| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
2
* Department of Surgical Research,
Department of Urology, and
Department of Pathology, Children’s Hospital and Harvard Medical School, Boston, Massachusetts 02115, USA
2Correspondence: Department of Surgical Research, Children’s Hospital, Enders, Room 1061, 300 Longwood Ave., Boston, MA 02115, USA.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: VEGF • VEGF receptors • motility • prostate carcinoma
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. At the molecular level, tumor
angiogenesis is mediated by a balance of activators and inhibitors.
Activators include members of the vascular endothelial growth factor
(VEGF) and fibroblast growth factor families, whereas inhibitors
include thrombospondin-1, interferon 
/ß, angiostatin, endostatin,
and others (2
3
4)
. There is ample evidence suggesting that
VEGF is a major contributor to tumor angiogenesis and growth. For
example, VEGF is a mitogen and chemoattractant for endothelial cells
(EC) and an angiogenesis factor in vivo (5
6
7)
.
Most tumor cells produce high levels of VEGF, and VEGF receptors
(VEGFRs) are expressed by tumor EC (5
, 8
, 9)
. Tumor
vascularization and growth are inhibited by anti-VEGF antibodies
(10
, 11)
, by dominant-negative VEGFRs (12)
,
and by soluble VEGFRs (13
, 14)
. VEGF expression is induced
by oncogenes such as Ras and inhibited by tumor suppressors
such as von Hippel Landau protein (15)
. VEGF expression is
up-regulated by hypoxia and is often elevated in regions of tumor
necrosis (16)
.
VEGF activities are mediated by high-affinity receptor tyrosine kinases
(RTKs) associated primarily with EC. Three VEGF binding RTKs have been
identified, Flt-1 (VEGFR-1), KDR/Flk-1 (VEGFR-2), and Flt-4 (VEGFR-3).
VEGFR-1 and VEGFR-2 are primarily expressed by vascular EC and VEGFR-3
by lymphatic EC (17
18
19
20)
. Recently, we identified another
VEGFR, neuropilin-1 (NRP1) (21
, 22)
, which is expressed by
EC and tumor cells. NRP1 binds VEGF165 but not
VEGF121 since the NRP1 binding site in
VEGF165 is encoded by VEGF exon 7, a domain that
is lacking in VEGF121 (21
, 23)
. NRP1
had been first described as a cell surface glycoprotein expressed on
axons in the developing nervous system (24
, 25)
and
subsequently shown to be a receptor for the semaphorins/collapsins
(26
, 27)
, a family of transmembrane and secreted
glycoproteins that act as mediators of neuronal guidance (26
, 28
29
30)
. Secreted collapsin-1 (Sema III/Sema D, now known as
Sema 3A) binds to NRP1 on axons, repels neurons, and induces
the collapse of dorsal root ganglia (DRG) neuronal growth cones
(29)
. Another member of the NRP family, NRP2, is a
receptor for VEGF165, placental-derived growth
factor-2 (22
, 31)
, and semaphorin IV (26
, 27
, 32)
.
There is evidence that NRP1 mediates angiogenesis. Overexpression of
NRP1 in mice resulted in excess capillary and blood vessel formation
and hemorrhaging in embryos, contributing to embryonic lethality
(33)
. Targeted disruption of NRP1 was embryonic lethal and
exhibited various types of vascular defects including impairment of
neural vascularization, transposition of large vessels, and
insufficient development of vascular networks in the yolk sac
(34
, 35)
. Our own studies demonstrated that coexpression
of NRP1 and KDR in porcine aortic EC enhanced
VEGF165 binding to KDR and KDR-mediated
chemotactic activity of VEGF165, suggesting that
in EC, NRP1 acts as a coreceptor for KDR (22)
.
Furthermore, Sema 3A inhibited the motility of porcine aortic EC in an
NRP1-dependent manner by disrupting the formation of lamellipodia and
inducing depolymerization of F-actin (36)
.
VEGF165 and Sema 3A are competitive inhibitors of
each other in binding, EC motility, and DRG collapse assays
(36)
, suggesting that the two ligands have overlapping
NRP1 binding sites, possibly the b/coagulation factor homology domain
(32)
.
An unanticipated result was our finding that tumor cells express NRP1
and bind VEGF165 via that receptor
(22)
. Some tumor cell lines express abundant NRP1; for
example, prostate and breast carcinoma cell lines possess 1–2 x
105 NRP1 copies per cell. The
Kd of VEGF165 binding to NRP1
in tumor cells is 2.8 x 10-10 M,
approximately the same as for VEGF165 binding to
EC NRP1 (22)
and Sema 3A binding to DRG NRP1 (26
, 27)
. Unlike EC, which express KDR as well as NRP1, the tumor
cell lines we have examined do not express KDR or Flt-1. However,
VEGF165 binding to these cells is mediated by
NRPs. The function of tumor-derived NRP1 is not known. Accordingly, we
overexpressed NRP1 in tumor cells in vitro and in
vivo using a tetracycline-inducible promoter to study the effect
of NRP1 expression on tumor cell phenotype. We report here that
conditional induction of NRP1 expression enhances tumor cell motility
as well as VEGF165 binding capacity in
vitro. Furthermore, induced expression of NRP1 in vivo
results in larger tumors associated with substantially increased tumor
angiogenesis and a lesser degree of tumor cell apoptosis.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Materials were purchased from the following
sources: cell culture media, Geneticin (G418), lipofectamine, Klenow
DNA polymerase, and T4 DNA ligase (Life Technologies, Rockville, Md.);
Taq DNA polymerase, dNTPs, hygromycin B, and protease
inhibitors (Boehringer Mannheim, Indianapolis, Ind.);
3H-thymidine, 125I-sodium,
32P-dCTP, and GeneScreen-Plus hybridization
transfer membranes (DuPont NEN, Boston, Mass.); disuccinimidyl suberate
and IODO-BEADS (Pierce Chemical, Rockford, Ill.); DNA labeling kits
(Amersham, Arlington Heights, Ill.). Restriction endonucleases were
from New England Biolabs (Beverly, Mass.); X-ray films were from
Eastman Kodak, Rochester, N.Y.; rabbit anti-von Willebrand factor (vWF)
antibody and mouse monoclonal anti-proliferating cell nuclear antigen
antibody were from DAKO (Carpinteria, Calif.); mouse monoclonal
anti-VEGF antibody (Upstate Biotechnology, Lake Placid, N.Y.);
Copenhagen rats were from Charles River Laboratories (Charlestown,
Mass.). Doxycycline (Dox) and all other chemicals were from Sigma (St.
Louis, Mo.) unless otherwise mentioned.
RNA extraction and reverse transcription-polymerase chain reaction
(RT-PCR)
Total RNA was prepared from cells in culture using RNeasy
columns (Qiagen, Santa Clarita, Calif.), according to the
manufacturer’s instructions. Reverse transcription of 2 µg total
RNA was carried out with Superscript II RNase
H- reverse transcriptase and 200 ng random
hexamers (Life Technologies). Primer pairs in PCR analysis were:
5'rNRP1 (ATGTGGAAGTGATCGATGGAG), 3'rNRP1 (GCTATTGCGCTGTCAGTGTAGA),
5'ß-actin (GACCTTCAACACCCCAGCC), 3'ß-actin (GCATACCCCTCGTAGATGG).
PCR (25 cycles) was carried out in 30 µl containing 10% of the cDNA
from the RT reaction, 10 pmol of each primer, 0.2 mM dNTPs, and 1 U
Taq DNA polymerase. Amplified PCR products (7 µl) were
electrophoresed on 1% agarose gels and stained with ethidium bromide.
Northern blot
NRP1 Northern blot analysis was carried out as described
(22
, 36)
. Briefly, total RNA (15 µg) was electrophoresed
on 1% formaldehyde-agarose gels and transferred to GeneScreen-Plus
membranes. The membranes were hybridized (42°C, 18 h) using
Hybridization Mixtures (Amresco, Solon, Ohio) with a
32P-labeled fragment of rat NRP1 cDNA
corresponding to nucleotides 400–905 in the open reading frame. After
hybridization, membranes were washed and exposed to X-ray films.
Tet-On system
AT2.1 cells were transfected with 5 µg pTet-On (Clontech, Palo
Alto, Calif.) and selected with 250 µg/ml G418. To screen for
induction in response to Dox, AT2.1/Tet-On cells were transiently
cotransfected with pTRE-Luc and pLacZ. The luciferase activity was
measured after 48 h induction with 2 µg/ml Dox. LacZ activity
was measured as a control for transfection efficiency. The pTRE plasmid
DNA (Clontech) was linearized with XbaI and treated with
Klenow DNA polymerase, followed by EcoRI digestion. A 3.4 kb
rNRP1 cDNA was cut from pMP21-rNRP1 plasmid with XhoI
(followed by Klenow polymerase treatment) and EcoRI
digestions. The cDNA was ligated into pTRE with T4 DNA ligase, yielding
pTRE-rNRP1. A clone of AT2.1/Tet-On with the highest luciferase
activity was cotransfected with pTRE-rNRP1 and pTK-Hyg, yielding
AT2.1/Tet-On/rNRP1 cells. The cells were grown in RPMI medium
containing 10% Tet system approved fetal calf serum (Clontech), in the
presence of hygromycin B and G418. Stable clones were screened for NRP1
expression by Northern and Western blot analyses after 48 h Dox
induction. Mock transfectants were transfected with pTet-On, pTK-Hyg
but without pTRE-rNRP1.
VEGF radioiodination and binding
The radioiodination of VEGF165 (22
, 36)
was achieved using IODO-BEADS and specific activities
ranging from 60,000–90,000 cpm/ng were obtained. Binding assays with
10 ng/ml 125I-VEGF165 were
carried out in 24-well plates using subconfluent cell cultures. The
cells were lysed with 250 µl of 1% Triton X-100 and bound
radioactivity was measured in a gamma counter as described previously
(22
, 36)
. Protein (5 µl aliquots) was measured using a
Bradford protein assay kit (Bio-Rad, Hercules, Calif.) and bound VEGF
was normalized to cpm/µg protein/well.
Western blot
Cell lysates (10 µg) were resolved on 7.5% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and transferred to PVDF
membranes (Millipore, Bedford, Mass.) as described (38)
.
Briefly, the membranes were blocked with 3% bovine serum albumin
(BSA), incubated with rabbit anti-rat NRP1 (1:1000), washed with a wash
buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Tween-20), incubated
with horseradish peroxidase (HRP) -conjugated goat anti-rabbit IgG
antibody (1:5000, Boehringer Mannheim), and washed again. The proteins
were detected with an ECL kit (NEN).
Motility assay
Motility assays were performed in a Boyden chamber (Neuro Probe
Inc., Gaithersburg, Md.), as described previously (22
, 36)
. Briefly, 15,000 cells in serum-free RPMI medium containing
0.1% BSA were added to wells in the upper chamber and RPMI medium
containing 0.1% BSA, but no growth factors were added to wells in the
lower chamber. The membranes were fixed with 4% formaldehyde and the
cells were stained with hematoxylin. The nonmigrating cells were
scraped off from the top of the filter, and the migrated cells at the
bottom side of the filter were counted by phase microscopy.
Proliferation assay
AT2.1/Tet-On/rNRP1 cells were seeded in 96-well plates (1000
cells/well). 3H-Thymidine (1 µCi/well) was
added when Dox treatment was started. After 48 h incubation, the
cells were harvested and the thymidine incorporated into DNA was
counted with a ß-counter (38)
.
Tumor growth in vivo
Animal studies were carried out in the animal facility of
Children’s Hospital in accordance with institutional guidelines. Male
Copenhagen rats 2 months old were anesthetized with isoflurane
inhalation. Cells (0.3x106/0.3 ml/rat) were
injected subcutaneously (s.c.) at the dorsal site between two hind
limbs. The rats (n=6, each group) were fed drinking water
containing 1% sucrose. To induce NRP1 expression, 10 µg/ml Dox was
added to the drinking water, which was changed every 48 h. Tumor
sizes were measured with a caliper every other day, and volume was
determined with the formula, volume = width2
x length x 0.52 (39)
.
Histology and histochemistry
Rats were killed 3–4 wk after tumor cell injection; tumor
tissues were fixed with 4% paraformaldehyde in phosphate-buffered
saline (PBS) and embedded in paraffin. Sections 5 µm thick were
examined by hematoxylin and eosin (H&E) staining. To examine entire
tumor cross sections, slides were scanned with a Polaroid Sprint Scan35
scanner (Meyer Instruments). For immunostaining, tissue sections were
deparaffinized and incubated with anti-rat NRP1 (1:1000), anti-vWF
(1:1000), anti-PCNA (1:50), or anti-VEGF (1:50). The slides were washed
with PBS, incubated with biotinylated goat anti-rabbit (for NRP1 and
vWF) and biotinylated goat anti-mouse IgG (for PCNA and VEGF) (Vector
Laboratories, Burlingame, Calif.). After HRP-Extravidin (1:50, Sigma)
incubation, the immunohistological reaction products were visualized
with 3,3'-diaminobenzidine. As controls, the primary antibodies were
either omitted or replaced with normal IgGs. Apoptotic cells were
detected with the terminal deoxynucleotidyl transferase-mediated dUTP
nick end labeling (TUNEL) assay (40)
. Briefly, the
sections were incubated with biotin-11-dUTP and deoxynucleotidyl
transferase (37°C, 16 h), washed, and incubated with
HRP-Extravidin. The TUNEL-positive cells were revealed with stable
3,3'-diaminobenzidine (Research Genetics, Huntsville, Ala.).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The
AT3.1 cells are more motile and tumorigenic than AT2.1 cells. To
confirm these cellular phenotypes, the two cell lines were analyzed in
a Boyden chamber migration assay to determine basal motility levels and
also injected into rats to measure tumor growth. AT3.1 cells were
three or fourfold more motile than AT2.1 cells (Fig. 1A
). The volume of AT3.1 tumors in rats after 4 wk of growth
was 12-fold greater than that of the AT2.1 cell tumors (Fig. 1B
). Relative NRP1 expression in these cell lines was
measured in vitro by RT-PCR and Northern blot analysis (Fig. 1C
). Whereas AT3.1 cells expressed abundant NRP1 mRNA, there
was very little NRP1 expression by AT2.1 cells. In contrast, both cell
types expressed similar levels of VEGF as determined by Northern blot
analysis (Fig. 1C
, bottom). Immunostaining of tumor sections
demonstrated that NRP1 was produced in AT3.1 but not AT2.1 tumors (Fig. 1D
). NRP1-positive tumor cells were preferentially detected
at the invading tumor front. Together, these results suggest there is a
positive correlation between higher levels of NRP1 expression in tumor
cells and enhanced tumor cell motility in vitro and tumor
size in vivo.
|
Effects of NRP1 induction in AT2.1 cells in vitro
To show a direct effect of NRP1 expression on tumor cell
phenotype, AT2.1 cells were transfected with rat NRP1 cDNA under the
control of a tetracycline-inducible promoter (Fig. 2
). Two highly inducible clones, AT2.1/Tet-On/rNRP1 clones 10 and 12,
were isolated in which NRP1 expression was strongly induced by the
tetracycline analog Dox, as determined by Northern blot (Fig. 2A
) and Western blot (Fig. 2B
) analyses. NRP1
expression was weakly or not detectable in non-Dox-treated cells (Fig. 2A
, 2B
, lanes 3, 5). However, in the presence of
Dox, the levels of 3.4 kb NRP1 mRNA (Fig. 2A
, lanes 4, 6)
and 130 kDa NRP1 protein (Fig. 2B
, lanes 4, 6) were
increased substantially. AT2.1 cells, mock-transfected with the pTet-On
plasmid DNA but without NRP1 cDNA, did not express detectable NRP1
either in the presence (Fig. 2A
, 2B
, lane 2) or
absence of Dox (Fig. 2A
, 2B
, lane 1).The optimal
dose of Dox necessary to induce NRP1 protein expression was 1–2
µg/ml (not shown). NRP1 protein expression was detected at 24 h
and was optimal 48 h after Dox treatment (not shown). NRP1 mRNA
could be detected as early as 4–6 h, and reached a maximum level at
20–24 h after Dox treatment (not shown). VEGF mRNA levels were not
altered by Dox treatments (not shown).
|
The induced NRP1 was functional.
125I-VEGF165 binding to
AT2.1/Tet-On/rNRP1 clones 10 and 12 was increased four- to eightfold
after Dox treatment (Fig. 3A
). Cross-linking followed by immunoprecipitation with
specific anti-NRP1 antibodies also demonstrated the enhanced binding of
125I-VEGF165 to AT2.1 cell
NRP1 induced by Dox compared to controls (not shown). On the other
hand, no
125I-VEGF165/VEGFR-2
complexes were formed with or without Dox, confirming that AT2.1 cells
do not express VEGFR-2 (not shown).
|
Induction of NRP1 expression in AT2.1/Tet-On/rNRP1 clones 10 and 12
increased cell basal level migration in a Boyden chamber threefold
compared to mock-transfected controls (Fig. 3B
). The cell
lines did not migrate to any greater extent in the presence of VEGF or
fetal calf serum (data not shown). However, induction of NRP1
expression did not affect tumor cell proliferation as measured by
3H-thymidine incorporation 48 h after Dox
treatment (Fig. 3C
).
All of the results that were obtained using the Dox-inducible promoter system were also obtained using stable AT2.1 cell lines expressing NRP1 (not shown).
NRP1 expression promotes tumor angiogenesis and progression
in vivo
AT2.1/Tet-On/rNRP1 clone 10 cells and the mock-transfected tumor
cells were injected into rats s.c. The rats, six in each experimental
and control group, were fed Dox in their drinking water over a 4 wk
period and the kinetics of tumor growth was measured (Fig. 4A
). In the absence of Dox, AT2.1 clone 10 tumors grew to a
volume of 12 cm3 (Fig. 4A
, open
circles). When NRP1 expression was induced by Dox, the tumor volume was
28 cm3, a 2.5-fold increase in size (Fig. 4A
, filled circles). On the other hand, mock-transfected
tumor cells grew as tumors to a size of 10 cm3
whether the animals were fed Dox (Fig. 4A
, filled squares)
or not (Fig. 4A
, open squares), demonstrating that Dox in
itself has no effect on tumor growth in vivo.
|
Immunohistological staining with specific anti-NRP1 antibodies
demonstrated that NRP1 protein expression was markedly induced by Dox
(Fig. 4E
) compared to non-Dox controls (Fig. 4D
).
As expected, Dox had no effect on NRP1 expression in mock-transfected
tumor cells lacking NRP1 cDNA (Fig. 4C
). Tumors with induced
NRP1 appeared to have more blood vessels compared to controls (Fig. 4E
vs. D
). These blood vessels often appeared to
be dilated. The presence of blood vessels was confirmed by
immunostaining with anti-vWF antibody, a marker for EC. Tumors with
induced NRP1 were significantly enriched in vWF-positive dilated
microvessels (Fig. 4G
vs. F
). The blood
vessel number was quantitated by counting tumor vessels in five
fields/tumor It was estimated that tumors with induced NRP-1 had three
to four times more blood vessels than the control tumors.
To demonstrate reproducibility with another inducible-AT2.1 clone and
to further examine the phenotype of the tumors with induced NRP1,
AT2.1/Tet-On/rNRP1 clone 12 cells were grown in vivo. Tumor
volumes were increased sevenfold in a 19 day period in animals that
were fed Dox (Fig. 5A
, filled circles) compared to untreated controls (Fig. 5A
, open circles). Upon termination of the experiment, whole
tumor tissues were subjected to histological analysis. Tumors with
induced NRP1 were visibly much larger than noninduced controls (Fig. 5A
, insets).
|
Tumors expressing induced NRP1 had much higher levels of PCNA-positive
proliferating tumor cells (Fig. 5C
) than noninduced tumors
(Fig. 5B
). In addition, tumors with induced NRP1 also
contained PCNA-positive vascular EC (Fig. 5C
, inset),
indicating a higher level of EC proliferation compared to the controls.
Tumors with induced NRP1 (Fig. 5E
) had relatively few
apoptotic cells as determined by TUNEL staining. On the other hand, in
non-Dox induced tumors (Fig. 5D
), there were numerous
regions of apoptotic tumor cells. In addition, apoptotic vascular EC
were detected in the non-Dox-induced tumors (Fig. 5D
,
inset), whereas EC in tumors with induced NRP1 expression were mostly
non-apoptotic (Fig. 5E
, open arrow). Since NRP1 is a VEGF
receptor, tumor sections were immunostained with anti-VEGF antibodies
to determine VEGF distribution. There was stronger VEGF immunostaining
in tumors with induced NRP1 expression (Fig. 5G
) than the
control tumors (Fig. 5F
). However, no difference
was observed in mRNA expression levels when the sections were analyzed
by in situ hybridization with VEGF riboprobes (not shown).
These results suggest that the tumors overexpressing NRP1 do not
synthesize additional VEGF but bind more VEGF to the tumor cells.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2.5-fold with one clone and six- to sevenfold in a
second clone in 3–4 wk compared to noninduced controls. Dox itself had
no effect on tumor growth since mock-transfected tumor cells grew to
the same extent with or without Dox. Overexpression of NRP1 in tumor
cells appeared to enhance tumor angiogenesis. The NRP1-overexpressing
tumors were substantially more vascular as determined by vWF staining.
In addition, an increase in proliferating EC in tumors with induced
NRP1 expression was detected by PCNA staining. Besides an apparent
increase in blood vessel density, the vessels in NRP1-overexpressing
tumors were more dilated, suggesting possible increased blood flow in
the tumors. NRP1 expression also decreased tumor cell and tumor
vascular EC apoptosis in vivo, indicating a survival
function for NRP1, possibly due to binding of VEGT and increased tumor
vascularization.
These results indicate that tumor-derived NRP1 is functional. Previous
results have shown that neuronal NRP1 mediates semaphorin axon
repulsion activity (26
, 27)
and that EC-NRP1 acts as a
coreceptor enhancing VEGFR-2-mediated chemotactic activities
(22)
. The mechanisms by which NRP1 expression induces
tumor angiogenesis and tumor growth in vivo are not yet
known. Dox-inducible NRP1 expression results in a five- to eightfold
increase in VEGF165 binding to NRP1-positive
tumor cells in vitro, and greatly enhanced levels of VEGF
protein, but not VEGF mRNA, can be detected in NRP1-overexpressing
tumors in vivo. Thus, one plausible mechanism is that as a
result of the enhanced levels of AT2.1 cell surface NRP1 after
induction, the VEGF165 produced by these cells is
retained in the tumor rather than diffusing away and, as a consequence
of higher concentrations of available VEGF165 in
the tumor, tumor angiogenesis is enhanced. The higher levels of NRP1 on
tumor cells could also lead to the binding of other members of the VEGF
family. VEGF-B and placental-derived growth factor, which
are expressed in tumor cells, also bind to NRP1 (41
, 42)
and are angiogenic (43)
.
There are alternative mechanisms as well; for example,
VEGF165 could stimulate tumor cells directly via
NRP1. VEGF165 binds to the AT2.1 prostate tumor
cells via NRP1 in the absence of VEGF RTKs and could activate these
tumor cells directly via a nonangiogenic pathway. One possibility is
that NRP1 expression activates downstream contributors to migration
pathways. For example, we have shown that Sema 3A inhibits EC migration
by retracting lamellipodia and depolymerizing F-actin in a
NRP1-dependent manner (36)
similar to the mechanisms that
lead to growth cone collapse (29)
. These processes are
regulated by members of the GTP binding protein family, including RhoA,
Rac1, and Cdc42 (44)
, and they could conceivably play a
role in NRP1-dependent tumor cell migration. It is now clear that
VEGF165 is not specific for EC but can interact
with non-EC such as tumor cells (22)
, Schwann cells
(45
, 46)
, and bone marrow stromal cells (47)
via NRP1. However, the effects of VEGF165 on
NRP1, a receptor with no apparent cytoplasmic kinase motifs, in these
cell types are yet unknown.
It may also be that the effects of NRP1 overexpression on cell motility in vitro and tumor angiogenesis in vivo are VEGF165 independent. The increase in tumor cell migration in a Boyden chamber in vitro after Dox induction of NRP1 was basal and not increased any further by stimulation with VEGF165, suggesting an NRP1 function independent of VEGF. One possibility is that NRP1 overexpression induces downstream genes that are responsible for enhancing cell motility and tumor vascularization. Analysis of NRP1-inducible genes after Dox induction of NRP1 is under way.
The proactive role of NRP1 in enhancing tumor angiogenesis and tumor
growth suggests that antagonizing NRP1 activity in tumor cells may be a
feasible anti-tumor strategy. We have previously identified several
anti-NRP1 antagonists. One of these is soluble NRP1 (sNRP1), which
consists of a portion of the NRP1 ectodomain and is expressed and
secreted by PC3 human prostate carcinoma and other cell types
(48)
. Tumors overexpressing sNRP1 are hemorrhagic and full
of disrupted blood vessels; the tumor cells are mostly apoptotic, a
phenotype opposite of tumors overexpressing full-length NRP1 as
reported here. A possible mechanism is that sNRP1 sequesters
VEGF165 away from EC, thereby blocking
VEGF-induced tumor angiogenesis. Another potential NRP1 antagonist is
Sema3A, which is a competitive inhibitor of
VEGF165 binding and of VEGF-induced EC migration
(36)
. Some tumor cells express NRP1, sNRP1, VEGF and, in
preliminary studies, Sema3A (C. J. Choi, H.-Q. Miao, and M.
Klagsbrun, unpublished results). It may be that the balance of these
angiogenesis-mediating factors determines the angiogenic potential of a
tumor cell.
In summary, this report is the first demonstration of NRP1 function in tumor cells. Tumor-derived NRP1 acts as a positive modulator of angiogenesis. Our future goals are to delineate the mechanisms by which NRP1 contributes to tumor growth and to target NRP1 as a potential anti-cancer strategy.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received for publication April 11, 2000.
Revision received June 5, 2000.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Chakraborty, S. Jain, and G. C. Kundu Osteopontin Promotes Vascular Endothelial Growth Factor Dependent Breast Tumor Growth and Angiogenesis via Autocrine and Paracrine Mechanisms Cancer Res., January 1, 2008; 68(1): 152 - 161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Calvani, D. Trisciuoglio, C. Bergamaschi, R. H. Shoemaker, and G. Melillo Differential Involvement of Vascular Endothelial Growth Factor in the Survival of Hypoxic Colon Cancer Cells Cancer Res., January 1, 2008; 68(1): 285 - 291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Li, D. Edholm, F. Lanner, G. Breier, F. Farnebo, A. Dimberg, and L. Claesson-Welsh Lentiviral Rescue of Vascular Endothelial Growth Factor Receptor-2 Expression in Flk1 / Embryonic Stem Cells Shows Early Priming of Endothelial Precursors Stem Cells, December 1, 2007; 25(12): 2987 - 2995. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Geretti, A. Shimizu, P. Kurschat, and M. Klagsbrun Site-directed Mutagenesis in the B-Neuropilin-2 Domain Selectively Enhances Its Affinity to VEGF165, but Not to Semaphorin 3F J. Biol. Chem., August 31, 2007; 282(35): 25698 - 25707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T.-M. Hong, Y.-L. Chen, Y.-Y. Wu, A. Yuan, Y.-C. Chao, Y.-C. Chung, M.-H. Wu, S.-C. Yang, S.-H. Pan, J.-Y. Shih, et al. Targeting Neuropilin 1 as an Antitumor Strategy in Lung Cancer Clin. Cancer Res., August 15, 2007; 13(16): 4759 - 4768. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Hochman, A. Castiel, J. Jacob-Hirsch, N. Amariglio, and S. Izraeli Molecular Pathways Regulating Pro-migratory Effects of Hedgehog Signaling J. Biol. Chem., November 10, 2006; 281(45): 33860 - 33870. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Vacca, C. Scavelli, G. Serini, G. Di Pietro, T. Cirulli, F. Merchionne, D. Ribatti, F. Bussolino, D. Guidolin, G. Piaggio, et al. Loss of inhibitory semaphorin 3A (SEMA3A) autocrine loops in bone marrow endothelial cells of patients with multiple myeloma Blood, September 1, 2006; 108(5): 1661 - 1667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Favier, A. Alam, P. Barron, J. Bonnin, P. Laboudie, P. Fons, M. Mandron, J.-P. Herault, G. Neufeld, P. Savi, et al. Neuropilin-2 interacts with VEGFR-2 and VEGFR-3 and promotes human endothelial cell survival and migration Blood, August 15, 2006; 108(4): 1243 - 1250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Ghez, Y. Lepelletier, S. Lambert, J.-M. Fourneau, V. Blot, S. Janvier, B. Arnulf, P. M. van Endert, N. Heveker, C. Pique, et al. Neuropilin-1 Is Involved in Human T-Cell Lymphotropic Virus Type 1 Entry J. Virol., July 15, 2006; 80(14): 6844 - 6854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Ellis The role of neuropilins in cancer Mol. Cancer Ther., May 1, 2006; 5(5): 1099 - 1107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Marwick, C. S. Stevenson, J. Giddings, W. MacNee, K. Butler, I. Rahman, and P. A. Kirkham Cigarette smoke disrupts VEGF165-VEGFR-2 receptor signaling complex in rat lungs and patients with COPD: morphological impact of VEGFR-2 inhibition Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L897 - L908. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Catalano, P. Caprari, S. Moretti, M. Faronato, L. Tamagnone, and A. Procopio Semaphorin-3A is expressed by tumor cells and alters T-cell signal transduction and function Blood, April 15, 2006; 107(8): 3321 - 3329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Kurschat, D. Bielenberg, M. Rossignol-Tallandier, A. Stahl, and M. Klagsbrun Neuron Restrictive Silencer Factor NRSF/REST Is a Transcriptional Repressor of Neuropilin-1 and Diminishes the Ability of Semaphorin 3A to Inhibit Keratinocyte Migration J. Biol. Chem., February 3, 2006; 281(5): 2721 - 2729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. El-Sheikh, P. Borgstrom, G. Bhattacharjee, M. Belting, and T. S. Edgington A Selective Tumor Microvasculature Thrombogen that Targets a Novel Receptor Complex in the Tumor Angiogenic Microenvironment Cancer Res., December 1, 2005; 65(23): 11109 - 11117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
< |
