FASEB J. Pierce now sold as Thermo Scientific
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BELANGER, H.
Right arrow Articles by YUSIBOV, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BELANGER, H.
Right arrow Articles by YUSIBOV, V.
(The FASEB Journal. 2000;14:2323-2328.)
© 2000 FASEB

Human respiratory syncytial virus vaccine antigen produced in plants

HELENE BELANGER*, NINA FLEYSH*, SHANNON COX*, GREG BARTMAN*, DEEPALI DEKA*, MICHEL TRUDEL{dagger}, HILARY KOPROWSKI* and VIDADI YUSIBOV*1

* Biotechnology Foundation Laboratories at Thomas Jefferson University, Philadelphia, Pennsylvania 19107, USA; and
{dagger} Centre de Recherche en Santehumaine, INRS-Institut Armand Frappier, Universite du Quebec, Laval, Canada

1Correspondence: Biotechnology Foundation Laboratories at Thomas Jefferson University, 1020 Locust St., Room 346 JAH, Philadelphia, PA 19107, USA. E-mail: vyusibov{at}hendrix.jci.tju.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human respiratory syncytial virus (RSV) is the primary cause of respiratory infection in infants worldwide. Currently there is no available vaccine, although studies in animal models have demonstrated protective immunity induced by an epitope of the RSV G-protein representing amino acids 174–187. Two peptides containing amino acids 174–187 of the G-protein of the human RSV A2 strain (NF1-RSV/172–187 and NF2-RSV/170–191) were separately engineered as translational fusions with the alfalfa mosaic virus coat protein and individually expressed in Nicotiana tabacum cv. Samsun NN plants through virus infection. RSV G-protein peptides were expressed in infected plant tissues at significant levels within 2 wk of inoculation and purified as part of recombinant alfalfa mosaic virions. BALB/c mice immunized intraperitoneally with three doses of the purified recombinant viruses showed high levels of serum antibody specific for RSV G-protein and were protected against infection with RSV Long strain.—Belanger, H., Fleysh, N., Cox, S., Bartman, G., Deka, D., Trudel, M., Koprowski, H., Yusibov, V. Human respiratory syncytial virus vaccine antigen produced in plants.


Key Words: G-protein • alfalfa mosaic virus • respiratory tract • RSV


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HUMAN RESPIRATORY SYNCYTIAL VIRUS (RSV), A MEMBER of the Paramyxoviridae family, is the most common cause of lower respiratory tract illness (1 2 3) , repeatedly infecting humans throughout their lifetime. Despite the presence of maternal antibodies, infants generally become infected and may suffer life-threatening illness. In fact, RSV infection represents the most common cause of infant hospitalization (4) . Subsequent infections usually do not progress to severe disease except in elderly and immunosuppressed individuals. Although the serious clinical and economic implications of RSV infection are well known, there is currently no safe and effective vaccine against this pathogen (5) . Early efforts to develop such a vaccine yielded a formalin-inactivated, alum-precipitated RSV preparation that not only failed to protect children, but also led to enhanced lower respiratory track illness and higher hospitalization rates after subsequent RSV infection (6 , 7) . Live attenuated RSV vaccines were also found to be unacceptable due to limited immunogenicity or lack of stability (5) .

Two major surface glycoproteins of RSV, fusion protein F and cell attachment protein G, are currently under intensive studies for subunit vaccine development (8 9 10 11) . Each of these proteins stimulates protective immunity in animals (12 13 14 15) . However, studies indicate that immunization with recombinant F or G-protein may lead to an altered immune response and disease enhancement upon subsequent RSV infection. Analyses of the B and T cell epitopes of these viral proteins have identified peptide sequences that provide protection against RSV and show promise for vaccine development (16 17 18 19 20 21 22 23 24 25) . The selection of well-characterized epitopes that confer effective immunity should allow the elimination of the viral determinants responsible for the adverse reactions in immunized children.

The immunogenicity of such peptides is generally increased by attaching them to a carrier molecule through chemical coupling to a molecule, such as keyhole limpet hemocyanin, or through translational fusion to structural proteins of bacterial (26) or mammalian (27) viruses. Recently, the coat protein (CP) of several plant viruses, including tobacco mosaic virus (28) , cow pea mosaic virus (29 , 30) , tomato bushy stunt virus (31) , and alfalfa mosaic virus (AlMV) (32) , have been used successfully as carrier molecules. Using the CP of AlMV as a carrier molecule for epitopes from the human immunodeficiency virus (HIV) gp120 or the rabies virus glycoprotein, we were able to induce neutralizing antibody production against HIV and protective immunity against rabies virus in mice (32 , 33) . Plant virus CP fused to a foreign peptide can self-assemble into particles and is finding increasing use in the production of antigenic peptides in plants. In addition to the safe and inexpensive production environment provided by plants, in-frame fusion of peptides to plant virus CP provides a means of easy and low-cost purification, an important aspect of large-scale peptide manufacturing.

In this study, we report the engineering and production of two peptides, which include amino acids 174–187 of the RSV G-protein (25) in plants as translational fusions with the AlMV CP using a newly developed plant virus expression vector based on AlMV. The AlMV genome consists of three plus-sense RNAs (RNA-1, -2, and -3) encapsidated by a single 24 kDa CP. A fourth AlMV RNA (subgenomic RNA4) is the messenger for the CP and is synthesized from genomic RNA3. The RSV G peptides were expressed in plants through plant virus infection and purified as part of AlMV virions. Mice immunized with recombinant AlMV containing the antigenic domain of the RSV G-protein showed high titers of RSV-specific serum antibodies and were protected against challenge infection.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
DNA constructs
All cloning and cell transformations were performed according to Sambrook et al. (34) . Escherichia coli JM109 competent cells (Promega, Madison, Wis.) were used for transformation. Two recombinant constructs, NF1-RSV and NF2-RSV (Fig. 1 ) were engineered through the in-frame fusion of RSV G peptide sequences to the amino-terminal coding sequences of the AlMV CP.



View larger version (14K):
[in this window]
[in a new window]
  		Figure 1. Schematic representation of NF1-RSV and NF2-RSV engineered using AlMV RNA3 and sequences of peptides cloned from RSV G-protein. P3 is a cell-to-cell movement protein; CP is a coat protein; P is a foreign peptide. Nucleotide and amino acid sequences of the peptides that were amino-terminally fused to CP to obtain NF1-RSV and NF2-RSV are indicated. AlMV CP sequences are in boldface.

NF1-RSV
Peptide coding sequences were cloned into pSP{Delta}AUG (35) , which contains an AlMV CP modified so that the AUG translation initiation codon is replaced by TCG to create a unique XhoI (CTCGAG) cloning site. A pair of complementary oligonucleotides (5'TCGAGCATCATGTCACCCTGCAGCATATGCAGCAACAATCCAACCTGCTGGGCTATCTGCAAG3' and 5'CGTAGTACAGTGGGACGTCGTATACGTCGTTGTTAGGTTGGACGACCCGATAGACGTTCAGCT3') encoding the amino acids 172–187 of the RSV G-protein were synthesized. Annealing of these two oligonucleotides generated XhoI and SalI compatible ends (5' and 3', respectively) for ligation into the unique Xhol site in pSP{Delta}AUG. Translation of the recombinant CP was initiated from the AUG codon introduced at the 5' end of the chimeric gene, which is upstream of nucleotide sequences encoding the RSV epitope. After sequence confirmation, the recombinant CP containing sequences for the RSV G-protein epitope was subcloned into full-length RNA3 of AlMV to create NF1-RSV (Fig. 1) .

NF2-RSV
This construct was created to express a 24-mer peptide representing amino acids 170–191 of the RSV G-protein. The sequence encoding the 24-mer peptide was polymerase chain reaction (PCR) amplified and amino-terminally fused to a mutant AlMV CP deleted of 12 amino-terminal amino acids and containing a unique KpnI site for cloning (CP{Delta}N12; Belanger et al., unpublished results). The DNA sequence encoding antigenic epitope of RSV G-protein was PCR amplified using 5'GCGCTCGAGGGTACCATGTCCTTTGTACCCTGCAGCATATGCAGCAACAATCCA3' as first-strand and 5'CGAGGTACCCTCTGGTATTCTTTTGCAGATAGCCCAGCAGGTTGGATTGTTGCT3' as second-strand primer. During PCR, the KpnI site was introduced for cloning into CP{Delta}N12. The PCR product was digested with KpnI and ligated into CP{Delta}N12 linearized by KpnI to obtain CP{Delta}N12RSV. After sequence confirmation, the recombinant CP was subcloned into full-length AlMV RNA3 to create NF2-RSV (Fig. 1) . NF2-RSV consists of full-length RNA3 where the antigenic epitope of RSV G-protein is fused to the NH2 terminus of mutant CP CP{Delta}N12 .

In vitro transcription
In vitro transcripts of genomic RNA3 and subgenomic RNA4 were synthesized using T7 and SP6 RNA polymerase, respectively (Promega), and purified plasmid DNA, according to the manufacturer’s guidelines. Transcripts were capped using the RNA cap structure analog m7G(5)ppp(5)G (Biolabs, Beverly, Mass.).

Plant infection and virus isolation
Recombinant viral constructs were produced in transgenic Nicotiana tabacum cv. Samsun NN plants expressing the AlMV P1 and P2 (P12) replicase genes (36) . For inoculation, a mixture (RNA4:RNA3, 1:1,000) of in vitro transcription products diluted 1:2 in FES buffer (37) was applied to the leaves of the transgenic P12 plants after abrading the leaf surface with carborundum (320-grit; Fisher, Pittsburgh, Pa.) and gently rubbed on the leaf surface to spread the inoculum and further abrade the surface. The recombinant virus was isolated 12–14 days postinoculation. Briefly, infected leaf tissue was homogenized in extraction buffer (0.1 M Na2HPO4, pH 7.1, 1 mM EDTA, 1% ß-mercaptoethanol, 0.1% Triton X-100) in a 1:3 w/v ratio using a Polytron homogenizer (Brinkmann Instruments, Inc., Westbury, N.Y.). Homogenate was treated with a premixed (1:1, v/v) solution of butanol-chloroform (1 ml of homogenate/ml of butanol-chloroform) and the sap was collected by centrifugation. Virus particles were selectively precipitated using 5% polyethylene glycol. Purified virus was resuspended in storage buffer (0.01 M Na2HPO4, pH 7.1, 1 mM EDTA).

Western blot and Coomassie staining analysis
Recombinant proteins produced in virus-infected plants were separated electrophoretically on sodium dodecyl sulfate (SDS) -polyacrylamide gels and either electroblotted onto a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, Calif.) for 1 h at 100 mA (32) or stained using Coomassie brilliant blue R250. After blocking with 5% powdered milk (in phosphate buffer), proteins were allowed to react with horseradish peroxidase-conjugated monoclonal antibodies (mAb) specific for AlMV CP (Agdia, Amherth, Ind.) or with mAb 18A2B2 (25) raised against a synthetic peptide containing amino acids 173–187 of the RSV G-protein. The proteins were also reacted with human RSV globulin RespiGam (MedImmune, Inc., Gaithersburg, Md.), derived from a pool of healthy human plasma. Reactivity was detected using chemiluminescent substrate (Boehringer, Indianapolis, Ind.). Concentration of the recombinant CP was determined by densitometric analysis of the chemiluminescent signal using a Fluor-S MultiImager (Bio-Rad Laboratories). A known concentration of purified wild-type (wt) AlMV CP was used as a standard.

Electron microscopy
Virus purified from AlMV-, NF1-RSV-, or NF2-RSV-infected plants was incubated with polyclonal antibodies against AlMV CP (Agdia; 1:10 dilution) for 30 min at room temperature and fixed with glutaraldehyde (final concentration 0.5%) for 5 min. Virus was applied on a carbon-coated grid, stained using 2% phosphotungstic acid (PTA) for 30 s, and visualized under a Hitachi HT7000 electron microscope.

Cells and virus
The human Long strain of RSV [VR-26; American Type Culture Collection (ATCC), Rockville, Md.] was propagated in Hep-2-cells (ATCC CCL-23) as described (25) .

Immunization and protection assays
Groups of five female BALB/c mice, 3–4 wk old, were injected intraperitoneally three times at 2 wk intervals with NF2-RSV or NF1-RSV in the presence of Freund’s complete (first injection) or incomplete (second and third injections) adjuvant, whereas control groups received RSV Long strain (105 TCID50/injection) or viral particles derived from the AlMV wt vector without the RSV insert or the challenge alone. Serum samples were collected 1 day before and 12 days after each immunization. Fourteen days after the last injection, all mice were challenged intranasally with 1.5 x 105 TCID50 of RSV Long strain as described (25) .

Enzyme-linked immunoassay (ELISA) assay
The presence of RSV-specific antibodies in the sera of immunized mice was analyzed by ELISA using flat-bottom microtiter plates coated overnight at 4°C with 0.1–1 µg of RSV per well as described (25) . Plates were read at 492 nm with an STL Lab Instrument spectrophotometer (Austria). End point titers were expressed as the last dilution giving an optical density twofold higher than background.

Virus titration
Five days after challenge, mice were killed and their lungs tested for the presence of virus. Lungs were immediately homogenized using a manual cell homogenizer at 0°C in 10 volumes of Hank’s solution (25 mM HEPES, pH 7.8, 218 mM sucrose, and 30 mM MgCl2) containing 0.5 µg/ml of Fungizone and 50 µg/ml of gentamicin. After centrifugation at 1500 rpm for 15 min, supernatants were collected and tested for the presence of virus by titration using HEp-2 cells as described previously (38) . Titers were expressed as log10 TCID50/g of lung tissue, calculated according to Karber’s method (38) . The detection limit of viral infection was <1.7/g of lung tissue.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of plant-derived RSV G-protein epitope
To express the RSV G peptides fused to the AlMV CP, 6-wk-old transgenic P12 plants were mechanically inoculated, respectively, with transcripts of NF1-RSV and NF2-RSV synthesized in vitro. Within 7 days of inoculation, symptoms of virus infection (vein clearing and yellowing) appeared in the uppermost three leaves. At 10 to 12 days after inoculation, the infection had spread throughout the entire plant with visible symptoms on all leaves. During this short period, significant quantities of recombinant CP had accumulated in systemically infected leaves due to the high rate of virus replication, with CP levels reaching, on average, 0.8 mg/g of fresh leaf tissue for both NF1-RSV and NF2-RSV. Up to 70% of expressed recombinant protein (0.5 mg/g of fresh tissue on average) was recoverable from infected leaf tissue as virus particles. The majority of particles recovered from NF1-RSV- or NF2-RSV-infected plants had a spherical or ellipsoid shape (Fig. 2 ), suggesting encapsidation of subgenomic RNA4 or genomic RNA3, respectively, in these virions. Long bacilliform particles suggestive of encapsidation of genomic RNA-1 or -2 were less frequently observed. These RNAs from transgenic P12 plants are defective at their 5' ends and are thus probably not replicated with virus RNA-dependent RNA polymerase.



View larger version (75K):
[in this window]
[in a new window]
  		Figure 2. Electron micrographs of particles purified from tobacco plants infected with AlMV, NF1-RSV, or NF2-RSV. The particles were stained using 2% PTA. Bars indicate 100 nm.

Recovery of correct-sized recombinant protein in purified virus samples was assessed by Western blot analysis (Fig. 3 ). Proteins immunoreactive with AlMV CP-specific antibodies migrated at the predicted molecular mass of 24.0 kDa for AlMV CP, 26.0 kDa for NF1-RSV, and 25.7 kDa for NF2-RSV. The presence of the antigenic RSV epitope in the fusion proteins was confirmed using mouse mAbs specific for the RSV G-protein epitope, which revealed the expected 26.0 and 25.7 kDa proteins in virus samples corresponding to NF1-RSV and NF2-RSV, respectively. Moreover, the RSV immune globulin preparation RespiGram also detected the plant-produced RSV antigens. However, neither RespiGram nor RSV-specific mAb detected the wt AlMV CP used as a control. Thus, AlMV and its CP provide an excellent system for expression and assembly of fused polypeptides. Coomassie blue staining showed that recombinant protein assembled into virions was purified to high homogeneity (Fig. 3) . Thus, these data demonstrate the efficiency of plant viruses not only as an expression system, but also as a purification system.



View larger version (45K):
[in this window]
[in a new window]
  		Figure 3. Western blot analysis of recombinant CP in virus particles purified from plants infected with wt AlMV, NF1-RSV, or NF2-RSV and Coomassie staining of proteins in the gel. Proteins were separated electrophoretically on a 12% SDS-polyacrylamide gel, transferred to a membrane, and reacted with different antibodies. Monoclonal antibodies specific for AlMV CP recognized 24.0 kDa (AlMV CP), 26.0 kDa (NF1-RSV), and 25.7 kDa (NF2-RSV) proteins, whereas antibodies specific for RSV G-protein or RespiGam recognized only NF1-RSV and NF2-RSV. Extracts from wt-AlMV infected plants did not react with antibodies specific for RSV. Coomassie staining demonstrates the efficiency of purification of polypeptides incorporated into virus particles. t indicates proteins from crude plant extracts infected with NF1-RSV or NF2-RSV, respectively; p indicates recombinant proteins isolated from these extracts by virus purification.

Immunogenicity of plant-derived RSV G-protein epitope
To evaluate the immunogenic and protective activity of recombinant plant viruses displaying the RSV G-protein epitope, BALB/c mice were immunized with purified NF1-RSV (0.8 mg/dose) or NF2-RSV (1.0 mg/dose) and challenged intranasally with 1.5 x 105 TCID50 of RSV Long strain. Both NF1-RSV and NF2-RSV stimulated production of RSV-specific serum IgG in immunized mice, whereas mice receiving AlMV vector without the insert or challenged only had background levels of response in ELISA (Table 1 ). Titers of RSV-specific serum antibody in NF2-RSV-immunized mice were considerably higher (1/61,440) compared to that of NF1-RSV (1/720). Mice immunized with RSV Long strain also had high titers of RSV-specific antibodies (1/29,440).


View this table:
[in this window]
[in a new window]
  		Table 1. Serum titers of RSV G-protein-specific IgG induced by plant virus containing RSV G peptide and protection from challenge

Analysis of the lungs of challenged mice revealed the absence of virus replication in groups immunized with RSV Long strain (positive control) and NF2-RSV (experimental vaccine), with virus titers in both groups below detection levels (<1.7±0.00, P=0.00, Table 1 ). Mice immunized with NF1-RSV were also protected (<= 2.0±0.37, P=0.00, Table 1 ), although two of the five mice in this group had detectable RSV titers in the lungs (<= 2.45), suggesting incomplete protection. Mice immunized with AlMV vector or challenged only had high virus titers in the lungs (<= 3.05±0.46; <= 3.1±0.41, respectively).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have developed an expression vector based on the AlMV genome that accommodates peptides fused to the NH2 terminus of viral CP. Indeed, two peptides of different size representing RSV G-protein amino acids 172–187 and 170–191, respectively, were fused to the NH2 terminus of AlMV CP and expressed in virus-infected plants. Expression and assembly of full-length fusion proteins into virions in the virus-infected plants indicates not only the stability of the recombinant virus, but also the ability of the AlMV CP to accommodate peptides of significant size without interfering with viral functions such as genome activation, replication, and assembly. Moreover, NF1-RSV and NF2-RSV were each passaged five consecutive times in new plants inoculated with an extract from systemically infected leaves of the previous passage without loss of the insert. Thus, these recombinant viruses retain the fusion protein not only during systemic movement throughout the entire plant, but also on subsequent passage to uninfected plants. In addition, the high replication rate of AlMV provides high levels of expression of the incorporated foreign sequences, so that on average 0.5 mg of NF1-RSV or NF2-RSV per gram of fresh tissue, equivalent to ~50 µg of pure RSV peptide, was purified. These results are comparable to those reported for cow pea mosaic virus (30) .

In mice, both NF1-RSV (amino acid 172–187) and NF2-RSV (amino acid 170–191) stimulated production of antibodies specific for the fusion peptide and provided protection against challenge infection. However, immunization with NF1-RSV, which contained the shorter peptide (amino acids 172–187), resulted in lower levels of RSV-specific antibody and only three of five mice immunized with NF1-RSV were protected. The reasons for this incomplete protection remain unclear, but it is possible that the additional amino acids present in NF2-RSV (amino acids 170–191) are needed for optimal immunogenicity. Alternatively, the use of lower doses (0.8 mg/dose) of NF1-RSV compared to those of NF2-RSV (1.0 mg/dose) might underlie the lower protection.

Expression of a plant-produced peptide representing the RSV G-protein antigenic epitope that provides protection to immunized animals may have important implications for the development of a safe, inexpensive, easily accessible and effective vaccine. Such a peptide-based vaccine should avoid incorporation of protein determinants responsible for disease enhancement. As shown here, the AlMV CP can be used for the production and delivery of functionally active molecules. The AlMV expression system might also allow development of a multivalent vaccine consisting of several antigenic determinants selected from different RSV proteins.


   ACKNOWLEDGMENTS
 
The authors thank Dr. Alexander Karasev for critical reading of this manuscript, Dr. Sue Loesch-Fries for the infectious cDNA clone of AlMV RNA4, Dr. John Bol for P12 plants, and Mike Berkovich, Francine Nadon, and Cecile Seguin for technical help. Research at Biotechnology Foundation Laboratories is supported by grants from the Commonwealth of Pennsylvania and U.S. Department of Agriculture.

Received for publication March 3, 2000. Revision received May 24, 2000.
   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Brandt, C. D., Kim, H. W., Arrobio, J. O. (1973) Epidemiology of respiratory syncytial virus infection in Washington D. C. III. Composite analysis of eleven consecutive yearly epidemics. Am. J. Epidemiol. 98,355-364[Abstract/Free Full Text]
  2. Chanock, R. M., Parrot, R. H. (1965) Acute respiratory disease in infancy and childhood: present understanding and prospects for prevention. Pediatrics 36,21-39[Abstract/Free Full Text]
  3. Mufson, M. A., Akerlind-Stopner, B., Orvell, C., Belshe, R. B., Norrby, E. (1991) A single-season epidemic with respiratory syncytial virus subgroup B2 during 10 epidemic years, 1978 to 1988. J. Clin. Microbiol. 29,162-165[Abstract/Free Full Text]
  4. Buraphacheep, W., Britt, W. J., Sullender, W. (1997) Detection of antibodies to respiratory syncytial virus attachment and nucleocapsid proteins with recombinant baculovirus-expressed antigens. J. Clin. Microbiol. 35,354-357[Abstract]
  5. Anderson, L., Heilman, C. (1995) Protective and disease-enhancing immune responses to respiratory syncytial virus. J. Infect. Dis. 171,1-7[Medline]
  6. Kapikian, A. Z., Mitchell, R. H., Chanock, R. M., Shvedoff, R. A., Stewart, C. E. (1969) An epidemiologic study of altered reactivity to respiratory syncytial (RS) virus infection in children previously vaccinated with an inactivated RS virus vaccine. Am. J. Epidemiol. 89,405-421[Abstract/Free Full Text]
  7. Kim, H. W., Canchola, J. G., Brandtt, C. D., Pyles, G., Chanock, R. M., Jensen, K., Parrot, R. H. (1969) Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am. J. Epidemiol. 89,422-434[Abstract/Free Full Text]
  8. Groothius, J. R., King, S. J., Hogerman, D. A., Paradiso, P. R., Simoes, E. A. F. (1998) Safety and immunogenicity of a purified F protein respiratory syncytial virus (PFP-2) vaccine in seropositive children with bronchopulmonary dysplasia. J. Infect. Dis. 177,467-469[Medline]
  9. Sullender, W. M., Britt, W. J. (1996) Antigenic and immunogenic analysis of group A and group B respiratory syncytial virus G proteins expressed from recombinant baculoviruses. J. Gen. Virol. 77,641-648[Abstract/Free Full Text]
  10. Tristram, D. A., Welliver, R. C., Mohar, K., Hogerman, D. A., Hildreth, S. W., Paradiso, P. (1993) Immunogenicity and safety of respiratory syncytial virus subunit vaccine in seropositive children 18–36 months old. J. Infect. Dis. 167,191-195[Medline]
  11. Wertz, G. W., Stott, E. J., Young, K. K., Anderson, K., Ball, L. A. (1987) Expression of the fusion protein of human respiratory syncytial virus from recombinant vaccinia virus vectors and protection of vaccinated mice. J. Virol. 61,293-301[Abstract/Free Full Text]
  12. Connors, M., Collins, P., Firestone, C. (1991) Respiratory syncytial virus (RSV) F, G, M2 (22K), and N proteins each induce resistance to RSV challenge, but resistance induced by M2 and N proteins is relatively short-lived. J. Virol. 65,1634-1637[Abstract/Free Full Text]
  13. Elango, N., Prince, G. A., Murphy, B. R., Venkatesan, S., Chanock, R. M., Moss, B. (1986) Resistance to human respiratory syncytial virus (RSV) infection induced by immunization of cotton rats with a recombinant vaccinia virus expressing the RSV G glycoprotein. Proc. Natl. Acad. Sci. USA 83,1906-1910[Abstract/Free Full Text]
  14. Stott, E. J., Ball, L. A., Young, K. K., Furze, J., Wertz, G. W. (1986) Human respiratory syncytial virus glycoprotein G expressed from a recombinant vaccinia virus vector protects mice against live-virus challenge. J. Virol. 60,607-613[Abstract/Free Full Text]
  15. Sullender, W. M., Anderson, K., Wertz, G. W. (1990) The respiratory syncytial virus subgroup B attachment glycoprotein: analysis of sequence, expression from a recombinant vector, and evaluation as an immunogen against homologous and heterologous subgroup virus challenge. Virology 178,195-203[Medline]
  16. Akerlind-Stopner, B., Utter, G., Mufson, M. A., Orvell, C., Lerner, R. A., Norrby, E. (1990) A subgroup-specific antigenic site in the G protein of respiratory syncytial virus forms a disulfide-bonded loop. J. Virol. 64,5143-5148[Abstract/Free Full Text]
  17. Akerlind-Stopner, B., Utter, G., Norrby, E., Mufson, M. A. (1995) Evaluation of subgroup-specific peptides of the G protein of respiratory syncytial virus for characterization of the immune response. J. Med. Virol. 47,120-125[Medline]
  18. Arbiza, J., Taylor, G., Lopez, J. A., Furze, J., Wyld, S., Whyte, P., Stott, E. J., Wertz, G., Sullender, W., Trudel, M. (1992) Characterization of two antigenic sites recognized by neutralizing monoclonal antibodies directed against the fusion glycoprotein of human respiratory syncytial virus. J. Gen. Virol. 73,2225-2234[Abstract/Free Full Text]
  19. Bastien, N., Trudel, M., Simard, C. (1999) Complete protection of mice from respiratory syncytial virus infection following mucosal delivery of synthetic peptide vaccines. Vaccine 17,832-836[Medline]
  20. Scopes, G. E., Watt, P. J., Lambden, P. R. (1990) Identification of a linear epitope on the fusion glycoprotein of respiratory syncytial virus. J. Gen. Virol. 71,53-59[Abstract/Free Full Text]
  21. Simard, C., Nadon, F., Seguin, C., Thien, N. N., Binz, H., Basso, J., Laliberte, J. F., Trudel, M. (1997) Subgroup specific protection of mice from respiratory syncytial virus infection with peptides encompassing the amino acid region 174–187 from the G glycoprotein: the role of cysteinyl residues in protection. Vaccine 15,423-432[Medline]
  22. Taylor, G., Stott, E. J., Furze, J., Ford, J., Sopp, P. (1992) Protective epitopes on the fusion protein of respiratory syncytial virus recognized by murine and bovine monoclonal antibodies. J. Gen. Virol. 73,2217-2223[Abstract/Free Full Text]
  23. Trudel, M., Nadon, F., Seguin, C., Dionne, G., Lacroix, M. (1987) Identification of a synthetic peptide as part of a major neutralization epitope of respiratory syncytial virus. J. Gen. Virol. 68,2273-2280[Abstract/Free Full Text]
  24. Trudel, M., Stott, E. J., Taylor, G., Oth, D., Mercier, G., Nadon, F., Seguin, C., Simard, C., Lacroix, M. (1991) Synthetic peptides corresponding to the F protein of RSV stimulate murine B and T cells but fail to confer protection. Arch. Virol. 117,59-71[Medline]
  25. Trudel, M., Nadon, F., Seguin, C., Binz, H. (1991) Protection of BALB/c mice from respiratory syncytial virus infection by immunization with a synthetic peptide derived from the G glycoprotein. Virology 185,749-757[Medline]
  26. Greenwood, J., Willis, A. E., Perham, R. N. (1991) Multiple display of foreign peptides on a filamentous bacteriophage. Peptides from Plasmodium falciparum circumsporozoite protein as antigens. J. Mol. Biol. 220,821-827[Medline]
  27. Dedieu, J. F., Ronco, J., van der Werf, S., Hogle, J. M., Henin, Y., Girard, M. (1992) Poliovirus chimeras expressing sequences from the principal neutralization domain of human immunodeficiency virus type 1. J. Virol. 66,3161-3167[Abstract/Free Full Text]
  28. Hamamoto, H., Sugiyama, Y., Nakagawa, N., Hashida, E., Matsunaga, Y., Takemoto, S., Watanabe, Y., Okada, Y. (1993) A new tobacco mosaic virus vector and its use for the systemic production of angiotensin-I-converting enzyme inhibitor in transgenic tobacco and tomato. Bio/Technology 11,930-932[Medline]
  29. Porta, C., Spall, V. E., Loveland, J., Johnson, J. E., Barker, P. J., Lomonossoff, G. P. (1994) Development of cowpea mosaic virus as a high-yielding system for the presentation of foreign peptides. Virology 202,949-955[Medline]
  30. Usha, R., Rohll, J. B., Spall, V. E., Shanks, M., Maule, A.J., Johnson, J. E., Lomonosoff, G. P. (1993) Expression of an animal virus antigenic site on the surface of a plant virus particle. Virology 197,366-374[Medline]
  31. Joelson, T., Akerblom, L., Oxefelt, L., Strandberg, B., Tomenius, K., Morris, T. J. (1997) Presentation of a foreign peptide on the surface of tomato bushy stunt virus. J. Gen. Virol. 78,1213-1217[Abstract]
  32. Yusibov, V., Modelska, A., Steplewski, K., Agadjanyan, M., Weiner, D., Hooper, C., Koprowski, H. (1997) Antigens produced in plants by infection with chimeric plant viruses immunize against rabies virus and HIV-1. Proc. Natl. Acad. Sci. USA 94,5784-5788[Abstract/Free Full Text]
  33. Modelska, A., Dietzschold, B., Flyesh, N., Fu, Z. F., Steplewski, K., Hooper, D. C., Koprowski, H., Yusibov, V. (1998) Immunization against rabies with plant-derived antigen. Proc. Natl. Acad. Sci. USA 95,2481-2485[Abstract/Free Full Text]
  34. Sambrook, S., Fritsch, E. F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual 2nd Ed Cold Spring Harbor Lab. Press Plainview, N.Y..
  35. Yusibov, V., Loesch-Fries, L. S. (1995) N-terminal basic amino acids of alfalfa mosaic virus coat protein involved in the initiation of infection. Virology 208,405-407[Medline]
  36. Taschner, P. E. M., van der Kuyl, A. C., Neeleman, L., Bol, J. F. (1991) Replication of incomplete alfalfa mosaic virus genome in plants transformed with viral replicase genes. Virology 181,445-450[Medline]
  37. Verch, T., Yusibov, V., Koprowski, H. (1998) Expression and assembly of a full-length monoclonal antibody in plants using a plant virus vector. J. Immunol. Methods 220,69-75[Medline]
  38. Taylor, G., Stott, E. J., Fernie, B. F., Coté, P. J., Collins, A. P., Hughes, M., Jebbett, J. (1984) Monoclonal antibodies that protect against respiratory syncytial virus infection in mice. Immunology 52,137-142[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BELANGER, H.
Right arrow Articles by YUSIBOV, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BELANGER, H.
Right arrow Articles by YUSIBOV, V.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS