| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Internal Medicine II, University of Lübeck, D-23538 Lübeck;
* Institute of Neurophysiology, University of Cologne, D-50931 Cologne;
Division of Molecular Immunology, Research Center Borstel, D-23845 Borstel;
Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben; and
§ Department of Immunology, University of Lübeck, D-23538 Lübeck, Germany
1Correspondence: Medizinische Klinik II, Medizinische Universität zu Lübeck, Ratzeburger Allee 160, D-23538 Lübeck, Germany. E-mail: franz{at}medinf.mu-luebeck.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: embryoid body • cardiac • green fluorescent protein • in vitro differentiation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. This is particularly limiting for a variety of heart
disorders such as ischemic and dilated cardiomyopathies, where
progressive heart failure can ultimately be treated only by
transplantation. Due to the limited availability of organs, an
alternative approach has been the isolation and implantation of
different types of myocytes (2)
and cardiomyocytes into
the diseased myocardium of rodents (3
4
5
6)
. These studies
demonstrated that transplanted cells could engraft and even form
functional gap junctions with the host myocardium. In addition,
revascularization as well as recovery from defective left ventricular
function has been observed (5)
. The lack of human cardiac
cell lines, however, poses a serious limitation of this approach.
Efforts to generate myocardial cell lines have focused largely on the
targeted expression of oncogenes, either in cultured cardiomyocytes
(7)
or in the myocardium of transgenic animals (8
, 9)
. However, no established lines exhibiting the typical
morphological and functional features of adult cardiomyocytes in
particular after repeated passages have been reported. The
establishment of a cardiac-specific cell line, i.e., of
ventricular-like cardiomyocytes, would be a major step toward a
cell-mediated replacement therapy.
Our and other groups have recently shown that cardiomyocytes
derived from embryonic stem (ES) cells are a valid source for the
generation of cardiomyocytes of different developmental stages.
Pluripotent murine ES cells, derived from the inner cell mass of
blastocysts (10)
and adapted to permanent cell culture,
can be induced to differentiate in vitro into a variety of
cell lineages, i.e., cardiomyocytes (10
, 11)
skeletal
(12)
and smooth muscle (13)
, neurons
(14)
, and endothelial cells (15)
. In the case
of the ES cell-derived cardiomyogenesis it has been unequivocally shown
that at the terminally differentiated stage, all different cardiac
phenotypes—sinus nodal-, pacemaker-, atrial-, and ventricular-like
cells—can be detected (16)
. In contrast to other primary
or transgenic cardiac cell lines the ES cell system may provide a valid
source for the generation of human cardiomyocytes, particularly after
the recent establishment of human ES/EG cell lines (17
, 18)
as well as their differentiation (19)
. However,
the availability of ES cell-derived ventricular-like cardiomyocytes is
limited by the fact that 1) only 
5% of all cells within
EBs are cardiomyocytes, 2) all the different cardiac
phenotypes are present, and 3) the isolation of these
cardiomyocytes has been impossible so far (20)
. To improve
the selection of cardiomyocytes within EBs, an 
-cardiac myosin heavy
chain (MHC) promoter driving a neomycin selection gene was established
(3)
. After differentiation and selection using G418,
exclusively cardiomyocytes survived. Because the -MHC promoter is
active in the entire adult heart, including atrial and pacemaker cells,
all the different cardiac phenotypes are positively selected.
Similarly, EGFP labeling of ES cell-derived cardiomyocytes driven by
the human cardiac -actin promoter stained all different phenotypes
of cardiomyocytes (21)
. In contrast, the myosin light
chain-2v (MLC-2v) promoter is characterized by its ventricle specific
expression (22)
. Previously, we have shown that transgenic
mice, in which the 2.1 kb MLC-2v promoter drives the luciferase
reporter gene, display ventricle-restricted expression
(23)
and that this promoter driving the ß-galactosidase
reporter gene specifically stained ventricular cardiomyocytes in EBs
(16)
.
The aim of the present study was to establish ES cell lines from which ventricular-like cardiomyocytes could be identified, facilitating an easy and efficient isolation procedure. For this purpose transgenic ES cell lines were generated expressing the enhanced version of the green fluorescent protein (EGFP) under the transcriptional control of the CMVenh./MLC-2v promoter. We demonstrate here that ventricle-specific expression occurs within several transgenic ES cell lines during early development. These EGFP-positive cells displayed morphological, histological, immunocytochemical, as well as electrophysiological features characteristic of ventricular-like cardiomyocytes. We further show reproducibly that large amounts of cardiomyocytes can be sorted using fluorescence-activated cell sorting (FACS).
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
was subcloned in the pIC20H cloning vector. After
subcloning of the MLC-2v promoter into pBluescript SK+
(SalI-EcoRI) (Stratagene, San Diego,
Calif.), it was introduced in pEGFP-1 (Clontech, Palo Alto, Calif.) by
EcoRI-XhoI digestion, resulting in the construct
pMLC-EGFP. To enhance the MLC-2v promoter, the -590/91 bp fragment of
the human cytomegalovirus immediate-early enhancer
(CMVenh.) (24)
was generated by
polymerase chain reaction (template: CMV-EGFP vector (Clontech),
primers: forward FCMV:
CTATGCGGCCGCCGCTTCGAGCTCGCCCGACATTGATTATTGACTAGT and
reverse RCMV: CTATGCGGCCGCATGGGGCGGAGTTGTTACGACATTTTGGAAAGT) and
inserted in pBLSK using NotI. After
SacII-BamHI digestion,
CMVenh. was subcloned clockwise into the same
sites of pEGFP resulting in pCMVenh.-EGFP.
The MLC-2v cassette was isolated from pMLC-EGFP by
XbaI (blunt ended) -XhoI digestion and introduced
in pCMVenh.-EGFP BamHI (blunt ended)
-XhoI. This vector was called
pCMVenh./MLC-EGFP (Fig. 1
); 10 µg BglII linearized vector was used for
electroporation (240V/500 µF) of 2.5 x
107 ES cells.
|
Cell culture
The mouse embryonic stem cell line (GS-ES) (25)
was
provided by Dr. M. Aguet (ISREC, Lausanne, Switzerland). GS-ES cells
are derived from the mouse strain Agouti 129/SV and were germline
competent. In comparison to previously used D3 cells, they have a
higher capacity to spontaneously differentiate to contracting
cardiomyocytes. Transgenic ES cells were propagated in high glucose
Dulbecco’s modified Eagle medium supplemented with 10%
heat-inactivated ES qualified fetal calf serum, 2 mM L-glutamine, 50
U/ml penicillin, 50 µg/ml streptomycin, 1x nonessential amino acids,
0.4 mg/ml GENETICIN (G418) (all reagents GIBCO BRL, Germany), and 0.1
mM ß-mercaptoethanol (Sigma, Germany). They were kept
undifferentiated on confluent feeder layers of mitomycin C-treated
primary culture of murine embryonic fibroblasts and by addition of 1000
units/ml purified recombinant mouse leukemia inhibitory factor (ESGRO;
Life Technologies, Inc., Grand Island, N.Y.). Cells were maintained at
37°C in a humidified atmosphere of 5% CO2/95%
air. Monolayers were passaged by trypsinization at confluence of
70–80%.
In vitro differentiation was initiated essentially as
described by Klug et al. (3)
. Briefly, ES cells were
harvested with 0.25% trypsin-EDTA and dissociated cells were
transferred to bacteriological dishes at a density of 2 x
105 ES cells/ml in ISCOVE’s modified Eagle
medium (Sigma) supplemented with 10% heat inactivated fetal calf
serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin,
1x nonessential amino acids (all reagents Life Technologies, Inc.),
and 450 µM -monothioglycerol (Sigma). After 3 days, EBs were
transferred to new medium. At day 6, EBs with a similar size were
plated onto gelatin-coated tissue culture dishes. The growth medium for
the attached differentiation cultures was changed every other day.
For further characterization and purification of in vitro
differentiated cardiomyocytes, the cells were processed according to a
protocol for the isolation of primary rat neonatal cardiomyocytes
(7)
. Briefly, EBs were washed with phosphate-buffered
saline (PBS) and digested by collagenase II (Worthington, N.J.) and
pancreatin (Life Technologies, Inc.) in HEPES at pH 7.35 and 37°C for
2–4 h. Digestion was monitored microscopically.
Antibodies and immunofluorescence labeling
Embryoid body (EB) outgrowths (day 6+25) or single cells
prepared from day 6 + 25 EBs and grown for another 2 days on
gelatinized 12 mm glass coverslips (200,000 cells/ml) were rinsed with
PBS fixed for 20 min at room temperature with 3.7% formaldehyde and
neutralized with 50 mM glycine. The cells were permeabilized using
0.4% Triton X-100 in PBS and incubated with the primary antibody in a
humidified chamber at 37°C for 2 h. After washing with 0.4%
Triton X-100 and PBS, secondary Cy3-conjugated antibody was added and
the specimen were incubated for 2 h at 37°C. Finally, the cells
were washed and mounted with Mowiol 4–88 (Calbiochem, Germany).
Monoclonal antibodies against skeletal and cardiac myosin (A4.1025)
(26)
; atrial MHC (F88.12F8) (27)
were
obtained from Alexis Corp. (Grünberg, Germany). TRITC-labeled
phalloidin and the monoclonal antibodies recognizing sarcomeric
-actinin (EA-53) and fast skeletal myosin (My-32) were purchased
from Sigma. Anti-troponin I antibody (4B7) has been described
(28)
.
FACS analysis
EB outgrowths (day 6+25) were digested as mentioned above.
0.5 x 106 cells were washed with PBS and
fixed for 20 min in ice-cold 3.7% paraformaldehyde. The cells were
permeabilized for 10 min using 0.4% Triton X-100 in cold PBS/5%
bovine serum albumin (BSA) and incubated for 1 h with the primary
antibody in a volume of 100 µl PBS/5% BSA at 37°C. After washing
twice with PBS/5% BSA, secondary Cy5-conjugated antibody (Dianova,
Berlin, Germany) was added and the cells were incubated for 1 h at
37°C. Finally, the cells were washed in PBS and analyzed. Flow
cytometric analysis was performed on a dual laser FACS Calibur (Becton
Dickinson, Germany). A 530/30 nm bandpass filter was used to measure
EGFP fluorescence intensity excited with the 488 nm line of an argon
ion laser. CY5 fluorescence was excited separately by the 635 nm
emission line of a laser diode and monitored with a 661/16 nm bandpass
filter. Detector settings were adjusted with untransfected cells that
were fixed, permeabilized, and stained as described above, except that
the primary antibody was replaced by a corresponding isotype control
antibody (MOPC-21, Sigma). Data of 50,000 cells were recorded using the
CellQuest Acquisition software (Becton Dickinson).
Preparation of single cells and electrophysiology
For the patch-clamp experiments, whole EBs or beating areas of
20–30 EBs (day 6+15) were dissected and isolated by enzymatic
dispersion, using collagenase B (Boehringer-Ingelheim, Germany)
(29)
. The solution used for the dissociation of the
dissected areas was (in mmol/l): NaCl 120, KCl 5.4,
MgSO4 5, CaCl2 0.03, Na
pyruvate 5, glucose 20, taurine 20, HEPES 10, collagenase B 0.5–1
mg/ml, pH 6.9 (NaOH). The dissociated material was plated onto
gelatin-coated glass coverslips and put into the incubator in 20% FCS
containing DMEM medium. The glass coverslips containing the cells were
placed into a temperature-controlled (37°C) recording chamber and
perfused continuously with extracellular solution by gravity at a rate
of 1 ml/min. Substances were applied by exchanging the solution in
the chamber; a 90% volume exchange was achieved within 20 s. Patch
pipettes (2–4 M
resistance) were pulled from Clark (Electromedical
Instruments, Reading, U.K.) borosilicate glass using a Zeitz puller
(DMZ, Munich, Germany).
Spontaneously beating EGFP-positive cardiac cells were selected under a
40x objective (Zeiss, Jena, Germany) using a Xenon excitation light
source (Zeiss) and a FITC filter set. For the patch-clamp recordings,
the whole-cell configuration of the patch-clamp technique was applied
(29)
. The cells were measured in the current-clamp mode
using an Axopatch 200-A amplifier (Axon Instruments, Foster City,
Calif.). Data were acquired at a sampling rate of 10 kHz, filtered at 1
kHz, stored on hard disk, and analyzed off-line using the ISO2 analysis
software package (MFK, Frankfurt, Germany). Statistical analysis was
performed using unpaired Student’s t test, and a
P value of < 0.05 was considered significant.
The solutions used for current and voltage clamp recordings had the following composition (in mM): Internal solution: KCl 50, KAspartate 80, MgCl2 1, MgATP 3, EGTA 10, HEPES 10, pH 7.4 (KOH). External solution: NaCl 140, KCl 5.4, CaCl2 3.6, MgCl2 1, HEPES 10, glucose 10 pH 7.4 (NaOH).
Preparation of isolated cardiomyocytes from EBs
1 x 108 collagenase II and
pancreatin-treated EBs were resuspended in ES cell medium and purified
by Percoll gradient centrifugation (7)
. Using a bottom
layer of 1.12 g/ml and a top layer of 1.06 g/ml, the cardiomyocytes
migrated to the interface of both layers during centrifugation at 1300
g for 45 min. After removal of the top layer, cardiomyocytes
were collected and washed twice in PBS. The final cell pellet was
resuspended in ES cell medium. Cell sorting was performed on a
FACStarPLUS cell sorter. EGFP was excited with
the 488 nm line of an argon ion laser and recorded using a 530/30 nm
bandpass filter. Sorting was based on the intensity of forward
scattered light (FSC) and EGFP fluorescence intensity. The sort gate
for EGFP-positive cells was established on the basis of the FSC and
EGFP intensity of untransfected cells. EGFP-positive cells were sorted
directly into culture medium containing tissue flasks for further cell
culture or sorted into glass tubes containing culture medium and
reanalyzed to estimate sort purity. WinMDI Software (Joe Trotter,
Scripps Institute, San Diego, Calif.) was used for data presentation
and statistical evaluation of the defined cell populations.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. 10–20 ES cell clones of each construct were selected,
amplified, and differentiated. In the case of the MLC-2v promoter
construct, three positive clones were identified (clones #6, #10 and
#20), but the number of EGFP-positive cells per beating area at all
developmental stages was low (
20) (Fig. 2
and Table 1
). In contrast, the number of EGFP-positive cells per beating area in
CMVenh./MLC-EGFP-positive EBs was increased (Fig. 2)
. For this construct, nine positive clones were identified with four
clones (#15, #18, #22, and #27) displaying a high number of green
fluorescent cells (>20) within the spontaneously beating areas of EBs
(Table 1)
. The remaining five CMVenh./MLC-EGFP
clones showed similar results as the MLC-EGFP clones. As expected, in
the negative control with the promoterless EGFP construct no green
fluorescent cells were observed despite the high number of beating
areas within these EBs (data not shown).
|
|
Characterization of the in vitro differentiation of
ES cell-derived EGFP-positive clones
At different times, EBs were analyzed for beating and content of
EGFP-positive cells. Three positive
CMVenh./MLC-EGFP clones (#18, #22, and #27), all
showing more than 20 green fluorescent cells per beating area, one
MLC-EGFP clone (#20), and one untransfected control were investigated
by light microscopy (Fig. 3A
). All clones analyzed showed a similar developmental
pattern with first contracting cells in the EB outgrowths reproducibly
appearing at day 6 + 6. At day 6 + 13, 20% of the total EB
outgrowth was beating (Fig. 3A
), whereby 85 ± 5% of
all EBs displayed contracting areas (data not shown). At later time
points the number of beating areas within EBs decreased and at day 6 +
30 almost no beating areas were observed (Fig. 3A
).
|
Analysis by fluorescence microscopy (Fig. 3B
) and flow
cytometry (Fig. 3C
) of differentiating
CMVenh./MLC-EGFP transfected EBs revealed first
EGFP-positive cells 2 days after the onset of spontaneous contractions
(day 6 + 8). Subsequently, the number of EGFP-positive cells increased
up to day 6 + 25 (Fig. 3B
). The maximum of fluorescence
intensity was reached at day 6 + 35 (Fig. 3C
). At later time
points, a slight drop in both the intensity and the number of
EGFP-positive cells was noticed. Among the
CMVenh./MLC-EGFP clones, #27 showed the highest
amount of fluorescent cells and the strongest intensity of
fluorescence, and was therefore chosen for further analysis. The
fluorescence intensity of MLC-EGFP-positive cells (clone #20) and cells
of the untransfected control were below detection level (Fig. 3C
).
Specificity of the EGFP expression in ES cell-derived
cardiomyocytes
The cardiac nature of the EGFP expressing cells within the EB
(clone #27) was proven with antibody staining specific for fast
skeletal myosin (My-32). FACS analysis of enzymatically dispersed
single cells showed that only a small population of EGFP negative
skeletal muscle cells was present in the EB (0.06%) (Fig. 4A
). No fluorescent My-32-positive skeletal myocytes could be
detected. Staining with antibodies against either -actinin (Fig. 4B
) or myosin (data not shown) demonstrated that almost all
EGFP-positive cells (91%) stain positive with either antibody.
However, only 0.4% out of total 1.52% sarcomeric cells were green
fluorescent (27%) (Fig. 4B
). Staining with an antibody
specific for human atrial myocytes resulted in only 0.01% EGFP
double-positive cells (Fig. 4C
). No EGFP staining was
detectable in the IgG control experiment (Fig. 4D
).
|
Similarly, immunohistochemistry with EBs stained for myosin showed that
only a subpopulation of cells within a distinct myofibrillar structure
was positive for EGFP (Fig. 5A
, B
). EBs generated from less than 2 x
105 ES cells favored skeletal muscle
differentiation, which was detected preferentially at the periphery of
the EB with no skeletal myosin staining of EGFP-positive cells (data
not shown). Striations by sarcomeric structures could be detected with
antibodies against -actinin (Fig. 5C
, D
) and troponin I
(data not shown) in EGFP-positive as well as EGFP-negative cells.
Antibody staining for human atrial myosin detected a small population
of EGFP-positive cells (Fig. 5E
, F
).
|
Electrophysiological and pharmacological characterization of
EGFP-positive cardiomyocytes
To examine the electrophysiological properties of ES cell-derived
cardiomyocytes, patch-clamp recordings were performed on spontaneously
contracting isolated cardiomyocytes. EBs of
CMVenh./MLC-EGFP transfected ES cells were
harvested at day 6 + 15.
The ventricular specificity of CMVenh./MLC-EGFP
labeling is summarized in Fig. 6A
. Thirteen of 16 EGFP-positive cells (82%) displayed
typical ventricular-like action potentials (AP) with a negative
membrane potential of -68.6 ± 2.8 mV, an AP duration (APD) of
118.3 ± 15.2 ms, an overshoot of 34.3 ± 3.9 mV, and the
clearly pronounced plateau phase indicating the long lasting
Ca2+ influx through L-type
Ca2+ channels (Fig. 6B
)
(31)
. Furthermore, these 13 cells revealed prolongation of
APD in the presence of the ß-adrenergic agonist isoprenaline (Iso,
0.1 µM), which is known to prolong APD at the late developmental
stage due to stimulation of L-type Ca2+-channels
(31)
. Incubation with the muscarinic agonist carbachol
(CCh, 1 µM), which has a pronounced negative chronotropic effect on
the spontaneous electrical activity in early cells, did not result in
any effect on APD and the membrane potential of EGFP-positive cells as
can be expected for ventricular-like cardiomyocytes (34)
.
12% of EGFP-positive cells (n=2) showed atrial-like
membrane potentials whereas 6% could be classified as early-type
cardiomyocytes (n=1) (Fig. 6A
). In contrast, EGFP
negative cells revealed a strong negative chronotropic response on CCh
application without concomitant hyperpolarization (n=5)
(data not shown). In accordance with earlier studies, no toxicity
associated with the expression of EGFP could be detected
(21)
.
|
Purification of EGFP-positive ventricular-like cardiomyocytes
To achieve a pure fraction of ventricular-like cardiomyocytes, we
performed a dual strategy including Percoll gradient density
centrifugation followed by FACS. EB outgrowths generated from 1 x
106 ES cells were digested at day 6 + 25. 1 x 108 unpurified differentiated cells containing
0.2% green fluorescent particles (2x105)
(Fig. 7A
) were loaded on a Percoll gradient, resulting in a three-
to fivefold enrichment of EGFP-positive cells (Fig. 7B
).
Subsequent FACS yielded in a 97% pure fraction of 5 x
104 EGFP-positive cells (Fig. 7C
).
Adherent cells started to contract again and demonstrated an intact
sarcomeric structure (Fig. 8A
, B
, C
, D
).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The 2.1 kb MLC-2v promoter was chosen because MLC-2v mRNA is
specifically found during heart tube formation at day 8 p.c.
(32)
. Within the adult mammalian heart, it is later
expressed almost exclusively in the ventricles (23)
.
Similarly, in the EB cell system, MLC-2v mRNA was detected with the
onset of spontaneous contractility (33)
. In contrast to
the strong activity of the MLC-2v promoter in transgenic mice
(23)
and in the adenoviral system (34)
,
transfected EBs revealed poor expression levels of the MLC-2v-driven
EGFP-marker gene. This has also been observed by other groups (personal
communications). We therefore included the CMV enhancer element
(25)
, which in transgenic animal experiments was able to
increase MLC-2v expression levels without significantly altering its
tissue specificity (publication in preparation).
To our knowledge this is the first time that the specific labeling,
purification, and characterization of in vitro
differentiated ventricular-like cardiomyocytes are shown. In similar
experiments Klug et al. (3)
and, more recently, Kolossov
et al. (21)
achieved selection and characterization of EB
derived cardiomyocytes. The usage of these cardiomyocytes for cell
transplantation into the heart is limited by the fact that the
respective promoters, -MHC (3)
and -actin
(21)
do not possess specificity distinguishing between
different types of cardiomyocytes. Using FACS analysis, 1.5% of the
total in vitro differentiated cell population and 91% of
EGFP-fluorescent cells show myogenic -actinin. Since there is no
evidence for the presence of skeletal muscle cells in our EB
preparations (0.06% skeletal myosin-positive cells), we conclude that
all -actinin-positive cells are of a cardiac phenotype, between 25
to 30% of those comprising an EGFP-positive staining pattern. This
proportion fits well with earlier observations showing that 25% of
cardiomyocytes in the EB environment show ventricular-like
characteristics (7)
. It is worth mentioning that
EGFP-positive cells are not distributed equally in between different
beating areas but concentrate on some areas (up to 90%), whereas other
contracting populations are almost devoid of any EGFP activity. During
all experiments, we had no indication of a toxic effect of the EGFP
expression. Cultivation for more than 100 days did not reduce the
number of EGFP-positive cells in the EB. Electrophysiological
measurements suggest that the EGFP-positive cardiomyocyte fraction
within the EB contained 82% ventricular-like, 12% atrial-like, and
6% early cardiomyocytes at developmental day 6 + 15. Using FACS
analysis, virtually no atrial EGFP-positive cardiomyocytes could be
detected (0.01%). The discrepancy revealed between the proportions of
EGFP-positive atrial-like cardiomyocytes estimated by
electrophysiology, immunohistochemistry, and FACS may be due to
dedifferentiation processes resulting from the different handling of
the analyzed cardiomyocytes. For FACS analysis, the cells were
processed immediately after treatment of the EBs with collagenase. In
contrast, for immunohistochemistry with single cells (Fig. 5C
, D
, E
, F
) or for electrophysiological measurements, as well as
for selection procedures using antibiotics (3)
, the cells
were plated again on culture dishes for an extended period of time.
During this period of time the gene expression pattern alters and the
morphology of the cardiomyocytes changed from a spindle-shaped,
triangular to a flat polymorphic-shaped form with multiple
pseudopodia-like processes. This observation is a first indication of a
starting dedifferentiation process, an observation commonly seen in
primary cultures of cardiomyocytes (36
, 37)
.
Dedifferentiation does not take place in EGFP-positive cardiomyocytes
as long as they are kept in their natural environment of the growing
3-dimensional EB. Moreover, it might be speculated that the few
electrophysiologically atrial-like, EGFP-positive cells finally
represented not yet terminally differentiated ventricular-like cells
that transiently show an atrial phenotype.
Our EGFP-based approach for the isolation of cardiomyocytes applying
Percoll gradient centrifugation and fluorescence activated cell sorting
resulted in 5 x 104 green fluorescent
contracting cells starting off with 1 x 108
differentiated ES cells, 2 x 105 green
fluorescent cardiomyocytes, respectively. Therefore, at least in our
hands, the EGFP-based method turned out to be less labor-intensive and
more efficient than the selection procedure described by Klug et al.
(3)
using MHC-Neo containing ES cells. Because of the
close contact between Neo-resistant cardiomyocytes and Neo-sensitive
noncardiomyogenic cells, a high number of Neo expressing cells gets
lost with medium changes and therefore clumps of detached cells had to
be collected and plated again (M. Müller, data not shown), a
procedure that is inefficient and time consuming.
The cellular transplantation of fetal, neonatal and adult
cardiomyocytes, skeletal muscle cells, satellite cells, and cardiac
tumor cells into the myocardium of various species such as mouse, rat,
and dog is well established (38
, 39)
. Klug et al. has
shown that ES cell derived cardiomyocytes can generate cardiac grafts
when transplanted into dystrophic recipient mice (3)
. With
our EGFP-based purification method, we get enough pure cardiomyocytes
to perform transplantations into the murine heart (
1x104). To achieve cellular transplantation in
larger animals and humans, a higher number of cardiomyocytes will be
required ( 106 cells) (40)
.
Indeed, we have recently shown that treatment of EBs with retinoic acid
is advantageous (16)
. Another possibility to increase the
quantity of differentiating cardiomyocytes might be the overexpression
of GATA transcription factors in ES cells, which has been shown to lead
to a fourfold increase in cardiomyocyte differentiation
(41)
.
The availability of human ES/EG cells (17
18
19)
and the
possibility of differentiating cardiomyocytes from human ES cells
(19)
, bone marrow stromal cells (42)
, as well
as the newly described nuclear transfer technology (43)
offer an enormous potential for cell mediated gene therapy. However,
most of these in vitro differentiation methods give rise to
more than 200 different types of cells, and therefore the strength of
these discoveries can only be used if a distinct cellular subset can be
isolated. The availability of purified human cardiomyocytes will allow
the discovery of new growth factors, the evaluation of drugs, and
toxicologic in vitro studies. Our study describes the
potential to label and rapidly purify specifically ventricle-like
cardiomyocytes, which in the near future may open new avenues in the
treatment of congestive heart failure.
|
ACKNOWLEDGMENTS |
|---|
Received for publication January 3, 2000.
Revision received May 26, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  N. Gassanov, D. Devost, B. Danalache, N. Noiseux, M. Jankowski, H. H. Zingg, and J. Gutkowska Functional Activity of the Carboxyl-Terminally Extended Oxytocin Precursor Peptide During Cardiac Differentiation of Embryonic Stem Cells Stem Cells, January 1, 2008; 26(1): 45 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Huber, I. Itzhaki, O. Caspi, G. Arbel, M. Tzukerman, A. Gepstein, M. Habib, L. Yankelson, I. Kehat, and L. Gepstein Identification and selection of cardiomyocytes during human embryonic stem cell differentiation FASEB J, August 1, 2007; 21(10): 2551 - 2563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Gassanov, M. Jankowski, B. Danalache, D. Wang, R. Grygorczyk, U. C. Hoppe, and J. Gutkowska Arginine Vasopressin-mediated Cardiac Differentiation: INSIGHTS INTO THE ROLE OF ITS RECEPTORS AND NITRIC OXIDE SIGNALING J. Biol. Chem., April 13, 2007; 282(15): 11255 - 11265. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Wang, D. L. Haviland, A. R. Burns, E. Zsigmond, and R. A. Wetsel A pure population of lung alveolar epithelial type II cells derived from human embryonic stem cells PNAS, March 13, 2007; 104(11): 4449 - 4454. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Buggisch, B. Ateghang, C. Ruhe, C. Strobel, S. Lange, M. Wartenberg, and H. Sauer Stimulation of ES-cell-derived cardiomyogenesis and neonatal cardiac cell proliferation by reactive oxygen species and NADPH oxidase J. Cell Sci., March 1, 2007; 120(5): 885 - 894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. W. van Laake, R. Hassink, P. A. Doevendans, and C. Mummery Heart repair and stem cells J. Physiol., December 1, 2006; 577(2): 467 - 478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Caspi and L. Gepstein Stem cells for myocardial repair Eur. Heart J. Suppl., September 1, 2006; 8(suppl_E): E43 - E54. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schwanke, S. Wunderlich, M. Reppel, M. E. Winkler, M. Matzkies, S. Groos, J. Itskovitz-Eldor, A. R. Simon, J. Hescheler, A. Haverich, et al. Generation and Characterization of Functional Cardiomyocytes from Rhesus Monkey Embryonic Stem Cells Stem Cells, June 1, 2006; 24(6): 1423 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. J. Muller, B. Leuchs, S. T. Pleger, D. Grimm, W.-M. Franz, H. A. Katus, and J. A. Kleinschmidt Improved cardiac gene transfer by transcriptional and transductional targeting of adeno-associated viral vectors Cardiovasc Res, April 1, 2006; 70(1): 70 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Kouskoff, G. Lacaud, S. Schwantz, H. J. Fehling, and G. Keller Sequential development of hematopoietic and cardiac mesoderm during embryonic stem cell differentiation PNAS, September 13, 2005; 102(37): 13170 - 13175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Brodie and H. D. Humes Stem Cell Approaches for the Treatment of Renal Failure Pharmacol. Rev., September 1, 2005; 57(3): 299 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Keller Embryonic stem cell differentiation: emergence of a new era in biology and medicine Genes & Dev., May 15, 2005; 19(10): 1129 - 1155. [Abstract] [Full Text] [PDF]
|
|
|
|
), #22 (
) and #27 (
).
Percentage of beating areas of total EB outgrowth (A)
and number of EGFP-positive cells per EB (B) was
determined by light microscopy. EGFP fluorescence intensity
(C) was measured by FACS analysis of 50 enzymatically
digested EBs. The dotted line in panel C represents
background level. Values are given as means ±SE from three
independent experiments.
