FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MÜLLER, M.
Right arrow Articles by FRANZ, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MÜLLER, M.
Right arrow Articles by FRANZ, W. M.
(The FASEB Journal. 2000;14:2540-2548.)
© 2000 FASEB

Selection of ventricular-like cardiomyocytes from ES cells in vitro

M. MÜLLER, B. K. FLEISCHMANN*, S. SELBERT, G. J. JI*, E. ENDL{dagger}, G. MIDDELER, O. J. MÜLLER, P. SCHLENKE§, S. FRESE, A. M. WOBUS{ddagger}, J. HESCHELER*, H. A. KATUS and W. M. FRANZ1

Internal Medicine II, University of Lübeck, D-23538 Lübeck;
* Institute of Neurophysiology, University of Cologne, D-50931 Cologne;
{dagger} Division of Molecular Immunology, Research Center Borstel, D-23845 Borstel;
{ddagger} Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben; and
§ Department of Immunology, University of Lübeck, D-23538 Lübeck, Germany

1Correspondence: Medizinische Klinik II, Medizinische Universität zu Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany. E-mail: franz{at}medinf.mu-luebeck.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ischemic disorders of the heart can cause an irreversible loss of cardiomyocytes resulting in a substantial decrease of cardiac output. The therapy of choice is heart transplantation, a technique that is hampered by the low number of donor organs. In the present study, we describe the specific labeling, rapid but gentle purification and characterization of cardiomyocytes derived from mouse pluripotent embryonic stem (ES) cells. To isolate the subpopulation of ventricular-like cardiomyocytes, ES cells were stable transfected with the enhanced green fluorescent protein (EGFP) under transcriptional control of the ventricular-specific 2.1 kb myosin light chain-2v (MLC-2v) promoter and the 0.5 kb enhancer element of the cytomegalovirus (CMVenh.). First fluorescent cells were detected at day 6 + 8 of differentiation within EBs. Four weeks after initiation of differentiation 25% of the cardiomyocyte population displayed fluorescence. Immunohistochemistry revealed the exclusive cardiomyogenic nature of EGFP-positive cells. This was further corroborated by electrophysiological studies where preferentially ventricular phenotypes, but no pacemaker-like cardiomyocytes, were detected among the EGFP-positive population. The enzymatic digestion of EBs, followed by Percoll gradient centrifugation and fluorescence-activated cell sorting, resulted in a 97% pure population of cardiomyocytes. Based on this study, ventricular-like cardiomyocytes can be generated in vitro from EBs and labeled using CMVenh./MLC-2v-driven marker genes facilitating an efficient purification. This method may become an important tool for future cell replacement therapy of ischemic cardiomyopathy especially after the proof of somatic differentiation of human ES cells in vitro.—Müller, M., Fleischmann, B. K., Selbert, S., Ji, G. J., Endl, E., Middeler, G., Mueller, O. J., Schlenke, P., Frese, S., Wobus, A. M., Hescheler, J., Katus, H. A., Franz, W. M. Selection of ventricular-like cardiomyocytes from ES cells in vitro.


Key Words: embryoid body • cardiac • green fluorescent protein • in vitro differentiation


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ADULT MAMMALIAN CARDIOMYOCYTES are terminally differentiated and have no or only limited regenerative capacity (1) . This is particularly limiting for a variety of heart disorders such as ischemic and dilated cardiomyopathies, where progressive heart failure can ultimately be treated only by transplantation. Due to the limited availability of organs, an alternative approach has been the isolation and implantation of different types of myocytes (2) and cardiomyocytes into the diseased myocardium of rodents (3 4 5 6) . These studies demonstrated that transplanted cells could engraft and even form functional gap junctions with the host myocardium. In addition, revascularization as well as recovery from defective left ventricular function has been observed (5) . The lack of human cardiac cell lines, however, poses a serious limitation of this approach. Efforts to generate myocardial cell lines have focused largely on the targeted expression of oncogenes, either in cultured cardiomyocytes (7) or in the myocardium of transgenic animals (8 , 9) . However, no established lines exhibiting the typical morphological and functional features of adult cardiomyocytes in particular after repeated passages have been reported. The establishment of a cardiac-specific cell line, i.e., of ventricular-like cardiomyocytes, would be a major step toward a cell-mediated replacement therapy.

Our and other groups have recently shown that cardiomyocytes derived from embryonic stem (ES) cells are a valid source for the generation of cardiomyocytes of different developmental stages. Pluripotent murine ES cells, derived from the inner cell mass of blastocysts (10) and adapted to permanent cell culture, can be induced to differentiate in vitro into a variety of cell lineages, i.e., cardiomyocytes (10 , 11) skeletal (12) and smooth muscle (13) , neurons (14) , and endothelial cells (15) . In the case of the ES cell-derived cardiomyogenesis it has been unequivocally shown that at the terminally differentiated stage, all different cardiac phenotypes—sinus nodal-, pacemaker-, atrial-, and ventricular-like cells—can be detected (16) . In contrast to other primary or transgenic cardiac cell lines the ES cell system may provide a valid source for the generation of human cardiomyocytes, particularly after the recent establishment of human ES/EG cell lines (17 , 18) as well as their differentiation (19) . However, the availability of ES cell-derived ventricular-like cardiomyocytes is limited by the fact that 1) only ~5% of all cells within EBs are cardiomyocytes, 2) all the different cardiac phenotypes are present, and 3) the isolation of these cardiomyocytes has been impossible so far (20) . To improve the selection of cardiomyocytes within EBs, an {alpha}-cardiac myosin heavy chain (MHC) promoter driving a neomycin selection gene was established (3) . After differentiation and selection using G418, exclusively cardiomyocytes survived. Because the {alpha}-MHC promoter is active in the entire adult heart, including atrial and pacemaker cells, all the different cardiac phenotypes are positively selected. Similarly, EGFP labeling of ES cell-derived cardiomyocytes driven by the human cardiac {alpha}-actin promoter stained all different phenotypes of cardiomyocytes (21) . In contrast, the myosin light chain-2v (MLC-2v) promoter is characterized by its ventricle specific expression (22) . Previously, we have shown that transgenic mice, in which the 2.1 kb MLC-2v promoter drives the luciferase reporter gene, display ventricle-restricted expression (23) and that this promoter driving the ß-galactosidase reporter gene specifically stained ventricular cardiomyocytes in EBs (16) .

The aim of the present study was to establish ES cell lines from which ventricular-like cardiomyocytes could be identified, facilitating an easy and efficient isolation procedure. For this purpose transgenic ES cell lines were generated expressing the enhanced version of the green fluorescent protein (EGFP) under the transcriptional control of the CMVenh./MLC-2v promoter. We demonstrate here that ventricle-specific expression occurs within several transgenic ES cell lines during early development. These EGFP-positive cells displayed morphological, histological, immunocytochemical, as well as electrophysiological features characteristic of ventricular-like cardiomyocytes. We further show reproducibly that large amounts of cardiomyocytes can be sorted using fluorescence-activated cell sorting (FACS).


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Transfection constructs
A 2.1 kb KpnI-EcoRI DNA fragment of the 5' upstream regulatory sequence of the rat cardiac MLC-2v gene (23) was subcloned in the pIC20H cloning vector. After subcloning of the MLC-2v promoter into pBluescript SK+ (SalI-EcoRI) (Stratagene, San Diego, Calif.), it was introduced in pEGFP-1 (Clontech, Palo Alto, Calif.) by EcoRI-XhoI digestion, resulting in the construct pMLC-EGFP. To enhance the MLC-2v promoter, the -590/91 bp fragment of the human cytomegalovirus immediate-early enhancer (CMVenh.) (24) was generated by polymerase chain reaction (template: CMV-EGFP vector (Clontech), primers: forward FCMV: CTATGCGGCCGCCGCTTCGAGCTCGCCCGACATTGATTATTGACTAGT and reverse RCMV: CTATGCGGCCGCATGGGGCGGAGTTGTTACGACATTTTGGAAAGT) and inserted in pBLSK using NotI. After SacII-BamHI digestion, CMVenh. was subcloned clockwise into the same sites of pEGFP resulting in pCMVenh.-EGFP. The MLC-2v cassette was isolated from pMLC-EGFP by XbaI (blunt ended) -XhoI digestion and introduced in pCMVenh.-EGFP BamHI (blunt ended) -XhoI. This vector was called pCMVenh./MLC-EGFP (Fig. 1 ); 10 µg BglII linearized vector was used for electroporation (240V/500 µF) of 2.5 x 107 ES cells.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Structure of the used EGFP transfection constructs. pMLC-EGFP contained the 2.1 kb MLC-2v promoter driving the EGFP marker gene, pCMVenh./MLC-EGFP, the MLC-2v promoter plus the human CMV immediate-early enhancer element (CMVenh.). pEGFP was a promoterless control construct. All constructs contained a CMV-neomycin cassette for positive selection in G418 (not shown).

Cell culture
The mouse embryonic stem cell line (GS-ES) (25) was provided by Dr. M. Aguet (ISREC, Lausanne, Switzerland). GS-ES cells are derived from the mouse strain Agouti 129/SV and were germline competent. In comparison to previously used D3 cells, they have a higher capacity to spontaneously differentiate to contracting cardiomyocytes. Transgenic ES cells were propagated in high glucose Dulbecco’s modified Eagle medium supplemented with 10% heat-inactivated ES qualified fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 1x nonessential amino acids, 0.4 mg/ml GENETICIN (G418) (all reagents GIBCO BRL, Germany), and 0.1 mM ß-mercaptoethanol (Sigma, Germany). They were kept undifferentiated on confluent feeder layers of mitomycin C-treated primary culture of murine embryonic fibroblasts and by addition of 1000 units/ml purified recombinant mouse leukemia inhibitory factor (ESGRO; Life Technologies, Inc., Grand Island, N.Y.). Cells were maintained at 37°C in a humidified atmosphere of 5% CO2/95% air. Monolayers were passaged by trypsinization at confluence of 70–80%.

In vitro differentiation was initiated essentially as described by Klug et al. (3) . Briefly, ES cells were harvested with 0.25% trypsin-EDTA and dissociated cells were transferred to bacteriological dishes at a density of 2 x 105 ES cells/ml in ISCOVE’s modified Eagle medium (Sigma) supplemented with 10% heat inactivated fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 1x nonessential amino acids (all reagents Life Technologies, Inc.), and 450 µM {alpha}-monothioglycerol (Sigma). After 3 days, EBs were transferred to new medium. At day 6, EBs with a similar size were plated onto gelatin-coated tissue culture dishes. The growth medium for the attached differentiation cultures was changed every other day.

For further characterization and purification of in vitro differentiated cardiomyocytes, the cells were processed according to a protocol for the isolation of primary rat neonatal cardiomyocytes (7) . Briefly, EBs were washed with phosphate-buffered saline (PBS) and digested by collagenase II (Worthington, N.J.) and pancreatin (Life Technologies, Inc.) in HEPES at pH 7.35 and 37°C for 2–4 h. Digestion was monitored microscopically.

Antibodies and immunofluorescence labeling
Embryoid body (EB) outgrowths (day 6+25) or single cells prepared from day 6 + 25 EBs and grown for another 2 days on gelatinized 12 mm glass coverslips (200,000 cells/ml) were rinsed with PBS fixed for 20 min at room temperature with 3.7% formaldehyde and neutralized with 50 mM glycine. The cells were permeabilized using 0.4% Triton X-100 in PBS and incubated with the primary antibody in a humidified chamber at 37°C for 2 h. After washing with 0.4% Triton X-100 and PBS, secondary Cy3-conjugated antibody was added and the specimen were incubated for 2 h at 37°C. Finally, the cells were washed and mounted with Mowiol 4–88 (Calbiochem, Germany).

Monoclonal antibodies against skeletal and cardiac myosin (A4.1025) (26) ; atrial MHC (F88.12F8) (27) were obtained from Alexis Corp. (Grünberg, Germany). TRITC-labeled phalloidin and the monoclonal antibodies recognizing sarcomeric {alpha}-actinin (EA-53) and fast skeletal myosin (My-32) were purchased from Sigma. Anti-troponin I antibody (4B7) has been described (28) .

FACS analysis
EB outgrowths (day 6+25) were digested as mentioned above. 0.5 x 106 cells were washed with PBS and fixed for 20 min in ice-cold 3.7% paraformaldehyde. The cells were permeabilized for 10 min using 0.4% Triton X-100 in cold PBS/5% bovine serum albumin (BSA) and incubated for 1 h with the primary antibody in a volume of 100 µl PBS/5% BSA at 37°C. After washing twice with PBS/5% BSA, secondary Cy5-conjugated antibody (Dianova, Berlin, Germany) was added and the cells were incubated for 1 h at 37°C. Finally, the cells were washed in PBS and analyzed. Flow cytometric analysis was performed on a dual laser FACS Calibur (Becton Dickinson, Germany). A 530/30 nm bandpass filter was used to measure EGFP fluorescence intensity excited with the 488 nm line of an argon ion laser. CY5 fluorescence was excited separately by the 635 nm emission line of a laser diode and monitored with a 661/16 nm bandpass filter. Detector settings were adjusted with untransfected cells that were fixed, permeabilized, and stained as described above, except that the primary antibody was replaced by a corresponding isotype control antibody (MOPC-21, Sigma). Data of 50,000 cells were recorded using the CellQuest Acquisition software (Becton Dickinson).

Preparation of single cells and electrophysiology
For the patch-clamp experiments, whole EBs or beating areas of 20–30 EBs (day 6+15) were dissected and isolated by enzymatic dispersion, using collagenase B (Boehringer-Ingelheim, Germany) (29) . The solution used for the dissociation of the dissected areas was (in mmol/l): NaCl 120, KCl 5.4, MgSO4 5, CaCl2 0.03, Na pyruvate 5, glucose 20, taurine 20, HEPES 10, collagenase B 0.5–1 mg/ml, pH 6.9 (NaOH). The dissociated material was plated onto gelatin-coated glass coverslips and put into the incubator in 20% FCS containing DMEM medium. The glass coverslips containing the cells were placed into a temperature-controlled (37°C) recording chamber and perfused continuously with extracellular solution by gravity at a rate of ~1 ml/min. Substances were applied by exchanging the solution in the chamber; a 90% volume exchange was achieved within ~20 s. Patch pipettes (2–4 M{Omega} resistance) were pulled from Clark (Electromedical Instruments, Reading, U.K.) borosilicate glass using a Zeitz puller (DMZ, Munich, Germany).

Spontaneously beating EGFP-positive cardiac cells were selected under a 40x objective (Zeiss, Jena, Germany) using a Xenon excitation light source (Zeiss) and a FITC filter set. For the patch-clamp recordings, the whole-cell configuration of the patch-clamp technique was applied (29) . The cells were measured in the current-clamp mode using an Axopatch 200-A amplifier (Axon Instruments, Foster City, Calif.). Data were acquired at a sampling rate of 10 kHz, filtered at 1 kHz, stored on hard disk, and analyzed off-line using the ISO2 analysis software package (MFK, Frankfurt, Germany). Statistical analysis was performed using unpaired Student’s t test, and a P value of < 0.05 was considered significant.

The solutions used for current and voltage clamp recordings had the following composition (in mM): Internal solution: KCl 50, KAspartate 80, MgCl2 1, MgATP 3, EGTA 10, HEPES 10, pH 7.4 (KOH). External solution: NaCl 140, KCl 5.4, CaCl2 3.6, MgCl2 1, HEPES 10, glucose 10 pH 7.4 (NaOH).

Preparation of isolated cardiomyocytes from EBs
1 x 108 collagenase II and pancreatin-treated EBs were resuspended in ES cell medium and purified by Percoll gradient centrifugation (7) . Using a bottom layer of 1.12 g/ml and a top layer of 1.06 g/ml, the cardiomyocytes migrated to the interface of both layers during centrifugation at 1300 g for 45 min. After removal of the top layer, cardiomyocytes were collected and washed twice in PBS. The final cell pellet was resuspended in ES cell medium. Cell sorting was performed on a FACStarPLUS cell sorter. EGFP was excited with the 488 nm line of an argon ion laser and recorded using a 530/30 nm bandpass filter. Sorting was based on the intensity of forward scattered light (FSC) and EGFP fluorescence intensity. The sort gate for EGFP-positive cells was established on the basis of the FSC and EGFP intensity of untransfected cells. EGFP-positive cells were sorted directly into culture medium containing tissue flasks for further cell culture or sorted into glass tubes containing culture medium and reanalyzed to estimate sort purity. WinMDI Software (Joe Trotter, Scripps Institute, San Diego, Calif.) was used for data presentation and statistical evaluation of the defined cell populations.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Identification of the EGFP-positive ES cell clones
The structure of the three electroporation constructs is depicted in Fig. 1 . 10–20 ES cell clones of each construct were selected, amplified, and differentiated. In the case of the MLC-2v promoter construct, three positive clones were identified (clones #6, #10 and #20), but the number of EGFP-positive cells per beating area at all developmental stages was low (<= 20) (Fig. 2 and Table 1 ). In contrast, the number of EGFP-positive cells per beating area in CMVenh./MLC-EGFP-positive EBs was increased (Fig. 2) . For this construct, nine positive clones were identified with four clones (#15, #18, #22, and #27) displaying a high number of green fluorescent cells (>20) within the spontaneously beating areas of EBs (Table 1) . The remaining five CMVenh./MLC-EGFP clones showed similar results as the MLC-EGFP clones. As expected, in the negative control with the promoterless EGFP construct no green fluorescent cells were observed despite the high number of beating areas within these EBs (data not shown).



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. EGFP expression in transgenic EBs. Two comparable and representative beating areas of transfected EBs at day 6 + 14 are shown. A) MLC-EGFP (clone #20) with less than 20 EGFP-positive cells per beating area and B) CMVenh./MLC-EGFP (clone #27) with ~150 EGFP-positive cells per beating area. In EBs transfected with the promoterless pEGFP construct, no EGFP activity was detectable (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. EGFP expression

Characterization of the in vitro differentiation of ES cell-derived EGFP-positive clones
At different times, EBs were analyzed for beating and content of EGFP-positive cells. Three positive CMVenh./MLC-EGFP clones (#18, #22, and #27), all showing more than 20 green fluorescent cells per beating area, one MLC-EGFP clone (#20), and one untransfected control were investigated by light microscopy (Fig. 3A ). All clones analyzed showed a similar developmental pattern with first contracting cells in the EB outgrowths reproducibly appearing at day 6 + 6. At day 6 + 13, ~20% of the total EB outgrowth was beating (Fig. 3A ), whereby 85 ± 5% of all EBs displayed contracting areas (data not shown). At later time points the number of beating areas within EBs decreased and at day 6 + 30 almost no beating areas were observed (Fig. 3A ).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 3. EB development and EGFP activity in untransfected (•), MLC-EGFP transfected clone #20 (*) and in CMVenh/MLC-EGFP transfected ES cell clones #18 ({blacktriangleup}), #22 ({blacksquare}) and #27 ({diamondsuit}). Percentage of beating areas of total EB outgrowth (A) and number of EGFP-positive cells per EB (B) was determined by light microscopy. EGFP fluorescence intensity (C) was measured by FACS analysis of 50 enzymatically digested EBs. The dotted line in panel C represents background level. Values are given as means ±SE from three independent experiments.

Analysis by fluorescence microscopy (Fig. 3B ) and flow cytometry (Fig. 3C ) of differentiating CMVenh./MLC-EGFP transfected EBs revealed first EGFP-positive cells 2 days after the onset of spontaneous contractions (day 6 + 8). Subsequently, the number of EGFP-positive cells increased up to day 6 + 25 (Fig. 3B ). The maximum of fluorescence intensity was reached at day 6 + 35 (Fig. 3C ). At later time points, a slight drop in both the intensity and the number of EGFP-positive cells was noticed. Among the CMVenh./MLC-EGFP clones, #27 showed the highest amount of fluorescent cells and the strongest intensity of fluorescence, and was therefore chosen for further analysis. The fluorescence intensity of MLC-EGFP-positive cells (clone #20) and cells of the untransfected control were below detection level (Fig. 3C ).

Specificity of the EGFP expression in ES cell-derived cardiomyocytes
The cardiac nature of the EGFP expressing cells within the EB (clone #27) was proven with antibody staining specific for fast skeletal myosin (My-32). FACS analysis of enzymatically dispersed single cells showed that only a small population of EGFP negative skeletal muscle cells was present in the EB (0.06%) (Fig. 4A ). No fluorescent My-32-positive skeletal myocytes could be detected. Staining with antibodies against either {alpha}-actinin (Fig. 4B ) or myosin (data not shown) demonstrated that almost all EGFP-positive cells (91%) stain positive with either antibody. However, only 0.4% out of total 1.52% sarcomeric cells were green fluorescent (27%) (Fig. 4B ). Staining with an antibody specific for human atrial myocytes resulted in only 0.01% EGFP double-positive cells (Fig. 4C ). No EGFP staining was detectable in the IgG control experiment (Fig. 4D ).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 4. FACS analysis of single cell preparation of embryoid body outgrowth. EB outgrowths were enzymatically digested at day 6 + 25. Single cell suspension was stained with antibodies specific for fast skeletal myosin (A), {alpha}-actinin (B), atrial myosin (C), and an IgG1 isotype control antibody (D).

Similarly, immunohistochemistry with EBs stained for myosin showed that only a subpopulation of cells within a distinct myofibrillar structure was positive for EGFP (Fig. 5A , B ). EBs generated from less than 2 x 105 ES cells favored skeletal muscle differentiation, which was detected preferentially at the periphery of the EB with no skeletal myosin staining of EGFP-positive cells (data not shown). Striations by sarcomeric structures could be detected with antibodies against {alpha}-actinin (Fig. 5C , D ) and troponin I (data not shown) in EGFP-positive as well as EGFP-negative cells. Antibody staining for human atrial myosin detected a small population of EGFP-positive cells (Fig. 5E , F ).



View larger version (152K):
[in this window]
[in a new window]
 
Figure 5. Immunohistochemical characterization of EGFP-positive cells: (A, C, E) show green fluorescence after EGFP excitation. (B, D, F) show immunoreactivity of the same area. EBs (A, B) were stained at day 6 + 25 with an antibody against myogenic MHC (B); bar 10 µm. After single cell preparation, EGFP-positive cells were labeled for {alpha}-actinin (D); bar 12.5 µm, and atrial MHC (F); bar 25 µm.

Electrophysiological and pharmacological characterization of EGFP-positive cardiomyocytes
To examine the electrophysiological properties of ES cell-derived cardiomyocytes, patch-clamp recordings were performed on spontaneously contracting isolated cardiomyocytes. EBs of CMVenh./MLC-EGFP transfected ES cells were harvested at day 6 + 15.

The ventricular specificity of CMVenh./MLC-EGFP labeling is summarized in Fig. 6A . Thirteen of 16 EGFP-positive cells (82%) displayed typical ventricular-like action potentials (AP) with a negative membrane potential of -68.6 ± 2.8 mV, an AP duration (APD) of 118.3 ± 15.2 ms, an overshoot of 34.3 ± 3.9 mV, and the clearly pronounced plateau phase indicating the long lasting Ca2+ influx through L-type Ca2+ channels (Fig. 6B ) (31) . Furthermore, these 13 cells revealed prolongation of APD in the presence of the ß-adrenergic agonist isoprenaline (Iso, 0.1 µM), which is known to prolong APD at the late developmental stage due to stimulation of L-type Ca2+-channels (31) . Incubation with the muscarinic agonist carbachol (CCh, 1 µM), which has a pronounced negative chronotropic effect on the spontaneous electrical activity in early cells, did not result in any effect on APD and the membrane potential of EGFP-positive cells as can be expected for ventricular-like cardiomyocytes (34) . 12% of EGFP-positive cells (n=2) showed atrial-like membrane potentials whereas 6% could be classified as early-type cardiomyocytes (n=1) (Fig. 6A ). In contrast, EGFP negative cells revealed a strong negative chronotropic response on CCh application without concomitant hyperpolarization (n=5) (data not shown). In accordance with earlier studies, no toxicity associated with the expression of EGFP could be detected (21) .



View larger version (26K):
[in this window]
[in a new window]
 
Figure 6. A) Patch-clamp analysis of CMVenh./MLC-EGFP transfected green fluorescent cardiomyocytes. EBs were grown to day 6 + 15 before single isolated cardiomyocytes (GS, n=16) were characterized by their electrophysiological properties (action potentials and ion currents) using the patch-clamp technique. Based on the type of action potential, recorded cells were classified as ventricle-like, atrial-like, early, atrio-ventricular-like, and Purkinje-like. B) Hormonal modulation of the spontaneous electrical activity of EGFP-positive ES cell-derived cardiomyocytes using current clamp recordings: Two representative EGFP-positive cells show ventricular-like action potentials: a relatively long action potential duration plateau phase, negative maximal diastolic potential, and a large overshoot. These EGFP-positive cells were insensitive to treatment with the muscarinic agonist, carbachol (CCh). In contrast, the ß-adrenergic agonist isoprenaline prolonged the action potential duration of EGFP-positive cells and evoked a positive chronotropic response, which was reversed by wash out.

Purification of EGFP-positive ventricular-like cardiomyocytes
To achieve a pure fraction of ventricular-like cardiomyocytes, we performed a dual strategy including Percoll gradient density centrifugation followed by FACS. EB outgrowths generated from 1 x 106 ES cells were digested at day 6 + 25. 1 x 108 unpurified differentiated cells containing ~0.2% green fluorescent particles (2x105) (Fig. 7A ) were loaded on a Percoll gradient, resulting in a three- to fivefold enrichment of EGFP-positive cells (Fig. 7B ). Subsequent FACS yielded in a 97% pure fraction of 5 x 104 EGFP-positive cells (Fig. 7C ). Adherent cells started to contract again and demonstrated an intact sarcomeric structure (Fig. 8A , B , C , D ).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Purification of EGFP-positive cardiomyocytes. A) FACS profile of an unpurified single cell preparation at day 6 + 25. B) After Percoll density centrifugation, a three- to fivefold enriched EGFP-positive cell population can be found in the interphase. C) After FACS sorting, green fluorescent cells are 97% pure. In all graphs EGFP fluorescence intensity is plotted against forward scatter, an index of cell size. Each graph shows 10,000 cells.



View larger version (140K):
[in this window]
[in a new window]
 
Figure 8. Immunohistochemistry of purified beating EGFP-positive cardiomyocytes. Green fluorescent cells are positive for sarcomeric proteins: A) MHC, B) {alpha}-actinin, C) f-actin, and D) troponin I. No staining was observed with an isotype control antibody (data not shown).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We here present a novel approach for the labeling and rapid purification of ventricular-like ES cell-derived cardiomyocytes. With the help of the ventricle-specific CMVenh./MLC-2v promoter driving an EGFP reporter gene, a specific staining of the ventricular-like subpopulation was achieved. The combination of Percoll purification and FACS sorting allowed a fast and reproducible enrichment of the EGFP-positive cell population containing as many as 5 x 104 ES cell-derived ventricular-like cardiomyocytes starting from 106 undifferentiated stem cells.

The 2.1 kb MLC-2v promoter was chosen because MLC-2v mRNA is specifically found during heart tube formation at day 8 p.c. (32) . Within the adult mammalian heart, it is later expressed almost exclusively in the ventricles (23) . Similarly, in the EB cell system, MLC-2v mRNA was detected with the onset of spontaneous contractility (33) . In contrast to the strong activity of the MLC-2v promoter in transgenic mice (23) and in the adenoviral system (34) , transfected EBs revealed poor expression levels of the MLC-2v-driven EGFP-marker gene. This has also been observed by other groups (personal communications). We therefore included the CMV enhancer element (25) , which in transgenic animal experiments was able to increase MLC-2v expression levels without significantly altering its tissue specificity (publication in preparation).

To our knowledge this is the first time that the specific labeling, purification, and characterization of in vitro differentiated ventricular-like cardiomyocytes are shown. In similar experiments Klug et al. (3) and, more recently, Kolossov et al. (21) achieved selection and characterization of EB derived cardiomyocytes. The usage of these cardiomyocytes for cell transplantation into the heart is limited by the fact that the respective promoters, {alpha}-MHC (3) and {alpha}-actin (21) do not possess specificity distinguishing between different types of cardiomyocytes. Using FACS analysis, 1.5% of the total in vitro differentiated cell population and ~91% of EGFP-fluorescent cells show myogenic {alpha}-actinin. Since there is no evidence for the presence of skeletal muscle cells in our EB preparations (0.06% skeletal myosin-positive cells), we conclude that all {alpha}-actinin-positive cells are of a cardiac phenotype, between 25 to 30% of those comprising an EGFP-positive staining pattern. This proportion fits well with earlier observations showing that ~25% of cardiomyocytes in the EB environment show ventricular-like characteristics (7) . It is worth mentioning that EGFP-positive cells are not distributed equally in between different beating areas but concentrate on some areas (up to 90%), whereas other contracting populations are almost devoid of any EGFP activity. During all experiments, we had no indication of a toxic effect of the EGFP expression. Cultivation for more than 100 days did not reduce the number of EGFP-positive cells in the EB. Electrophysiological measurements suggest that the EGFP-positive cardiomyocyte fraction within the EB contained 82% ventricular-like, 12% atrial-like, and 6% early cardiomyocytes at developmental day 6 + 15. Using FACS analysis, virtually no atrial EGFP-positive cardiomyocytes could be detected (0.01%). The discrepancy revealed between the proportions of EGFP-positive atrial-like cardiomyocytes estimated by electrophysiology, immunohistochemistry, and FACS may be due to dedifferentiation processes resulting from the different handling of the analyzed cardiomyocytes. For FACS analysis, the cells were processed immediately after treatment of the EBs with collagenase. In contrast, for immunohistochemistry with single cells (Fig. 5C , D , E , F ) or for electrophysiological measurements, as well as for selection procedures using antibiotics (3) , the cells were plated again on culture dishes for an extended period of time. During this period of time the gene expression pattern alters and the morphology of the cardiomyocytes changed from a spindle-shaped, triangular to a flat polymorphic-shaped form with multiple pseudopodia-like processes. This observation is a first indication of a starting dedifferentiation process, an observation commonly seen in primary cultures of cardiomyocytes (36 , 37) . Dedifferentiation does not take place in EGFP-positive cardiomyocytes as long as they are kept in their natural environment of the growing 3-dimensional EB. Moreover, it might be speculated that the few electrophysiologically atrial-like, EGFP-positive cells finally represented not yet terminally differentiated ventricular-like cells that transiently show an atrial phenotype.

Our EGFP-based approach for the isolation of cardiomyocytes applying Percoll gradient centrifugation and fluorescence activated cell sorting resulted in 5 x 104 green fluorescent contracting cells starting off with 1 x 108 differentiated ES cells, 2 x 105 green fluorescent cardiomyocytes, respectively. Therefore, at least in our hands, the EGFP-based method turned out to be less labor-intensive and more efficient than the selection procedure described by Klug et al. (3) using {alpha}MHC-Neo containing ES cells. Because of the close contact between Neo-resistant cardiomyocytes and Neo-sensitive noncardiomyogenic cells, a high number of Neo expressing cells gets lost with medium changes and therefore clumps of detached cells had to be collected and plated again (M. Müller, data not shown), a procedure that is inefficient and time consuming.

The cellular transplantation of fetal, neonatal and adult cardiomyocytes, skeletal muscle cells, satellite cells, and cardiac tumor cells into the myocardium of various species such as mouse, rat, and dog is well established (38 , 39) . Klug et al. has shown that ES cell derived cardiomyocytes can generate cardiac grafts when transplanted into dystrophic recipient mice (3) . With our EGFP-based purification method, we get enough pure cardiomyocytes to perform transplantations into the murine heart (>= 1x104). To achieve cellular transplantation in larger animals and humans, a higher number of cardiomyocytes will be required (>= 106 cells) (40) . Indeed, we have recently shown that treatment of EBs with retinoic acid is advantageous (16) . Another possibility to increase the quantity of differentiating cardiomyocytes might be the overexpression of GATA transcription factors in ES cells, which has been shown to lead to a fourfold increase in cardiomyocyte differentiation (41) .

The availability of human ES/EG cells (17 18 19) and the possibility of differentiating cardiomyocytes from human ES cells (19) , bone marrow stromal cells (42) , as well as the newly described nuclear transfer technology (43) offer an enormous potential for cell mediated gene therapy. However, most of these in vitro differentiation methods give rise to more than 200 different types of cells, and therefore the strength of these discoveries can only be used if a distinct cellular subset can be isolated. The availability of purified human cardiomyocytes will allow the discovery of new growth factors, the evaluation of drugs, and toxicologic in vitro studies. Our study describes the potential to label and rapidly purify specifically ventricle-like cardiomyocytes, which in the near future may open new avenues in the treatment of congestive heart failure.


   ACKNOWLEDGMENTS
 
This work was funded by BMBF grant 01KV9560. M.M. was supported by a Swiss National Science Foundation grant. We are grateful to Tanja Ubben for her excellent technical assistance. We thank Dr. Michel LeHir for his assistance in immunhistologie. We are further grateful to Dr. F. Boess for carefully reading the manuscript.

Received for publication January 3, 2000. Revision received May 26, 2000.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Anversa, P., Fitzpatrick, D., Argani, S., Capasso, J. M. (1991) Myocyte mitotic division in the aging mammalian rat heart. Circ. Res. 69,1159-1164[Abstract/Free Full Text]
  2. Taylor, D. A., Atkins, B. Z., Hungspreugs, P., Jones, T. R., Reedy, M. C., Hutcheson, K. A., Glower, D. D., Kraus, W. E. (1998) Regenerating functional myocardium: Improved performance after skeletal myoblast transplantation. Nature Med. 4,929-933[Medline]
  3. Klug, M. G., Soonpaa, M. H., Koh, G. Y., Field, L. J. (1996) Genetically selected cardiomyocytes from differentiating embryonic stem cells form stable intracardiac grafts. J. Clin. Invest. 98,216-224[Medline]
  4. Leor, J., Patterson, M., Quinones, M. J., Kedes, L. H., Kloner, R. A. (1996) Transplantation of fetal myocardial tissue into the infarcted myocardium of rat. A potential method for repair of infarcted myocardium?. Circulation 94,II332-II336
  5. Li, R. K., Mickle, D. A., Weisel, R. D., Mohabeer, M. K., Zhang, J., Rao, V., Li, G., Merante, F., Jia, Z. Q. (1997) Natural history of fetal rat cardiomyocytes transplanted into adult rat myocardial scar tissue. Circulation 96,II179-II1786
  6. Soonpaa, M. H., Koh, G. Y., Klug, M. G., Field, L. J. (1994) Formation of nascent intercalated disks between grafted fetal cardiomyocytes and host myocardium. Science 264,98-101[Abstract/Free Full Text]
  7. Sen, A., Dunnmon, P., Henderson, S. A., Gerard, R. D., Chien, K. R. (1988) Terminally differentiated neonatal rat myocardial cells proliferate and maintain specific differentiated functions following expression of SV40 large T antigen. J. Biol. Chem. 263,19132-19136[Abstract/Free Full Text]
  8. Delcarpio, J. B., Lanson, N. A., Jr, Field, L. J., Claycomb, W. C. (1991) Morphological characterization of cardiomyocytes isolated from a transplantable cardiac tumor derived from transgenic mouse atria (AT-1 cells). Circ. Res. 69,1591-1600[Abstract/Free Full Text]
  9. Katz, E. B., Steinhelper, M. E., Delcarpio, J. B., Daud, A. I., Claycomb, W. C., Field, L. J. (1992) Cardiomyocyte proliferation in mice expressing alpha-cardiac myosin heavy chain-SV40 T-antigen transgenes. Am. J. Physiol. 262,H1867-H1876[Abstract/Free Full Text]
  10. Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W., Kemler, R. (1985) The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol. 87,27-45[Medline]
  11. Wobus, A. M., Wallukat, G., Hescheler, J. (1991) Pluripotent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca2+ channel blockers. Differentiation 48,173-182[Medline]
  12. Rohwedel, J., Maltsev, V., Bober, E., Arnold, H. H., Hescheler, J., Wobus, A. M. (1994) Muscle cell differentiation of embryonic stem cells reflects myogenesis in vivo: developmentally regulated expression of myogenic determination genes and functional expression of ionic currents. Dev. Biol. 164,87-101[Medline]
  13. Drab, M., Haller, H., Bychkov, R., Erdmann, B., Lindschau, C., Haase, H., Morano, I., Luft, F. C., Wobus, A. M. (1997) From totipotent embryonic stem cells to spontaneously contracting smooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model. FASEB J. 11,905-915[Abstract]
  14. Strubing, C., Ahnert-Hilger, G., Shan, J., Wiedenmann, B., Hescheler, J., Wobus, A. M. (1995) Differentiation of pluripotent embryonic stem cells into the neuronal lineage in vitro gives rise to mature inhibitory and excitatory neurons. Mech. Dev. 53,275-287[Medline]
  15. Wartenberg, M., Gunther, J., Hescheler, J., Sauer, H. (1998) The embryoid body as a novel in vitro assay system for antiangiogenic agents. Lab. Invest. 78,1301-1314[Medline]
  16. Wobus, A. M., Kaomei, G., Shan, J., Wellner, M. C., Rohwedel, J., Ji, G., Fleischmann, B., Katus, H. A., Hescheler, J., Franz, W. M. (1997) Retinoic acid accelerates embryonic stem cell-derived cardiac differentiation and enhances development of ventricular cardiomyocytes. J Mol Cell Cardiol 29,1525-1539[Medline]
  17. Shamblott, M. J., Axelman, J., Wang, S., Bugg, E. M., Littlefield, J. W., Donovan, P. J., Blumenthal, P. D., Huggins, G. R., Gearhart, J. D. (1998) Derivation of pluripotent stem cells from cultured human primordial germ cells. Proc. Natl. Acad. Sci. USA. 95,13726-13731[Abstract/Free Full Text]
  18. Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., Jones, J. M. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282,1145-1147[Abstract/Free Full Text]
  19. Reubinoff, B. E., Pera, M. F., Fong, C.-Y., Trounson, A., Bongso, A. (2000) Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nature (London) Biotech. 18,399-404
  20. Metzger, J. M., Lin, W. I., Samuelson, L. C. (1994) Transition in cardiac contractile sensitivity to calcium during the in vitro differentiation of mouse embryonic stem cells. J. Cell Biol. 126,701-711[Abstract/Free Full Text]
  21. Kolossov, E., Fleischmann, B. K., Liu, Q., Bloch, W., Viatchenko-Karpinski, S., Manzke, O., Ji, G. J., Bohlen, H., Addicks, K., Hescheler, J. (1998) Functional characteristics of ES cell-derived cardiac precursor cells identified by tissue-specific expression of the green fluorescent protein. J. Cell Biol. 143,2045-2056[Abstract/Free Full Text]
  22. Lee, K. J., Ross, R. S., Rockman, H. A., Harris, A. N., O’Brien, T. X., van Bilsen, M., Shubeita, H. E., Kandolf, R., Brem, G., Price, J., et al (1992) Myosin light chain-2 luciferase transgenic mice reveal distinct regulatory programs for cardiac and skeletal muscle-specific expression of a single contractile protein gene. J. Biol. Chem. 267,15875-15885[Abstract/Free Full Text]
  23. Franz, W. M., Breves, D., Klingel, K., Brem, G., Hofschneider, P. H., Kandolf, R. (1993) Heart-specific targeting of firefly luciferase by the myosin light chain-2 promoter and developmental regulation in transgenic mice. Circ. Res. 73,629-638[Abstract/Free Full Text]
  24. Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein, B., Schaffner, W. (1985) A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41,521-530[Medline]
  25. Heuchel, R., Radtke, F., Georgiev, O., Stark, G., Aguet, M., Schaffner, W. (1994) The transcription factor MTF-1 is essential for basal and heavy metal induced metallothionein gene expression. EMBO J 13,2870-2875[Medline]
  26. Dan-Goor, M., Silberstein, L., Kessel, M., Muhlrad, A. (1990) Localization of epitopes and functional effects of two novel monoclonal antibodies against skeletal muscle myosin. J. Muscle Res. Cell Motil. 11,216-226[Medline]
  27. Bouvagnet, P., Leger, J., Pons, F., Dechesne, C., Leger, J. J. (1984) Fiber types and myosin types in human atrial and ventricular myocardium. An anatomical description. Circ. Res. 55,794-804[Abstract/Free Full Text]
  28. Zehelein, J., Remppis, A., Scheffold, T., Schröder, A., Grünig, E., Katus, H. A. (1993) Enzyme immunoassay für kardiales troponin I. Z. Kardiol. 82,155
  29. Maltsev, V. A., Wobus, A. M., Rohwedel, J., Bader, M., Hescheler, J. (1994) Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ. Res. 75,233-244[Abstract/Free Full Text]
  30. Hamill, O. P., Sakmann, B. (1981) Multiple conductance states of single acetylcholine receptor channels in embryonic muscle cells. Nature (London) 294,462-464[Medline]
  31. Maltsev, V. A., Ji, G. J., Wobus, A. M., Fleischmann, B. K., Hescheler, J. (1999) Establishment of beta-adrenergic modulation of L-type Ca2+ current in the early stages of cardiomyocyte development. Circ. Res. 84,136-145[Abstract/Free Full Text]
  32. O’Brien, T. X., Lee, K. J., Chien, K. R. (1993) Positional specification of ventricular myosin light chain 2 expression in the primitive murine heart tube. Proc. Natl. Acad. Sci. USA 90,5157-5161[Abstract/Free Full Text]
  33. Miller-Hance, W. C., LaCorbiere, M., Fuller, S. J., Evans, S. M., Lyons, G., Schmidt, C., Robbins, J., Chien, K. R. (1993) In vitro chamber specification during embryonic stem cell cardiogenesis. Expression of the ventricular myosin light chain-2 gene is independent of heart tube formation. J. Biol. Chem. 268,25244-25252[Abstract/Free Full Text]
  34. Rothmann, T., Katus, H. A., Hartong, R., Perricaudet, M., Franz, W. M. (1996) Heart muscle-specific gene expression using replication defective recombinant adenovirus. Gene Ther. 3,919-926[Medline]
  35. Ji, G. J., Fleischmann, B. K., Bloch, W., Feelisch, M., Andressen, C., Addicks, K., Hescheler, J. (1999) Regulation of the L-type Ca2+ channel during cardiomyogenesis: switch from NO to adenylyl cyclase-mediated inhibition. FASEB J 13,313-324[Abstract/Free Full Text]
  36. Bugaisky, L. B., Zak, R. (1989) Differentiation of adult rat cardiac myocytes in cell culture. Circ. Res. 64,493-500[Abstract/Free Full Text]
  37. Li, R. K., Mickle, D. A., Weisel, R. D., Carson, S., Omar, S. A., Tumiati, L. C., Wilson, G. J., Williams, W. G. (1996) Human pediatric and adult ventricular cardiomyocytes in culture: assessment of phenotypic changes with passaging. Cardiovasc. Res. 32,362-373[Abstract/Free Full Text]
  38. Koh, G. Y., Soonpaa, M. H., Klug, M. G., Pride, H. P., Cooper, B. J., Zipes, D. P., Field, L. J. (1995) Stable fetal cardiomyocyte grafts in the hearts of dystrophic mice and dogs. J. Clin. Invest. 96,2034-2042
  39. Schwarz, E. R., Patterson, M., Kloner, R. A. (1998) Cardiomyocyte transplantation—a cell replacement for repair of myocardial infarction?. Z. Kardiol. 87,1-7
  40. Watanabe, E., Smith, D. M., Jr., Delcarpio, J. B., Sun, J., Smart, F. W., Van Meter, C. H., Jr., Claycomb, W. C. (1998) Cardiomyocyte transplantation in a porcine myocardial infarction model. Cell Transpl. 7,239-246[Medline]
  41. Grepin, C., Nemer, G., Nemer, M. (1997) Enhanced cardiogenesis in embryonic stem cells overexpressing the GATA-4 transcription factor. Development 124,2387-2395[Abstract]
  42. Makino, S., Kukuda, K., Miyoshi, S., Konishi, F., Kodama, H., Pan, J., Sano, M., Takahashi, T., Hori, S., Abe, H., Hata, J., Umezawa, A., Ogawa, S. (1999) Cardiomyocytes can be generated from marrow stromal cells in vitro. J. Clin. Invest. 103,697-705[Medline]
  43. Wilmut, I., Schnieke, A. E., McWhir, J., Kind, A. J., Campbell, K. H. (1997) Viable offspring derived from fetal and adult mammalian cells. Nature (London) 385,810-813[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
J. D. Adams, U. Kim, and H. T. Soh
Multitarget magnetic activated cell sorter
PNAS, November 25, 2008; 105(47): 18165 - 18170.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
N. Gassanov, D. Devost, B. Danalache, N. Noiseux, M. Jankowski, H. H. Zingg, and J. Gutkowska
Functional Activity of the Carboxyl-Terminally Extended Oxytocin Precursor Peptide During Cardiac Differentiation of Embryonic Stem Cells
Stem Cells, January 1, 2008; 26(1): 45 - 54.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
P. Batten, N. A Rosenthal, and M. H Yacoub
Immune response to stem cells and strategies to induce tolerance
Phil Trans R Soc B, August 29, 2007; 362(1484): 1343 - 1356.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
I. Huber, I. Itzhaki, O. Caspi, G. Arbel, M. Tzukerman, A. Gepstein, M. Habib, L. Yankelson, I. Kehat, and L. Gepstein
Identification and selection of cardiomyocytes during human embryonic stem cell differentiation
FASEB J, August 1, 2007; 21(10): 2551 - 2563.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Gassanov, M. Jankowski, B. Danalache, D. Wang, R. Grygorczyk, U. C. Hoppe, and J. Gutkowska
Arginine Vasopressin-mediated Cardiac Differentiation: INSIGHTS INTO THE ROLE OF ITS RECEPTORS AND NITRIC OXIDE SIGNALING
J. Biol. Chem., April 13, 2007; 282(15): 11255 - 11265.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Wang, D. L. Haviland, A. R. Burns, E. Zsigmond, and R. A. Wetsel
A pure population of lung alveolar epithelial type II cells derived from human embryonic stem cells
PNAS, March 13, 2007; 104(11): 4449 - 4454.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Buggisch, B. Ateghang, C. Ruhe, C. Strobel, S. Lange, M. Wartenberg, and H. Sauer
Stimulation of ES-cell-derived cardiomyogenesis and neonatal cardiac cell proliferation by reactive oxygen species and NADPH oxidase
J. Cell Sci., March 1, 2007; 120(5): 885 - 894.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. W. van Laake, R. Hassink, P. A. Doevendans, and C. Mummery
Heart repair and stem cells
J. Physiol., December 1, 2006; 577(2): 467 - 478.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
O. Caspi and L. Gepstein
Stem cells for myocardial repair
Eur. Heart J. Suppl., September 1, 2006; 8(suppl_E): E43 - E54.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Schwanke, S. Wunderlich, M. Reppel, M. E. Winkler, M. Matzkies, S. Groos, J. Itskovitz-Eldor, A. R. Simon, J. Hescheler, A. Haverich, et al.
Generation and Characterization of Functional Cardiomyocytes from Rhesus Monkey Embryonic Stem Cells
Stem Cells, June 1, 2006; 24(6): 1423 - 1432.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
O. J. Muller, B. Leuchs, S. T. Pleger, D. Grimm, W.-M. Franz, H. A. Katus, and J. A. Kleinschmidt
Improved cardiac gene transfer by transcriptional and transductional targeting of adeno-associated viral vectors
Cardiovasc Res, April 1, 2006; 70(1): 70 - 78.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Kouskoff, G. Lacaud, S. Schwantz, H. J. Fehling, and G. Keller
Sequential development of hematopoietic and cardiac mesoderm during embryonic stem cell differentiation
PNAS, September 13, 2005; 102(37): 13170 - 13175.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
J. C. Brodie and H. D. Humes
Stem Cell Approaches for the Treatment of Renal Failure
Pharmacol. Rev., September 1, 2005; 57(3): 299 - 313.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Keller
Embryonic stem cell differentiation: emergence of a new era in biology and medicine
Genes & Dev., May 15, 2005; 19(10): 1129 - 1155.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Koyanagi, J. Haendeler, C. Badorff, R. P. Brandes, J. Hoffmann, P. Pandur, A. M. Zeiher, M. Kuhl, and S. Dimmeler
Non-canonical Wnt Signaling Enhances Differentiation of Human Circulating Progenitor Cells to Cardiomyogenic Cells
J. Biol. Chem., April 29, 2005; 280(17): 16838 - 16842.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. M. Wobus and K. R. Boheler
Embryonic Stem Cells: Prospects for Developmental Biology and Cell Therapy
Physiol Rev, April 1, 2005; 85(2): 635 - 678.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
R. David, M. Groebner, and W.-M. Franz
Magnetic Cell Sorting Purification of Differentiated Embryonic Stem Cells Stably Expressing Truncated Human CD4 as Surface Marker
Stem Cells, April 1, 2005; 23(4): 477 - 482.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Hattan, H. Kawaguchi, K. Ando, E. Kuwabara, J. Fujita, M. Murata, M. Suematsu, H. Mori, and K. Fukuda
Purified cardiomyocytes from bone marrow mesenchymal stem cells produce stable intracardiac grafts in mice
Cardiovasc Res, February 1, 2005; 65(2): 334 - 344.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
T. Xue, H. C. Cho, F. G. Akar, S.-Y. Tsang, S. P. Jones, E. Marban, G. F. Tomaselli, and R. A. Li
Functional Integration of Electrically Active Cardiac Derivatives From Genetically Engineered Human Embryonic Stem Cells With Quiescent Recipient Ventricular Cardiomyocytes: Insights Into the Development of Cell-Based Pacemakers
Circulation, January 4, 2005; 111(1): 11 - 20.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. C. Davila, G. G. Cezar, M. Thiede, S. Strom, T. Miki, and J. Trosko
Use and Application of Stem Cells in Toxicology
Toxicol. Sci., June 1, 2004; 79(2): 214 - 223.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Magnusson, C. Rolny, L. Jakobsson, C. Wikner, Y. Wu, D. J. Hicklin, and L. Claesson-Welsh
Deregulation of Flk-1/vascular endothelial growth factor receptor-2 in fibroblast growth factor receptor-1-deficient vascular stem cell development
J. Cell Sci., March 15, 2004; 117(8): 1513 - 1523.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. M. White, P. E. Constantin, and W. C. Claycomb
Cardiac physiology at the cellular level: use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure and function
Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H823 - H829.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
O. J. Muller, M. Lange, H. Rattunde, H.-P. Lorenzen, M. Muller, N. Frey, C. Bittner, W. Simonides, H. A. Katus, and W.-M. Franz
Transgenic rat hearts overexpressing SERCA2a show improved contractility under baseline conditions and pressure overload
Cardiovasc Res, August 1, 2003; 59(2): 380 - 389.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J.-Q. He, Y. Ma, Y. Lee, J. A. Thomson, and T. J. Kamp
Human Embryonic Stem Cells Develop Into Multiple Types of Cardiac Myocytes: Action Potential Characterization
Circ. Res., July 11, 2003; 93(1): 32 - 39.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Sachinidis, B. K. Fleischmann, E. Kolossov, M. Wartenberg, H. Sauer, and J. Hescheler
Cardiac specific differentiation of mouse embryonic stem cells
Cardiovasc Res, May 1, 2003; 58(2): 278 - 291.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. G. Nir, R. David, M. Zaruba, W.-M. Franz, and J. Itskovitz-Eldor
Human embryonic stem cells for cardiovascular repair
Cardiovasc Res, May 1, 2003; 58(2): 313 - 323.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
J. D. Dowell, M. Rubart, K. B.S. Pasumarthi, M. H. Soonpaa, and L. J. Field
Myocyte and myogenic stem cell transplantation in the heart
Cardiovasc Res, May 1, 2003; 58(2): 336 - 350.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Reffelmann and R. A. Kloner
Cellular cardiomyoplasty--cardiomyocytes, skeletal myoblasts, or stem cells for regenerating myocardium and treatment of heart failure?
Cardiovasc Res, May 1, 2003; 58(2): 358 - 368.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. J. Goldenthal and J. Marin-Garcia
Stem cells and cardiac disorders: an appraisal
Cardiovasc Res, May 1, 2003; 58(2): 369 - 377.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Johkura, L. Cui, A. Suzuki, R. Teng, A. Kamiyoshi, S. Okamura, S. Kubota, X. Zhao, K. Asanuma, Y. Okouchi, et al.
Survival and function of mouse embryonic stem cell-derived cardiomyocytes in ectopic transplants
Cardiovasc Res, May 1, 2003; 58(2): 435 - 443.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. I. Rybkin, D. W. Markham, Z. Yan, R. Bassel-Duby, R. S. Williams, and E. N. Olson
Conditional Expression of SV40 T-antigen in Mouse Cardiomyocytes Facilitates an Inducible Switch from Proliferation to Differentiation
J. Biol. Chem., April 25, 2003; 278(18): 15927 - 15934.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
Q. He, J. Li, E. Bettiol, and M. E. Jaconi
Embryonic Stem Cells: New Possible Therapy for Degenerative Diseases That Affect Elderly People
J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2003; 58(3): M279 - 287.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Badorff, R. P. Brandes, R. Popp, S. Rupp, C. Urbich, A. Aicher, I. Fleming, R. Busse, A. M. Zeiher, and S. Dimmeler
Transdifferentiation of Blood-Derived Human Adult Endothelial Progenitor Cells Into Functionally Active Cardiomyocytes
Circulation, February 25, 2003; 107(7): 1024 - 1032.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Gepstein
Derivation and Potential Applications of Human Embryonic Stem Cells
Circ. Res., November 15, 2002; 91(10): 866 - 876.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. M. Zhang, C. Hartzell, M. Narlow, and S. C. Dudley Jr
Stem Cell-Derived Cardiomyocytes Demonstrate Arrhythmic Potential
Circulation, September 3, 2002; 106(10): 1294 - 1299.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
K. R. Boheler, J. Czyz, D. Tweedie, H.-T. Yang, S. V. Anisimov, and A. M. Wobus
Differentiation of Pluripotent Embryonic Stem Cells Into Cardiomyocytes
Circ. Res., August 9, 2002; 91(3): 189 - 201.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MÜLLER, M.
Right arrow Articles by FRANZ, W. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MÜLLER, M.
Right arrow Articles by FRANZ, W. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS