequent dilations whereas the responses to the specific KCa channel activator NS1619 (100 µmol/l; Fig. 4 , left) were not altered. SNP-induced dilations were also similar in antisense and sense oligonucleotide-treated segments (Fig. 4 , left). Antisense oligonucleotide treatment did not affect endothelial increases in Ca2+i in response to ACh.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
With the aid of antisense oligonucleotides against the coding region of CYP2C8/9, we have demonstrated the involvement of this CYP isoform in the EDHF-mediated responses of a resistance artery. Although the concept that a CYP-dependent metabolite of arachidonic acid is an EDHF has been proposed before, the nonselective nature of the CYP inhibitors currently available in some cases masked the actions of EDHF as a consequence of their direct action on KCa channels. Moreover, these compounds cannot be used to differentiate between the various CYP activities (e.g., epoxygenase vs. hydroxylase) or provide detailed information on the nature of the CYP-related EDHF synthase. The method described here uses antisense transfection techniques and targets a CYP isoform that displays the characteristics of the CYP-related EDHF synthase in that it is an isoform expressed in endothelial cells, the expression of which can be enhanced by ß-naphthoflavone. This compound has previously been shown to increase the production of a CYP-related EDHF by cultured human endothelial cells and porcine coronary arteries (20) . CYP2C8 is the 2C isoform isolated and cloned from human endothelial cells (16) and corresponds, for example, to 2C11 in the rat (21) and 2C25–27 in the hamster (22) . All of these isoforms are expressed in endothelial cells and produce the stereoisomers of epoxy-eicosatrienoic acid (11,12-, 14,15-, and 5,6-EET) via epoxidation of arachidonic acid. 14,15- and 11,12-EETs have been shown to activate charybdotoxin-sensitive KCa channels in vascular smooth muscle cells, which in turn mediate the effects of EDHF in resistance arteries of the hamster (8) . That EDHF mediates the NO/PGI2-independent effects observed in the present study is suggested by our previous findings that both the Ca2+ decrease as well as the ACh-induced dilation and hyperpolarization are highly sensitive to charybdotoxin.

The inhibitory effect of the CYP2C8/9 antisense oligonucleotide was selective, as it attenuated EDHF-mediated dilations and decreases in smooth muscle Ca2+i without affecting the responses to the KCa channel opener NS1619, endothelial Ca2+ signaling, or vascular reactivity to norepinephrine and SNP. Previous studies have suggested that CYP metabolites play a determining role in the regulation of the capacitative Ca2+ entry in endothelial cells (23 , 24) . As an increase in endothelial Ca2+ is thought to precede the activation of PLA2, liberation of arachidonic acid, and activation of the EDHF synthase, it was essential to exclude an effect of the antisense oligonucleotides on endothelial Ca2+ signaling. Indeed, neither the sense nor the antisense oligonucleotides had a significant effect on the acetylcholine-induced increase in endothelial Ca2+. Thus, an attenuated Ca2+ response to acetylcholine cannot account for the effects of CYP2C8/9 antisense oligonucleotides on EDHF-mediated responses. The inhibition of EDHF-mediated dilation cannot be explained by a general impairment of smooth muscle or KCa channel function after oligonucleotide transfection. This statement is based on the fact that the NE-induced constriction and NS1619- and SNP-induced dilations were similar in all of the treatment groups, and is further supported by the finding that no FITC fluorescence was found in smooth muscle cells of vessels treated with FITC-labeled oligonucleotides. The selective targeting of endothelial cells under the experimental conditions used is not remarkable, since it is possible to selectively load endothelial cells with lipophilic compounds such as fluo-3 AM (25) and di-ANEPPS-AM (26 , 27) .

In summary, we have used a novel organ culture technique in combination with oligonucleotide transfection to test the hypothesis that CYP2C8/9 is an EDHF synthase. Although our approach does not distinguish between a direct hyperpolarizing action of a CYP 2C8/9 metabolite or its possible permissive role for the actions of a different EDHF, it demonstrates that a product of CYP2C8/9 is an integral part of the signaling cascade leading to EDHF-mediated responses in resistance arteries.


   ACKNOWLEDGMENTS
 
This work was supported by the Deutsche Forschungsgemeinschaft (SFB 553/B1 and B2) and Institut de Recherches Internationales Servier. It contains data from the doctoral thesis of S.P.


   FOOTNOTES
 
Received for publication March 26, 1999. Revised for publication September 20, 1999.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Nagao, T., Illiano, S., Vanhoutte, P. M. (1992) Heterogeneous distribution of endothelium-dependent relaxations resistant to NG-nitro-L-arginine in rats. Am. J. Physiol. 263,H1090-H1094[Abstract/Free Full Text]
  2. Quilley, J., Fulton, D., McGiff, J. C. (1997) Hyperpolarizing factors. Biochem. Pharmacol. 54,1059-1070[Medline]
  3. Chataigneau, T., Feletou, M., Thollon, C., Villeneuve, N., Vilaine, J. P., Duhault, J., Vanhoutte, P. M. (1998) Cannabinoid CB1 receptor and endothelium-dependent hyperpolarization in guinea-pig carotid, rat mesenteric and porcine coronary arteries. Br. J. Pharmacol. 123,968-974[Medline]
  4. Gebremedhin, D., Harder, D. R., Pratt, P. F., Campbell, W. B. (1998) Bioassay of an endothelium-derived hyperpolarizing factor from bovine coronary arteries: role of a cytochrome P450 metabolite. J. Vasc. Res. 35,274-284[Medline]
  5. Lischke, V., Busse, R., Hecker, M. (1995) Selective inhibition by barbiturates of the synthesis of endothelium-derived hyperpolarizing factor in the rabbit carotid artery. Br. J. Pharmacol. 115,969-974[Medline]
  6. de Wit, C., Esser, N., Lehr, H. A., Bolz, S. S., Pohl, U. (1999) A pentobarbital sensitive EDHF co-mediates ACh-induced arteriolar dilation in the hamster microcirculation. Am. J. Physiol. 276,H1527-H1534[Abstract/Free Full Text]
  7. Edwards, G., Zygmunt, P. M., Hogestatt, E. D., Weston, A. H. (1996) Effects of cytochrome P450 inhibitors on potassium currents and mechanical activity in rat portal vein. Br. J. Pharmacol. 119,691-701[Medline]
  8. Clark, S. G., Fuchs, L. C. (1997) Role of nitric oxide and Ca++-dependent K+ channels in mediating heterogeneous microvascular responses to acetylcholine in different vascular beds. J. Pharmacol. Exp. Ther. 282,1473-1479[Abstract/Free Full Text]
  9. Campbell, W. B., Gebremedhin, D., Pratt, P. F., Harder, D. R. (1996) Identification of epoxyeicosatrienoic acids as endothelium-derived hyperpolarizing factors. Circ. Res. 78,415-423[Abstract/Free Full Text]
  10. Eckman, D. M., Hopkins, N., McBride, C., Keef, K. D. (1998) Endothelium-dependent relaxation and hyperpolarization in guinea-pig coronary artery: role of epoxyeicosatrienoic acid. Br. J. Pharmacol. 124,181-189[Medline]
  11. Miura, H., Gutterman, D. D. (1998) Human coronary arteriolar dilation to arachidonic acid depends on cytochrome P-450 monooxygenase and Ca2+-activated K+ channels. Circ. Res. 83,501-507[Abstract/Free Full Text]
  12. Oltman, C. L., Weintraub, N. L., Vanrollins, M., Dellsperger, K. C. (1998) Epoxyeicosatrienoic acids and dihydroxyeicosatrienoic acids are potent vasodilators in the canine coronary microcirculation. Circ. Res. 83,932-939[Abstract/Free Full Text]
  13. Li, P. L., Campbell, W. B. (1997) Epoxyeicosatrienoic acids activate K+ channels in coronary smooth muscle through a guanine nucleotide binding protein. Circ. Res. 80,877-884[Abstract/Free Full Text]
  14. Rifkind, A. B., Lee, C., Chang, T. K., Waxman, D. J. (1995) Arachidonic acid metabolism by human cytochrome P450s 2C8, 2C9,2E1, and 1A2: regioselective oxygenation and evidence for a role for CYP2C enzymes in arachidonic acid epoxygenation in human liver microsomes. Arch. Biochem. Biophys. 320,380-389[Medline]
  15. Wu, S., Chen, W., Murphy, E., Gabel, S., Tomer, K. B., Foley, J., Steenbergen, C., Falck, J. R., Moomaw, C. R., Zeldin, D. C. (1997) Molecular cloning, expression, and functional significance of a cytochrome P450 highly expressed in rat heart myocytes. J. Biol. Chem. 272,12551-12559[Abstract/Free Full Text]
  16. Lin, J. H. C., Kobari, Y., Zhu, Y., Stemerman, M. B., Pritchard, K. A. (1996) Human umbilical vein endothelial cells express P450 1C8 mRNA: Cloning of endothelial P450 epoxygenase. Endothelium 4,219-229
  17. Bolz, S. S., Pohl, U. (1997) Indomethacin enhances endothelial NO release—evidence for a role of PGI2 in the autocrine control of calcium-dependent autacoid production. Cardiovasc. Res. 36,437-444[Abstract/Free Full Text]
  18. Meininger, G. A., Zawieja, D. C., Falcone, J. C., Hill, M. A., Davey, J. P. (1991) Calcium measurement in isolated arterioles during myogenic and agonist stimulation. Am. J. Physiol. 261,H950-H959[Abstract/Free Full Text]
  19. Pieperhoff, S., Bolz, S. S., de Wit, C., Pohl, U. (1998) The ACh-induced endothelium-dependent dilation in isolated small skeletal arteries of the hamster is maintained after 48h in culture. J. Vasc. Res. 35,225abstr.
  20. Popp, R., Bauersachs, J., Hecker, M., Fleming, I., Busse, R. (1996) A transferable, beta-naphthoflavone-inducible, hyperpolarizing factor is synthesized by native and cultured porcine coronary endothelial cells. J. Physiol. (London) 497,699-709
  21. Morishima, N., Yoshioka, H., Higashi, Y., Sogawa, K., Fujii-Kuriyama, Y. (1987) Gene structure of cytochrome P-450(M-1) specifically expressed in male rat liver. Biochemistry 26,8279-8285[Medline]
  22. Sakuma, T., Masaki, K., Itoh, S., Yokoi, T., Kamataki, T. (1994) Sex-related differences in the expression of cytochrome P450 in hamsters: cDNA cloning and examination of the expression of three distinct CYP2C cDNAs. Mol. Pharmacol. 45,228-236[Abstract]
  23. Graier, W. F., Simecek, S., Sturek, M. (1995) Cytochrome P450 mono-oxygenase-regulated signalling of Ca2+ entry in human and bovine endothelial cells. J. Physiol. (London) 482,259-274[Medline]
  24. Hoebel, B. G., Kostner, G. M., Graier, W. F. (1997) Activation of microsomal cytochrome P450 mono-oxygenase by Ca2+ store depletion and its contribution to Ca2+ entry in porcine aortic endothelial cells. Br. J. Pharmacol. 121,1579-1588[Medline]
  25. Dora, K. A., Doyle, M. P., Duling, B. R. (1997) Elevation of intracellular calcium in smooth muscle causes endothelial cell generation of NO in arterioles. Proc. Natl. Acad. Sci. USA 94,6529-6534[Abstract/Free Full Text]
  26. McGahren, E. D., Beach, J. M., Duling, B. R. (1998) Capillaries demonstrate changes in membrane potential in response to pharmacological stimuli. Am. J. Physiol. 274,H60-H65[Abstract/Free Full Text]
  27. Beach, J. M., McGahren, E. D., Xia, J., Duling, B. R. (1996) Ratiometric measurement of endothelial depolarization in arterioles with a potential-sensitive dye. Am. J. Physiol. 270,H2216-H2227[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Exp PhysiolHome page
J. Wray and D. Bishop-Bailey
Epoxygenases and peroxisome proliferator-activated receptors in mammalian vascular biology
Exp Physiol, January 1, 2008; 93(1): 148 - 154.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. P. Mortensen, J. Gonzalez-Alonso, R. Damsgaard, B. Saltin, and Y. Hellsten
Inhibition of nitric oxide and prostaglandins, but not endothelial-derived hyperpolarizing factors, reduces blood flow and aerobic energy turnover in the exercising human leg
J. Physiol., June 1, 2007; 581(2): 853 - 861.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. A. Hagedorn, C.-L. Cooke, J. R. Falck, B. F. Mitchell, and S. T. Davidge
Regulation of Vascular Tone During Pregnancy: A Novel Role for the Pregnane X Receptor
Hypertension, February 1, 2007; 49(2): 328 - 333.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Lu, D. Ye, X. Wang, J. M. Seubert, J. P. Graves, J. A. Bradbury, D. C. Zeldin, and H.-C. Lee
Cardiac and vascular KATP channels in rats are activated by endogenous epoxyeicosatrienoic acids through different mechanisms
J. Physiol., September 1, 2006; 575(2): 627 - 644.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
S. Taddei, D. Versari, A. Cipriano, L. Ghiadoni, F. Galetta, F. Franzoni, A. Magagna, A. Virdis, and A. Salvetti
Identification of a Cytochrome P450 2C9-Derived Endothelium-Derived Hyperpolarizing Factor in Essential Hypertensive Patients
J. Am. Coll. Cardiol., August 1, 2006; 48(3): 508 - 515.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Feletou and P. M. Vanhoutte
Endothelium-Derived Hyperpolarizing Factor: Where Are We Now?
Arterioscler. Thromb. Vasc. Biol., June 1, 2006; 26(6): 1215 - 1225.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. Siegl, M. Koeppen, S. E. Wolfle, U. Pohl, and C. de Wit
Myoendothelial Coupling Is Not Prominent in Arterioles Within the Mouse Cremaster Microcirculation In Vivo
Circ. Res., October 14, 2005; 97(8): 781 - 788.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Watanabe, J. Suzuki, H. Yamawaki, V. K. Sharma, S.-S. Sheu, and B. C. Berk
Losartan Metabolite EXP3179 Activates Akt and Endothelial Nitric Oxide Synthase via Vascular Endothelial Growth Factor Receptor-2 in Endothelial Cells: Angiotensin II Type 1 Receptor-Independent Effects of EXP3179
Circulation, September 20, 2005; 112(12): 1798 - 1805.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. You, E. M. Golding, and R. M. Bryan Jr.
Arachidonic acid metabolites, hydrogen peroxide, and EDHF in cerebral arteries
Am J Physiol Heart Circ Physiol, September 1, 2005; 289(3): H1077 - H1083.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Wang, X. Wei, X. Xiao, R. Hui, J. W. Card, M. A. Carey, D. W. Wang, and D. C. Zeldin
Arachidonic Acid Epoxygenase Metabolites Stimulate Endothelial Cell Growth and Angiogenesis via Mitogen-Activated Protein Kinase and Phosphatidylinositol 3-Kinase/Akt Signaling Pathways
J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 522 - 532.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Koeppen, R. Feil, D. Siegl, S. Feil, F. Hofmann, U. Pohl, and C. de Wit
cGMP-Dependent Protein Kinase Mediates NO- but not Acetylcholine-Induced Dilations in Resistance Vessels In Vivo
Hypertension, December 1, 2004; 44(6): 952 - 955.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
P. S. Clifford and Y. Hellsten
Vasodilatory mechanisms in contracting skeletal muscle
J Appl Physiol, July 1, 2004; 97(1): 393 - 403.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S.-S. Bolz, L. Vogel, D. Sollinger, R. Derwand, C. de Wit, G. Loirand, and U. Pohl
Nitric Oxide-Induced Decrease in Calcium Sensitivity of Resistance Arteries Is Attributable to Activation of the Myosin Light Chain Phosphatase and Antagonized by the RhoA/Rho Kinase Pathway
Circulation, June 24, 2003; 107(24): 3081 - 3087.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Earley, A. Pastuszyn, and B. R. Walker
Cytochrome P-450 epoxygenase products contribute to attenuated vasoconstriction after chronic hypoxia
Am J Physiol Heart Circ Physiol, June 5, 2003; 285(1): H127 - H136.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
F. Krotz, H. Y. Sohn, M. Keller, T. Gloe, S. S. Bolz, B. F. Becker, and U. Pohl
Depolarization of Endothelial Cells Enhances Platelet Aggregation Through Oxidative Inactivation of Endothelial NTPDase
Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2003 - 2009.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
B. Hoepfl, B. Rodenwaldt, U. Pohl, and C. de Wit
EDHF, but not NO or prostaglandins, is critical to evoke a conducted dilation upon ACh in hamster arterioles
Am J Physiol Heart Circ Physiol, September 1, 2002; 283(3): H996 - H1004.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. Bauersachs, M. Christ, G. Ertl, U.R. Michaelis, B. Fisslthaler, R. Busse, and I. Fleming
Cytochrome P450 2C expression and EDHF-mediated relaxation in porcine coronary arteries is increased by cortisol
Cardiovasc Res, June 1, 2002; 54(3): 669 - 675.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
E. M. Golding, S. P. Marrelli, J. You, and R. M. Bryan Jr
Endothelium-Derived Hyperpolarizing Factor in the Brain: A New Regulator of Cerebral Blood Flow?
Stroke, March 1, 2002; 33(3): 661 - 663.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. A. Schildmeyer and R. M. Bryan Jr.
Effect of NO on EDHF response in rat middle cerebral arteries
Am J Physiol Heart Circ Physiol, February 1, 2002; 282(2): H734 - H738.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. J. Roman
P-450 Metabolites of Arachidonic Acid in the Control of Cardiovascular Function
Physiol Rev, January 1, 2002; 82(1): 131 - 185.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
B. C. BERK, J.-I. ABE, W. MIN, J. SURAPISITCHAT, and C. YAN
Endothelial Atheroprotective and Anti-inflammatory Mechanisms
Ann. N.Y. Acad. Sci., December 1, 2001; 947(1): 93 - 111.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Fleming
Cytochrome P450 and Vascular Homeostasis
Circ. Res., October 26, 2001; 89(9): 753 - 762.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. L. Tuttle and J. C. Falcone
Nitric oxide release during {alpha}1-adrenoceptor-mediated constriction of arterioles
Am J Physiol Heart Circ Physiol, August 1, 2001; 281(2): H873 - H881.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. Coats, F. Johnston, J. MacDonald, J. J. V. McMurray, and C. Hillier
Endothelium-Derived Hyperpolarizing Factor : Identification and Mechanisms of Action in Human Subcutaneous Resistance Arteries
Circulation, March 27, 2001; 103(12): 1702 - 1708.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
I. Fleming, U. R. Michaelis, D. Bredenkötter, B. Fisslthaler, F. Dehghani, R. P. Brandes, and R. Busse
Endothelium-Derived Hyperpolarizing Factor Synthase (Cytochrome P450 2C9) Is a Functionally Significant Source of Reactive Oxygen Species in Coronary Arteries
Circ. Res., January 19, 2001; 88(1): 44 - 51.
[Abstract] [Full Text]


Home page
CirculationHome page
S.-S. Bolz, J. Galle, R. Derwand, C. de Wit, and U. Pohl
Oxidized LDL Increases the Sensitivity of the Contractile Apparatus in Isolated Resistance Arteries for Ca2+ via a Rho- and Rho Kinase-Dependent Mechanism
Circulation, November 7, 2000; 102(19): 2402 - 2410.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S.-S. Bolz, S. Pieperhoff, C. De Wit, and U. Pohl
Intact endothelial and smooth muscle function in small resistance arteries after 48 h in vessel culture
Am J Physiol Heart Circ Physiol, September 1, 2000; 279(3): H1434 - H1439.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Popp, R. P. Brandes, G. Ott, R. Busse, and I. Fleming
Dynamic Modulation of Interendothelial Gap Junctional Communication by 11,12-Epoxyeicosatrienoic Acid
Circ. Res., April 19, 2002; 90(7): 800 - 806.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager