FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SANTUCCI-DARMANIN, S.
Right arrow Articles by PAQUIS-FLUCKLINGER, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SANTUCCI-DARMANIN, S.
Right arrow Articles by PAQUIS-FLUCKLINGER, V.
(The FASEB Journal. 2000;14:1539-1547.)
© 2000 FASEB

MSH4 acts in conjunction with MLH1 during mammalian meiosis

SABINE SANTUCCI-DARMANIN*,1, DEEPIKA WALPITA{dagger},1, FRANÇOISE LESPINASSE*, CLAUDE DESNUELLE*, TERRY ASHLEY{dagger} and VÉRONIQUE PAQUIS-FLUCKLINGER*2

* Laboratoire de Neurobiologie Cellulaire, UMR CNRS/UNSA 6549, Faculté de Médecine, 06107 Nice cédex 2, France; and
{dagger} Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06510, USA

2Correspondence: Laboratoire de Neurobiologie Cellulaire, UMR CNRS/UNSA 6549, Faculté de Médecine, Avenue de Valombrose, 06107 Nice cédex 2, France. E-mail: paquis{at}unice.fr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
MSH4 is a meiosis-specific MutS homolog. In yeast, it is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. MLH1 (MutL homolog 1) facilitates both mismatch repair and crossing over during meiosis in yeast. Germ-line mutations in the MLH1 human gene are responsible for hereditary nonpolyposis cancer, but the analysis of MLH1-deficient mice has revealed that MLH1 is also required for reciprocal recombination in mammals. Here we show that hMSH4 interacts with hMLH1. The two proteins are coimmunoprecipitated regardless of the presence of DNA or ATP, suggesting that the interaction does not require the binding of MSH4 to DNA. The domain of hMSH4 responsible for the interaction is in the amino-terminal part of the protein whereas the region that contains the ATP binding site and helix-turn-helix motif does not bind to hMLH1. Immunolocalization analysis shows that MSH4 is present at sites along the synaptonemal complex as soon as homologous chromosomes synapse. The number of MSH4 foci decreases gradually as pachynema progresses. During this transition, MLH1 foci begin to appear and colocalize with MSH4. These results suggest that MSH4 is first required for chromosome synapsis and that this MutS homologue is involved later with MLH1 in meiotic reciprocal recombination.—Santucci-Darmanin, S., Walpita, D., Lespinasse, F., Desnuelle, C., Ashley, T., Paquis-Flucklinger, V. MSH4 acts in conjunction with MLH1 during mammalian meiosis.


Key Words: MSH proteins • MLH proteins • protein interaction • synapsis • meiotic recombination • mismatch DNA repair


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE ESCHERICHIA COLI MutHLS system has been highly conserved throughout evolution. The eukaryotic pathway results in a specialization of MutS and MutL homologs, which have evolved to play crucial roles in both DNA mismatch repair and meiotic recombination (1) . In somatic nuclei, the recognition of mismatched nucleotides requires the formation of MSH2-MSH3 or MSH2-MSH6 complexes. Heterodimerization appears to allow the specificity of mismatch recognition. Once the MutS homologue heterodimer is bound to the DNA, a second heterodimer composed of two MutL homologs (MLH1-PMS1 in yeast and MLH1-PMS2 in human) is required for mismatch correction. In Saccharomyces cerevisiae, MSH4, despite being highly homologous to other MutS homologs, plays no role in mismatch recognition (2) . This yeast protein is associated with chromosomes during pachynema and is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I (2) . The expression of a protein encoded by the human homologue of the yeast MSH4 gene is also restricted to meiotic cells (3 , 4) . Similar to results observed in yeast (5) , hMSH4 forms a heterodimeric complex with hMSH5 (6 , 7) , another MutS homologue that functions predominantly in meiosis (8 9 10) . The interaction between hMSH4 and hMSH5 confirms that, as in the DNA repair pathway, heterodimeric interaction of MutS homologs is required during mammalian meiosis. However functional interactions between MSH and MLH proteins have never been demonstrated in the mammalian meiotic process.

As a step toward understanding the biological function of MSH4 during mammalian meiosis, we decided to determine whether this protein interacts with other proteins involved in meiotic recombination. Different features led us to search for an interaction between hMSH4 and hMLH1. First, MLH1 interacts with MSH proteins in DNA mismatch repair (1) . Second, the involvement of MLH1 during meiosis has been demonstrated in yeast (11) and in mammals (12 13 14) . This protein localizes to sites of crossing over on meiotic chromosomes (12 , 15 , 16) and MLH1-deficient mice are sterile. In these mice, meiotic failure is associated with greatly reduced levels of chiasmata, suggesting a critical role for MLH1 in reciprocal recombination.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Antibodies
We used rabbit polyclonal peptide antibodies (GP3) raised against the last carboxyl-terminal 15 aa of the hMSH4 protein. The mouse monoclonal antibody recognizing human MLH1 (Ab-1) was purchased from Oncogene Sciences (Uniondale, N.Y.). A monoclonal antibody directed against T7.Tag sequence was obtained from Novagen (Madison, Wis.). To detect GST fusion proteins, we used goat polyclonal antibodies that recognize the GST.Tag sequence (Amersham-Pharmacia, Little Chalfont, U.K.). Secondary antibodies used in Western blotting experiments were goat anti-rabbit (Amersham), goat anti-mouse (Amersham), and rabbit anti-goat (Dako, Carpinteria, Calif.) conjugated with horseradish peroxidase.

Plasmid constructions
To construct plasmid encoding hMSH4 fusion protein (pTRC His-hMSH4), the entire hMSH4 cDNA was inserted in the correct reading frame into the KpnI site of pTRC His b vector (Invitrogen, San Diego, Calif.). A plasmid for the production of hMLH1 fusion protein (pET 28-hMLH1) was generated as follows: hMLH1 cDNA was ligated in-frame into the XhoI site of pET 28 b vector (Novagen). pTRC His-hMSH4 and pET 28-hMLH1 vectors express respectively hMSH4 and hMLH1 fusion proteins, both carrying to their amino-terminal end the 11 amino acid T7.Tag sequence. This sequence allows the detection of hMSH4 and hMLH1 fusion proteins by using an anti-T7.Tag monoclonal antibody. For the expression of various hMSH4 mutants as glutathione S-transferase (GST) fusion proteins, plasmids were generated as follows. To amplify specific regions of hMSH4 cDNA, polymerase chain reactions were performed by using oligonucleotides primers containing a terminal restriction site for subsequent subcloning. Resulting amplified products were digested with the correct enzyme and ligated in-frame into the corresponding restriction site of the pGEX-5X-2 vector (Pharmacia, Piscataway, N.J.). The cDNA inserts were confirmed to be free of mutations by DNA sequencing. The primer pairs used to generate the various deletion mutants were as follows. GST-hMSH4-{Delta}1: sense 5' GGAATTCATTTTTTGATCATAACTGGACCA 3', reverse 5' GGAATTCTTATTCTTCAGTCTTTTCTGGA 3'; GST-hMSH4-{Delta}2: sense 5' TCCCCCGGGATGCTGAGGCCTGAGATCT 3', reverse 5' TCCCCCGGGTCAATTACTCCCTTCTGTAAC 3'; GST-hMSH4-{Delta}3: sense 5' GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse 5' GCGGATCCACAAGTTCCAAGGTATGTTT 3'; GST-hMSH4-{Delta}4: sense 5' GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse: 5' TCCCCCGGGCCTATAGTCTTGATTATT 3'; GST-hMSH4-{Delta}5: sense 5' GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse 5' TCCCCCGGGCTTGGACTGAACCTCCAT 3'. Restriction sites present in the oligonucleotides are italicized. For GST-hMSH4-{Delta}1, GST-hMSH4-{Delta}2, and GST-hMSH4-{Delta}3 constructs, cDNA inserts were ligated respectively into EcoRI, SmaI and BamHI restriction sites of the pGEX-5X-2 vector. cDNAs insert present in either GST-hMSH4-{Delta}4 or GST-hMSH4-{Delta}5 were cloned between BamHI and SmaI sites of the pGEX-5X-2 vector.

In vitro translation
The pET 28-hMLH1 plasmid was added to coupled transcription-translation rabbit reticulocytes lysates (Promega, Madison, Wis.) with [35S]L-methionine (Amersham), according to the manufacturer’s instructions.

Expression of recombinant proteins
E. coli BL21 (DE3) host strain was used for expression of the various recombinant proteins. For coexpression of the hMLH1 protein with either full-length or truncated hMSH4 proteins, BL21 (DE3) cells were transformed simultaneously with pET 28-hMLH1 and either pTRC His-hMSH4 or one of the pGEX-hMSH4 constructs described above. The resulting transformants were selected on LB plates containing ampicillin and kanamycin. Fresh overnight cultures of transformed BL21 (DE3) were diluted 1 in 100 with LB medium containing appropriate antibiotics. After growth at 37°C to an A600 of 0.6, each culture was induced by adding 1 mM-IPTG (isopropyl-1-thio-ß-D galactopyranoside) for 3 h. Induced cells were collected by centrifugation at 4°C, frozen in liquid nitrogen, and stored at -80°C for further extraction (see below). To analyze expression of fusion proteins, 2 ml of induced cultures was used to make whole-cell lysates. Cells were harvested by centrifugation at 4°C and the pellet was resuspended directly in 200 µl of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer and incubated at 95°C for 3 min. Resulting protein samples were separated on SDS-8% polyacrylamide gels and analyzed by Western blotting as follows. After electrophoresis, proteins were electrotransferred onto Hybond-C extra filters (Amersham). The filters were incubated overnight in TBS-T buffer (Tris-buffered saline and 0.05% polyoxyethylene sorbitan monolaurate) containing 3% bovine serum albumin (BSA fraction V, Sigma, St. Louis, Mo.). Then the filters were incubated for 1 h with appropriate antibodies. GP3 polyclonal antibodies (1:2000 dilution) and the monoclonal Ab-1 antibody (1:100) were used to detect respectively the full-length hMSH4 fusion protein and the hMLH1 fusion protein. The monoclonal anti-T7.Tag antibody (1:5000 dilution) allowed detection of both hMSH4 and hMLH1 fusion proteins; polyclonal anti-GST antibodies (1:2000 dilution) were used to visualize the various GST-hMSH4 deletion mutants. After extensive washing in TBS-T buffer, the filters were incubated for 45 min with appropriate secondary antibodies conjugated to horseradish peroxidase. The filters were washed again with TBS-T buffer prior to detection of signal by using ECL chemiluminescent detection system (Amersham).

Coimmunoprecipitation of hMSH4 and hMLH1 recombinant proteins
When induced bacterial cells transformed with either pTRC His-hMSH4 or pET 28-hMLH1 were lysed by sonication or lysozyme treatment, we observed that hMSH4 is mostly soluble, whereas a large proportion of hMLH1 is present in the insoluble fraction. When the two proteins are generated in the same bacterial cells, hMSH4 becomes partially insoluble, as was hMLH1. Therefore, proteins extracts derived from BL21(DE3) cells doubly transformed with pTRC His-hMSH4 and pET 28-hMLH1 plasmids were made by using a denaturing lysis procedure in order to release most of the hMSH4 and hMLH1 fusion proteins. For this purpose, frozen pellets of induced bacterial cells prepared as described above were resuspending in denaturing buffer (50 mM Tris-HCl, pH 7.5, 8 M urea, 1 vol. buffer per 10 vol bacterial culture) and incubated on ice for 30 min. After sonication, the lysate was submitted to centrifugation at 10,000 g for 30 min at 4°C. To allow protein renaturation and refolding, 250 µl aliquots of the resulting supernatant were diluted progressively (20x) in ice-cold buffer A: 25 mM Tris-HCl, pH 7.5, 100 mM KCl, 5 mM MgCl2, 5 mM DTT, 10% glycerol, 2% BSA with complete EDTA-free protease inhibitor cocktail (Boehringer Mannheim, Mannheim, Germany) and in the presence or absence of 1.5 mM ATP. The resulting 5 ml diluted supernatant was incubated either with DNase I (Boehringer Mannheim) for 30 min at 25°C or in the presence of 4 µg DNA (double- or single-stranded) for 30 min at 4°C. Then immunoprecipitation was performed by incubating, for 1 h on ice, the diluted lysate with 20 µl of hMSH4 anti-peptide serum (GP3) or with 20 µl of the corresponding preimmune serum. 50 µl of a 50% slurry of protein A-Sepharose beads (Pharmacia Biotech, Brussels, Belgium), preequilibrated in buffer A, was added and the reaction was incubated for 1 h at 4°C with gentle rocking. Immunoprecipitates were recovered by centrifugation and washed twice with buffer B (50 mM Tris-HCl, pH 8, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 1 mM DTT, 1 mM PMSF) and once with buffer B adjusted to 1 M NaCl. The washed beads were resuspended with 25 µl of SDS-PAGE loading buffer and boiled for 3 min. Resulting protein samples were separated on SDS-8% polyacrylamide gel and electrotransferred onto filters for Western blotting analysis. The filters were blotted with either anti-hMSH4 polyclonal antibodies (GP3), the monoclonal antibody recognizing hMLH1 (Ab-1), or the monoclonal antibody directed against the T7.Tag sequence.

GST fusion protein interaction assay
Induced bacterial cells that express the T7.Tag-hMLH1 fusion protein with one of the GST-hMSH4 deletion mutants (GST-hMSH4-{Delta}1, {Delta}2, {Delta}3, {Delta}4, or {Delta}5) were used to prepare lysates, as described above, by using denaturing conditions, followed by 20x dilution in buffer A. Then 100 µl of a 50% slurry of glutathione S-Sepharose beads (GST beads) preequilibrated in buffer A was added to 10 ml of diluted lysates. After an incubation of 2 h at 4°C with gentle rocking, the GST beads were collected by centrifugation at 1000 rpm for 30 s, the supernatant was removed, and the beads were washed as described above for protein A-Sepharose beads. The washed beads were resuspended with 50 µl of SDS-PAGE loading buffer, boiled for 3 min, and spun at 1000 rpm for 30 s; 25 µl of the resulting supernatant was loaded on a SDS-8% polyacrylamide gel and analyzed by Western blotting. Filters were probed with either anti-GST antibodies in order to detect the various GST-hMSH4 deletion mutants or the anti-MLH1 monoclonal antibody (Ab-1).

GST fusion protein interaction assay with in vitro translated hMLH1 protein
GST fusion protein interaction assay was also performed by using GST-hMSH4 deletion mutants ({Delta}1, {Delta}2) expressed in E. coli and in in vitro transcribed and translated hMLH1 protein. This interaction assay was essentially as described by Guerrette and colleagues (17) with some modifications. Frozen pellets of induced E. coli BL21 (DE3) cells that express either GST-hMSH4-{Delta}1, GST-hMSH4-{Delta}2, or GST proteins were resuspended in lysis buffer C: 20 mM Tris-HCl, pH 8, 500 mM NaCl, 1% Nonidet P40, 10% glycerol, 5 mM DTT with complete EDTA free proteases inhibitor cocktail (1 vol buffer per 10 vol bacterial culture). Lysozyme was added to a concentration of 1 mg/ml and left on ice for 30 min. Lysates were submitted to sonication, followed by centrifugation at 10,000 g for 30 min at 4°C. Resulting supernatants were incubated with DNase I (20 µg/ml) for 30 min at 25°C. Then GST beads preequilibrated in buffer C plus 2% BSA were added to lysates such that ~ 200 ng of GST fusion proteins were bound to 50 µl of beads. After an incubation of 2 h at 4°C, the GST beads were washed as described previously. The binding reaction was then performed with 50 µl of beads and 15 µl of in vitro translated hMLH1 in 1 ml of binding buffer D: 20 mM Tris-HCl, pH 8, 150 mM NaCl, 0.1% Nonidet P40, 10% glycerol, 0.75 mg/ml BSA, 5 mM EDTA, 2 mM DTT with complete EDTA free proteases inhibitor cocktail. After 1 h of incubation at 4°C, the bound complexes were sedimented and washed four times in binding buffer D. The beads were resuspended in 50 µl of SDS-PAGE loading buffer. The resulting samples were resolved by SDS-PAGE electrophoresis; gels were fixed, treated with Amplify (Amersham), and dried before exposure at -70°C.

Mouse spermatocytes staining
Mouse spermatocytes were prepared from 17- to 21-day-old C57BL/6 males (18) and stained with antibodies as described previously (19) . For double labeling, the following antibody combinations were used: polyclonal hMSH4 (made in rabbit) and SCP3 (made in goat) detected with anti-rabbit-FITC and anti-goat rhodamine, respectively (Jackson Labs, West Grove, Pa.). Triple labeling with hMSH4 (rabbit), monoclonal MLH1 (mouse), and SCP3 (goat) was followed by anti-rabbit-FITC, anti-mouse-Cy5, and anti-goat rhodamine, respectively (Jackson Labs). The cells were counterstained with 4',6' diamino-2-phenylindole (DAPI) (Sigma) and mounted in DABCO (Sigma) antifade solution. Image capture was on a Nikon Eclipse E800 Fluorescence microscope equipped with narrow band-pass filters and computer-assisted cooled CCD camera (Photometrics CH 350).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Overexpression of hMSH4 and hMLH1 fusion proteins
To test physical interaction between hMSH4 and hMLH1, we constructed vectors allowing the expression of the two proteins in bacteria. pTRC His-hMSH4 and pET 28-hMLH1 plasmids, encoding respectively hMSH4 and hMLH1 proteins carrying the T7.Tag sequence fused to their amino-terminal end, were introduced into the E. coli BL21 (DE3) host strain. To test overexpression of hMSH4 and hMLH1 proteins, whole lysates derived from induced bacteria transformed with individual plasmid or cotransformed with both plasmids were submitted to immunoblotting analysis. After transfer to filters, the proteins were probed with either anti-MSH4 polyclonal antibodies, the monoclonal antibody directed against hMLH1, or the anti-T7.Tag monoclonal antibody that recognized both hMSH4 and hMLH1 fusion proteins (Fig. 1 ). pTRC His-hMSH4 and pET 28-hMLH1 plasmids encoded polypeptides of appropriate size after bacterial induction (104 kDa for hMSH4 and 94 kDa for hMLH1).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Expression of fusion proteins in bacterial cells. E. coli BL21 (DE3) was transformed with either pTRC His-hMSH4 (A), pET 28-hMLH1 (B), or both (C). Whole-cell lysates from uninduced (-) or induced (+) bacteria were separated by electrophoresis on 8% acrylamide gel and transferred onto membranes for Western blotting analysis. Membranes were probed with either anti-MSH4 (A), anti-MLH1 (B), or anti-T7.Tag (C) antibodies. The position of standards in kDa is indicated. Solid arrows indicate the position of the induced fusion proteins. Polypeptides of expected size [hMSH4 (104 kDa) and hMLH1 (94 kDa)] were generated by pTRC His-hMSH4 and pET 28-hMLH1, respectively, and they cross-react with appropriate antibodies. In addition to the full-length protein, the anti-MLH1 antibody recognizes two major shorter products (B, open arrow). These polypeptides are probably the result of proteolysis of the amino-terminal end of hMLH1 protein, as they were not detected when T7.Tag antibody was used (C).

Coimmunoprecipitation of hMSH4 and hMLH1
For immunoprecipitation experiments, protein extracts containing both hMSH4 and hMLH1 fusion proteins were prepared by using a lysis procedure that included a denaturation step. These resulting lysates were incubated with anti-MSH4 antibodies or preimmune serum as control and immune complexes were adsorbed on protein A-Sepharose beads. The material retained from thoroughly washed beads was recovered by boiling in SDS-PAGE loading buffer, resolved by gel electrophoresis, and analyzed by Western blotting with either anti-T7.Tag or anti-MLH1 monoclonal antibodies (Fig. 2 ). Western blot analysis showed hMSH4 immunoprecipitation (Fig. 2A ). Furthermore, hMLH1 was found, in addition to hMSH4, in immunoprecipitates obtained by using anti-MSH4 antibodies whereas neither of these two proteins was observed when preimmune serum was used (Fig. 2A , 2B ). The anti-MSH4 antibodies did not precipitate hMLH1 in the absence of hMSH4 (Fig. 2C ). As extracts were treated with DNase I before incubation with antibodies, we can exclude the possibility that coimmunoprecipitation was due to individual affinity of proteins for DNA. Taken together, these results suggest a physical interaction between hMSH4 and hMLH1.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Coimmunoprecipitation of hMSH4 and hMLH1. Protein extracts containing either hMSH4 and hMLH1 fusion proteins (A, B) or hMLH1 alone (C) were prepared as described in Materials and Methods and incubated with either anti-MSH4 antibodies (lanes 1) or preimmune serum (lanes 2). After addition of protein A-Sepharose, immune complexes were recovered by centrifugation. Equal volumes of the immunoprecipitates were separated on an 8% SDS-PAGE gel, transferred onto nitrocellulose, and probed with either anti-T7.Tag antibody (A) or anti-MLH1 monoclonal antibody (B, C). Anti-MSH4 antibodies did not precipitate hMLH1 in the absence of hMSH4 (C). The arrows indicate the position of hMSH4, hMLH1, IgG, and hMLH1 proteolysis products (open arrow).

In an attempt to elucidate the first steps in the repair process, several studies have focused on biochemical interactions between the MutS and MutL homologs in yeast and human. A heterodimer of MutL homologs interacts with MutS homologs that are already bound to DNA (20 21 22) . This interaction requires the presence of ATP or ATP-{gamma}S (a nonhydrolyzable analog of ATP), most probably because ATP binding by MutS homologs induces conformational changes necessary for the interaction with MutL-like proteins. This observation led us to examine the effect of DNA and ATP on hMSH4-hMLH1 interaction. As shown in Figs. 2 and 3 , the coimmunoprecipitation of hMLH1 with hMSH4 is observed in the absence of both DNA and ATP. Furthermore, the addition of DNA (single- or double-stranded), ATP, or both in the reaction did not appear to modulate the formation of the hMSH4-hMLH1 complex (Fig. 3 ).



View larger version (82K):
[in this window]
[in a new window]
 
Figure 3. Neither ATP nor DNA modulate the formation of hMSH4-hMLH1 complex. Protein extracts containing hMSH4 and hMLH1 were treated with DNAse I (lanes 1, 2, 7, 8) or incubated in the presence of either 4 µg of single-stranded DNA (lanes 3, 4, 9, 10) or 4 µg of double-stranded DNA (lanes 5, 6, 11, 12). As indicated, ATP (1.5 mM) was added (right panels) or not (left panels) in the reactions. Extracts were then submitted to immunoprecipitations, which were performed with either anti-MSH4 antibodies (lanes 2, 4, 6, 8, 10, 12) or preimmune serum (lanes 1, 3, 5, 7, 9, 11). Resulting immunoprecipitates were analyzed by Western blotting and membranes were probed with either anti-T7.Tag (top panels) or anti-MLH1 (bottom panels) antibodies. Solid arrows indicate the position of hMSH4, hMLH1, and IgG. Open arrow indicates hMLH1 proteolysis products. ssDNA and dsDNA indicate single- and double-stranded DNA, respectively.

Identification of the hMSH4 interacting domain
To determine the hMSH4 region involved in binding hMLH1, we constructed plasmids allowing the expression of various hMSH4 deletion mutants (Fig. 4 ) as GST fusion proteins.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Schematic representation of the various hMSH4 deletion mutants expressed in E. coli BL21 (DE3) as GST fusion proteins. Truncated hMSH4 proteins ({Delta}1 to {Delta}5) were fused to the GST protein and the expected molecular mass of each resulting GST fusion polypeptide is indicated on the right. Beginning and ending hMSH4 amino acid residues of each mutant are indicated.

We first examined the interaction between hMLH1 and either the carboxyl-terminal domain of hMSH4 ({Delta}1 mutant, amino acid residues 675–936) or the amino-terminal region of hMSH4 ({Delta}2 mutant, amino acid residues 1–674) by using two procedures.

First, pET 28-hMLH1 plasmid encoding the hMLH1 fusion protein was introduced in E. coli BL21 (DE3) cells with either GST-hMSH4-{Delta}1 or GST-hMSH4-{Delta}2 deletion constructs. As a control, BL21 (DE3) cells were also cotransformed with the pET 28-hMLH1 vector and a pGEX vector that encodes GST protein (GST moiety only). Overexpression of the GST-hMSH4-{Delta}1 and {Delta}2 mutants was analyzed by Western blotting. Each deletion construct produced a polypeptide of expected size (Fig. 5A ). Protein extracts derived from bacteria that express either hMLH1 with one of the two GST-hMSH4 mutants, hMLH1 with GST or hMLH1 alone were prepared by using the same procedure as the one described in coimmunoprecipitation experiments. Equal amounts of the resulting lysates were incubated with glutathione S-Sepharose beads. The material retained by GST beads was analyzed by Western blotting using either anti-GST (Fig. 5A ) or anti-MLH1 (Fig. 5B ) antibodies. To verify that a nearly identical ratio of hMLH1 protein was present in each protein extract prior to incubation with GST beads, equal amounts of each lysate were submitted to Western blotting analysis by using anti-MLH1 antibody (Fig. 5C ).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Determination of the hMSH4 region involved in binding hMLH1. A, B) Equal amounts of protein extracts derived from induced bacterial cells doubly transformed with pET 28-hMLH1 and either GST-hMSH4-{Delta}1 or GST-hMSH4-{Delta}2 constructs were prepared as described in Materials and Methods and incubated with GST beads. Material retained on beads was resolved on 8% SDS-PAGE and analyzed by Western blotting. A) Filters were probed with anti-GST antibodies, which allowed us to visualize the various GST fusion proteins. GST fusion proteins {Delta}1 and {Delta}2 (lanes 1 and 2, respectively) exhibit the expected molecular size. B) Filters were incubated with the monoclonal antibody directed against hMLH1. hMLH1 protein was not precipitated with GST beads when it was expressed in bacteria with GST-hMSH4-{Delta}1 mutant (lane 1) but hMLH1 was present in precipitates obtained with GST-hMSH4-{Delta}2 mutant (lane 2). C) Equal amounts of protein extracts containing hMLH1 with either GST-hMSH4-{Delta}1 (lane 1) or GST-hMSH4-{Delta}2 (lane 2) were analyzed, prior to incubation with GST beads, by immunoblotting analysis with the anti-MLH1 antibody. Each extract contained a nearly identical ratio of hMLH1 protein. D) GST-hMSH4-{Delta}1 (lane 1), GST-hMSH4-{Delta}2 (lane 2), and GST (lane 3) extracted from induced bacteria were bound to GST beads and incubated with in vitro translated hMLH1 protein ([35S]L-methionine labeled). Material retained on GST beads was submitted to electrophoresis and analyzed by autoradiography. In vitro translated hMLH1 protein was precipitated with GST-hMSH4-{Delta}2 (lane 2) but did not appear to interact with either GST-hMSH4-{Delta}1 (lane 1) or GST protein (lane 3). Lane 4 corresponds to 10% of the in vitro translated hMLH1 protein used in each experiment.

Second, protein extracts derived from bacteria that express either GST-hMSH4-{Delta}1, GST-hMSH4-{Delta}2 or GST proteins were prepared by using a lysis procedure without the denaturation step. The lysates were incubated with glutathione S-Sepharose beads such that ~ 200 ng of GST fusion protein was bound to 50 µl of GST beads. Then in vitro translated hMLH1 protein was added to either GST-hMSH4-{Delta}1, GST-hMSH4-{Delta}2, or GST proteins fixed to beads. The resulting bound complexes were analyzed by electrophoresis, followed by autoradiography (Fig. 5D ).

By using two different procedures, we have demonstrated that the GST-hMSH4-{Delta}1 mutant corresponding to the carboxyl-terminal part of hMSH4 and containing an ATP binding site and a helix-turn-helix motif did not appear to interact with hMLH1 (Fig. 5B , 5D ). This result is consistent with the coimmunoprecipitation study, as neither DNA nor ATP was required for hMSH4-hMLH1 interaction. In contrast, hMLH1 significantly bound to GST-hMSH4-{Delta}2 deletion mutant (Fig. 5B , 5D ), suggesting that the interaction region is located between amino acids 1 and 674 of hMSH4. No binding of hMLH1 to glutathione Sepharose beads (data not shown) or to GST protein was observed (Fig. 5D ).

Further characterization of the hMSH4 interacting domain
The interaction region was further resolved by truncating the amino-terminal fragment of hMSH4. Protein extracts derived from bacteria that express hMLH1 with one of the GST-hMSH4-{Delta}3, {Delta}4, {Delta}5 deletion mutants or with GST as control were prepared by using the lysis procedure, including a denaturation step as described previously. Equal amounts of the various lysates were incubated with GST beads and material bound to beads was analyzed by Western blotting by using either anti-GST antibodies (Fig. 6A ) or the anti-MLH1 monoclonal antibody (Fig. 6B ). GST-hMSH4-{Delta}3, {Delta}4, {Delta}5 deletion constructs allow the production of proteins of expected size (Fig. 6A ). Amino acid residues 1–272 of hMSH4 ({Delta}5 mutant) appeared to be sufficient to bind hMLH1 protein (Fig. 6B ), suggesting that the most significant hMLH1 interaction region of hMSH4 is located within the first 272 amino residues of this protein. It is worth noting that the interaction with hMLH1 appeared to be reduced when one compares hMSH4 amino acid residues 1–433 ({Delta}3 mutant), 1–330 ({Delta}4 mutant), or 1–272 ({Delta}5 mutant) with hMSH4 amino acid residues 1–674 ({Delta}2 mutant) (Fig. 6B ). This reduction of interaction between hMLH1 and {Delta}3, {Delta}4 and {Delta}5 hMSH4 mutants has been observed in several independent experiments (data not shown). These results suggest that the interaction region of hMSH4 with hMLH1 may encompass the region located between amino residues 1 and 674.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Further characterization of the hMSH4 binding domain. A, B) Protein extracts obtained from induced bacterial cells cotransformed with pET 28-hMLH1 and either GST-hMSH4-{Delta}2, {Delta}3, {Delta}4, {Delta}5, or GST alone (as control) were incubated with GST beads; precipitated proteins were analyzed by Western blotting. A) Filters were probed with anti-GST antibodies. GST fusion protein {Delta}2, {Delta}3, {Delta}4, {Delta}5, and GST (lanes 1 to 5, respectively) exhibit the expected molecular size. B) Filters were incubated with the anti-MLH1 monoclonal antibody. hMLH1 protein was precipitated with {Delta}2, {Delta}3, {Delta}4, {Delta}5 hMSH4 mutants (lanes 1 to 4, respectively) and did not interact with GST protein (lane 5). Note that hMLH1 binding with {Delta}3, {Delta}4, {Delta}5 hMSH4 mutants appears to be reduced compared with hMLH1 binding with {Delta}2 mutant. C) Prior to incubation with GST beads, protein extracts containing hMLH1 with either {Delta}2, {Delta}3, {Delta}4, {Delta}5, or GST proteins were analyzed as described in Fig. 5C . Each extract contained nearly identical ratio of hMLH1 protein. The positions of standards in kDa are indicated. Solid head arrows and open head arrows indicate hMLH1 full-length protein and hMLH1 proteolysis products, respectively.

Colocalization of MSH4 and MLH1 on meiotic chromosomes
During leptonema of early meiotic prophase in mouse spermatocytes, axial elements, a component of the synaptonemal complex (SC) begin to form between the sister chromatids of each chromosome. SCP3 is a component of axial elements, and antibodies against SCP3 can be used to follow SC formation (23) . Synapsis of homologous chromosomes in mouse spermatocytes usually begins even before axial element formation is complete and involves alignment of homologues and formation of a central element and transverse filaments, additional components of the SC. When mouse spermatocytes are stained with the hMSH4 peptide antibody, MSH4 foci are not seen on asynapsed axial elements, but are found along the SC as soon as homologues begin to synapse during zygonema (Fig. 7A ). Completion of autosomal synapsis marks the transition to pachynema, the next stage of meiotic prophase. MSH4 remains at multiple sites along all the autosomal SCs during early pachynema, as identified by the staging criteria of Moses (24) (Fig. 7B ). As pachynema progresses, the number of MSH4 foci begins to drop, but the remaining foci exhibit a characteristic pattern. By around mid-pachynema, there are usually only 2–3 MSH4 foci per SC and one of these is often near one end of the SC (Fig. 7C ). Although the number of foci is greater, the pattern of localization near the distal (noncentromeric) end of the SC is reminiscent of that observed for MLH1, a protein shown to be involved in reciprocal recombination (12 , 16) . When we triple label spermatocytes with SCP3, MSH4, and MLH1, MSH4 is at its maximum in early pachynema, with no MLH1 foci present. By the early-mid pachytene transition, MLH1 foci begin to appear and rapidly reached their maximum number of 19–22 per nucleus. It is during this time that MLH1 exhibits maximum colocalization with MSH4 (Fig. 7E, F ). In this transient stage, colocalization of MSH4 and MLH1 foci is at its maximum, between 95 and 100% (9 nuclei). From this substage onward, the number of MSH4 foci decreases and the percent of colocalization drops first to 75–85% (11 nuclei), then to 40–50% (5 nuclei), and finally to 1–25% (45 nuclei). These changes in degree of colocalization reflect a continued loss of MSH4 signal as spermatocytes progress through pachynema. The remaining MSH4 signals continue to colocalize with MLH1. By mid-late pachynema, MSH4 foci totally disappear (Fig. 7D ), whereas MLH1 foci are gradually lost as spermatocytes progress through late pachynema (Fig. 8 ).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 7. MSH4 localization in spermatocytes. SCP3 is a component of the axial elements and is shown in white; MSH4 localization is shown in green. A) MSH4 localizes to sites along the SCs as soon as any portion of homologous chromosomes synapse. Arrow denotes a synaptic fork of an autosomal bivalent. Note MSH4 along the synapsed axis to the right of the arrow and the lack of MSH4 along the two asynapsed axes to the left of the arrow. B) In early pachynema (identified by the amount of synapsis between the X and Y chromosomes indicated by the arrow), MSH4 is present at multiple sites along the autosomal SCs. The X chromosome has no homologue in spermatocytes and there are no MSH4 foci along its asynapsed axis. However, there is a single large focus (arrow) at the base of the pairing region between the X and Y. C) By early to mid-pachytene transition, most of the MSH4 foci have disappeared, but note the MSH4 focus in the pseudoautosomal region at the base of the XY (arrow), the site of an obligatory crossover between the X and Y chromosomes. D) By late pachynema, all MSH4 foci have disappeared. E, F) Colocalization of MSH4 (green foci in panel E) and MLH1 (red foci in panel F). One site of colocalization is indicated by the arrowhead. XY bivalent indicated by arrow.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 8. A schematic representation of dynamic changes in the number of MSH4 and MLH1 foci associated with the SCs, as determined by a immunolocalization study.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ross-Macdonald and Roeder (2) suggested that in yeast MSH4 may recognize DNA substrates such as Holliday junctions. They proposed that its role may be the stabilization of these recombination intermediates and/or their resolution. In yeast and mammals, MLH1 is involved in the process of crossing over (11 12 13 14 15) . Consistent with these results, we have observed that MSH4 and MLH1 physically interact and colocalize at a discrete subset of foci in meiotic prophase of mammals, at the time when recombination is occurring. Our results provide further evidence that these two proteins function together in vivo during meiosis, most probably in a common pathway to promote crossing over.

In addition, we have found that MSH4 does not need to be bound to DNA in order to form a complex with hMLH1 and that this interaction does not require the binding or the hydrolysis of ATP. Consistent with these observations, we have demonstrated that the region of MSH4 involved in the interaction with MLH1 is located in the amino-terminal part of the protein, whereas the NTP binding and putative helix-turn-helix domains are in the carboxyl-terminal region. These results indicate that steps essential for the assembly of a complex between other MutS and MutL homologs in mismatch DNA repair (21 , 22) are not required for the interaction between MSH4 and MLH1 during meiosis. In particular, MSH2, unlike MSH4, needs to be bound to DNA prior to interaction with MLH1 (20 , 21) . Since MSH4 acts in a separate process from MSH2, MSH3, and MSH6, it is of interest to determine the particular attributes of this protein contributing to its functional specificity. It has been suggested that MSH4 recognizes different DNA substrates compared to the mismatch repair MSH proteins (2) . Alternatively, MSH4 may bind to a similar set of DNA substrates but act to recruit different downstream proteins. Here we have shown that MSH4 acts differently from DNA repair MSH proteins to form a complex with MLH1. Consequently, we suggest that this difference also contributes to the functional specificity of MSH4. Based on the conservation of the adenine nucleotide binding and hydrolysis domain (3) , it is likely that MSH4 exhibits ATP binding and hydrolytic activity. However, how these activities contribute to MSH4 function in meiotic recombination remains to be determined. In vivo, additional factors are likely to interact with MSH4 and MLH1 in the reciprocal recombination process. The recruitment of one or more of these proteins can be expected to require ATP binding and/or hydrolytic activity of MSH4. Alternatively, ATP binding and/or ATPase activity may be necessary for the binding of MSH4 to its DNA substrates. The importance of these activities for MSH4 function is supported by the fact that mutations in the conserved ATP binding domain of MSH5 in yeast (a protein that is definitely recruited to MSH4) create null alleles (5) .

The combination of knockout mice and immunolocalization studies is helping to define the role of MutS and MutL homologs in mammalian meiosis. Null mutation of the Msh2 gene have no effect on the fertility of male or female inbred mice (25) , suggesting that in meiosis MSH2 might be replaced by another protein of the MutS family. Mice carrying a disruption in Msh5 show a defect in chromosome synapsis (9 , 10) . Here we have shown that the time of expression of MSH4 and its localization along synapsed axes of zygotene and early pachytene spermatocytes make MSH4 the likely MutS partner for MSH5 during chromosome synapsis. Further studies will be necessary to determine whether chromosome synapsis requires an interaction between a MSH4-MSH5 heterodimer and MutL-like proteins. Unlike MLH1, which is not expressed at this step of meiosis, PMS2 is a good candidate for a MutL-like synaptic protein since synapsis and SC organization is disrupted in male mice deficient for this protein (26) . As the MutL homologs likewise function as heterodimeric pairs, the second component of the MutL synaptic heterodimer remains to be identified.

We have also shown that MSH4 acts later in pachynema and that it colocalizes with MLH1. In MLH1-deficient mice, meiotic failure is associated with an almost total absence of chiasmata (12) . Chiasmata represent the physical manifestation of crossover events. MLH1 foci are localized to chiasma sites during diplotene in wild-type mouse oocytes (12) . All together, these results suggest that MLH1 plays a role in reciprocal recombination. Furthermore, the number and positions of autosomal MLH1 foci in human spermatocytes are similar to those of autosomal chiasma (15) . Barlow and Hultén (15) confirmed that anti-MLH1 labeling is a tool to detect crossing over sites during pachynema. The interaction between MSH4 and MLH1 associated with their colocalization on meiotic chromosomes during early-mid pachynema suggests that these two proteins act in conjunction, probably in meiotic recombination process. Since msh5 -/- mice fail to synapse (9 , 10) , it is not yet known whether MSH5 also acts in crossover events. Likewise, it remains unclear whether PMS2 or an other MutL homologue is the second member of a MutL recombinational heterodimer. The dual roles of MSH4, first without and then with MLH1, emphasize the separation of mammalian synaptic and recombination events. Only the identification of all MSH and MLH partners acting in synapsis and recombination will afford an understanding of the molecular mechanisms involved in these two critical steps of mammalian meiosis.


   ACKNOWLEDGMENTS
 
We are indebted to F. Vidal, J. C. Simeca, and G. Carle for reading the manuscript and to B. Ferrua for help in antibodies purification. This work was made possible by grants from the Association pour la Recherche sur le Cancer and the Ligue contre le Cancer to V. P-F. and by grants from National Institutes of Health (GM47797 and GM55300) to T.A.


   FOOTNOTES
 
1 S.S.D and D.W contributed equally to this study.

Received for publication September 22, 1999. Revision received January 31, 2000.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Fishel, R., Wilson, T. (1997) MutS homologs in mammalian cells. Curr. Opin. Genet. Dev. 7,105-113[Medline]
  2. Ross-Macdonald, P., Roeder, G. S. (1994) Mutation of a meiosis-specific MutS homolog decreases crossing over but not mismatch correction. Cell 79,1069-1080[Medline]
  3. Paquis-Flucklinger, V., Santucci-Darmanin, S., Paul, R., Sauni res, A., Turc-Carel, C., Desnuelle, C. (1997) Cloning and expression analysis of a meiosis-specific MutS homolog: the human MSH4 gene. Genomics 44,188-194[Medline]
  4. Santucci-Darmanin, S., Paul, R., Sauni res, A., Desnuelle, C., Paquis-Flucklinger, V. (1999) Alternative splicing of hMSH4: two isoforms in testis and abnormal transcripts in somatic tissues. Mammalian Genome 10,423-427
  5. Pochart, P., Woltering, D., Hollingworth, N. M. (1997) Conserved properties between functionally distinct MutS homologs in yeast. J. Biol. Chem. 272,30345-30349[Abstract/Free Full Text]
  6. Winand, N. J., Panzer, J. A., Kolodner, R. D. (1998) Cloning and characterization of the human and Caenorhabditis elegans homologs of the Saccharomyces cerevisiae MSH5 gene. Genomics 53,69-80[Medline]
  7. Brocker, T. A., Barusevicius, A., Snowden, T., Rasio, D., Guerrette, S., Robbins, D., Schmidt, C., Burczak, J., Croce, C. M., Copeland, T., Kovatich, A. J., Fishel, R. (1999) hMSH5: a human MutS homologue that forms a novel heterodimer with hMSH4 and is expressed during spermatogenesis. Cancer Res 59,816-822[Abstract/Free Full Text]
  8. Hollingworth, N. M., Ponte, L., Halsey, C. (1995) MSH5, a novel MutS homolog, facilitates meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae but not mismatch repair. Genes Dev 9,1728-1739[Abstract/Free Full Text]
  9. de Vries, S. S., Bart, E. B., Dekker, M., Siezen, A., de Rooij, D. G., de Boer, P., te Riele, H. (1999) Mouse MutS-like protein Msh5 is required for proper chromosome synapsis in male and female meiosis. Genes Dev 13,523-531[Abstract/Free Full Text]
  10. Edelmann, W., Cohen, P. E., Kneitz, B., Winand, N., Lia, M., Heyer, J., Kolodner, R., Pollard, J. W., Kucherlapati, R. (1999) Mammalian MutS homologue 5 is required for chromosome pairing in meiosis. Nat. Genet. 21,123-127[Medline]
  11. Hunter, N., Borts, R. (1997) Mlh1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev 11,1573-1582[Abstract/Free Full Text]
  12. Baker, S. M., Plug, A. W., Prolla, T. A., Bronner, C. E., Harris, A. C., Yao, X., Christie, D. M., Monell, C., Arnheim, N., Bradley, A., Ashley, T., Liskay, R. M. (1996) Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over. Nat. Genet. 13,336-342[Medline]
  13. Edelmann, W., Cohen, P. E., Kane, M., Lau, K., Morrow, B., Bennett, S., Umar, A., Kunkel, T., Cattoretti, G., Chaganti, R., Pollard, J. W., Kolodner, R. D., Kucherlapati, R. (1996) Meiotic pachytene arrest in MLH1-deficient mice. Cell 85,1125-1134[Medline]
  14. Woods, L. M., Hodges, C. A., Baart, E., Baker, S. M., Liskay, M., Hunt, P. A. (1999) Chromosomal influence on meiotic spindle assembly: abnormal meiosis I in female Mlh1 mutant mice. J. Cell Biol. 145,1395-1406[Abstract/Free Full Text]
  15. Barlow, A. L., Hultén, M. A. (1998) Crossing over analysis at pachytene in man. Eur. J. Hum. Genet. 6,350-358[Medline]
  16. Anderson, L. K., Reeves, A., Webb, L. M., Ashley, T. (1999) Distribution of crossovers on mouse chromosomes using immunofluorescent localization of MLH1 protein. Genetics 151,1569-1579[Abstract/Free Full Text]
  17. Guerrette, S., Acharya, S., Fishel, R. (1999) The interaction of the human MutL homologs in hereditary nonpolyposis colon cancer. J. Biol. Chem. 274,6336-6341[Abstract/Free Full Text]
  18. Peters, A. H. F. M., Plug, A. W., van Vugt, M. J., de Boer, P. (1997) A drying-down technique for spreading of mammalian meiocytes from the male and the female germ line. Chromosome Res 5,66-71[Medline]
  19. Ashley, T., Plug, A. W., Xu, J., Solari, A. J., Reddy, G., Golub, E. I., Ward, D. C. (1995) Dynamic changes in RAD51 distribution on chromatin during meiosis in male and female vertebrates. Chromosoma 104,19-28[Medline]
  20. Prolla, T. A., Pang, Q., Alani, E., Kolodner, R. D., Liskay, R. M. (1994) MLH1, PMS1, and MSH2 interactions during the initiation of DNA mismatch repair in yeast. Science 265,1091-1093[Abstract/Free Full Text]
  21. Gu, L., Hong, Y., McCulloch, S., Watanabe, H., Li, G. M. (1998) ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair. Nucleic Acids Res 26,1173-1178[Abstract/Free Full Text]
  22. Habraken, Y., Sung, P., Prakas, L., Prakas, S. (1998) ATP-dependent assembly of a ternary complex consisting of a DNA mismatch and the yeast MSH2-MSH6 and MLH1-PMS1 protein complexes. J. Biol. Chem. 273,9837-9841[Abstract/Free Full Text]
  23. Lammers, J. H. M., Offenberg, H. H., van Aalderen, M., Vink, A. C. G., Dietrich, A. J. J., Heyting, C. (1994) The gene encoding a major component of the lateral element of the synaptonemal complex of the rat is related to X-linked lymphocyte-regulated genes. Mol. Cell. Biol. 14,1137-1146[Abstract/Free Full Text]
  24. Moses, M. J. (1980) New cytogenetics studies on mammalian meiosis. Serio, M. Martini, L. eds. Animal Models of Human Reproduction ,169-190 Raven Press New York, N.Y..
  25. Reitmar, A. H., Schmits, R., Ewel, A., Bapat, B., Redston, M., Mitri, A., Waterhouse, P., Mittrücker, H. W., Wakeham, A., Liu, B., Thomason, A., Griesser, H., Gallinger, S., Ballahusen, W. G., Fishel, R., Mak, T. W. (1995) MSH2 deficient mice are viable and susceptible to lymphoid tumours. Nat. Genet. 11,64-70[Medline]
  26. Baker, S. M., Bronner, C. E., Zhang, I., Plug, A. W., Robatzek, M., Warren, G., Elliot, E. A., Yu, E., Ashley, T., Arnheim, N., Flavell, R. A., Liskay, R. M. (1995) Male mice defective in the DNA mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis. Cell 82,309-316[Medline]



This article has been cited by other articles:


Home page
GeneticsHome page
A. Svetlanov, F. Baudat, P. E. Cohen, and B. de Massy
Distinct Functions of MLH3 at Recombination Hot Spots in the Mouse
Genetics, April 1, 2008; 178(4): 1937 - 1945.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Kan, X. Sun, N. K. Kolas, E. Avdievich, B. Kneitz, W. Edelmann, and P. E. Cohen
Comparative Analysis of Meiotic Progression in Female Mice Bearing Mutations in Genes of the DNA Mismatch Repair Pathway
Biol Reprod, March 1, 2008; 78(3): 462 - 471.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. de Boer, P. Stam, A. J. J. Dietrich, A. Pastink, and C. Heyting
Two levels of interference in mouse meiotic recombination
PNAS, June 20, 2006; 103(25): 9607 - 9612.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
P. E. Cohen, S. E. Pollack, and J. W. Pollard
Genetic Analysis of Chromosome Pairing, Recombination, and Cell Cycle Control during First Meiotic Prophase in Mammals
Endocr. Rev., June 1, 2006; 27(4): 398 - 426.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
N. K. Kolas, A. Svetlanov, M. L. Lenzi, F. P. Macaluso, S. M. Lipkin, R. M. Liskay, J. Greally, W. Edelmann, and P. E. Cohen
Localization of MMR proteins on meiotic chromosomes in mice indicates distinct functions during prophase I
J. Cell Biol., November 7, 2005; 171(3): 447 - 458.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Oliver-Bonet, P.J. Turek, F. Sun, E. Ko, and R.H. Martin
Temporal progression of recombination in human males
Mol. Hum. Reprod., July 1, 2005; 11(7): 517 - 522.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
F. A.T. de Vries, E. de Boer, M. van den Bosch, W. M. Baarends, M. Ooms, L. Yuan, J.-G. Liu, A. A. van Zeeland, C. Heyting, and A. Pastink
Mouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation
Genes & Dev., June 1, 2005; 19(11): 1376 - 1389.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. L. Argueso, J. Wanat, Z. Gemici, and E. Alani
Competing Crossover Pathways Act During Meiosis in Saccharomyces cerevisiae
Genetics, December 1, 2004; 168(4): 1805 - 1816.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Neyton, F. Lespinasse, P. B. Moens, R. Paul, P. Gaudray, V. Paquis-Flucklinger, and S. Santucci-Darmanin
Association between MSH4 (MutS homologue 4) and the DNA strand-exchange RAD51 and DMC1 proteins during mammalian meiosis
Mol. Hum. Reprod., December 1, 2004; 10(12): 917 - 924.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
F. W. Stahl, H. M. Foss, L. S. Young, R. H. Borts, M. F. F. Abdullah, and G. P. Copenhaver
Does Crossover Interference Count in Saccharomyces cerevisiae?
Genetics, September 1, 2004; 168(1): 35 - 48.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Her, X. Wu, M. D. Griswold, and F. Zhou
Human MutS Homologue MSH4 Physically Interacts with von Hippel-Lindau Tumor Suppressor-binding Protein 1
Cancer Res., February 15, 2003; 63(4): 865 - 872.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. L. Argueso, A. W. Kijas, S. Sarin, J. Heck, M. Waase, and E. Alani
Systematic Mutagenesis of the Saccharomyces cerevisiae MLH1 Gene Reveals Distinct Roles for Mlh1p in Meiotic Crossing Over and in Vegetative and Meiotic Mismatch Repair
Mol. Cell. Biol., February 1, 2003; 23(3): 873 - 886.
[Abstract] [Full Text]


Home page
GeneticsHome page
E. R. Hoffmann, P. V. Shcherbakova, T. A. Kunkel, and R. H. Borts
MLH1 Mutations Differentially Affect Meiotic Functions in Saccharomyces cerevisiae
Genetics, February 1, 2003; 163(2): 515 - 526.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Santucci-Darmanin, S. Neyton, F. Lespinasse, A. Saunieres, P. Gaudray, and V. Paquis-Flucklinger
The DNA mismatch-repair MLH3 protein interacts with MSH4 in meiotic cells, supporting a role for this MutL homolog in mammalian meiotic recombination
Hum. Mol. Genet., July 15, 2002; 11(15): 1697 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. B. Moens, N. K. Kolas, M. Tarsounas, E. Marcon, P. E. Cohen, and B. Spyropoulos
The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination
J. Cell Sci., April 15, 2002; 115(8): 1611 - 1622.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. K. Anderson, K. D. Hooker, and S. M. Stack
The Distribution of Early Recombination Nodules on Zygotene Bivalents From Plants
Genetics, November 1, 2001; 159(3): 1259 - 1269.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Pelttari, M.-R. Hoja, L. Yuan, J.-G. Liu, E. Brundell, P. Moens, S. Santucci-Darmanin, R. Jessberger, J. L. Barbero, C. Heyting, et al.
A Meiotic Chromosomal Core Consisting of Cohesin Complex Proteins Recruits DNA Recombination Proteins and Promotes Synapsis in the Absence of an Axial Element in Mammalian Meiotic Cells
Mol. Cell. Biol., August 15, 2001; 21(16): 5667 - 5677.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SANTUCCI-DARMANIN, S.
Right arrow Articles by PAQUIS-FLUCKLINGER, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SANTUCCI-DARMANIN, S.
Right arrow Articles by PAQUIS-FLUCKLINGER, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS