|
|
||||||||
,1
* Laboratoire de Neurobiologie Cellulaire, UMR CNRS/UNSA 6549, Faculté de Médecine, 06107 Nice cédex 2, France; and
Department of Genetics, Yale University School of Medicine, New Haven, Connecticut 06510, USA
2Correspondence: Laboratoire de Neurobiologie Cellulaire, UMR CNRS/UNSA 6549, Faculté de Médecine, Avenue de Valombrose, 06107 Nice cédex 2, France. E-mail: paquis{at}unice.fr
| ABSTRACT |
|---|
|
|
|---|
Key Words: MSH proteins MLH proteins protein interaction synapsis meiotic recombination mismatch DNA repair
| INTRODUCTION |
|---|
|
|
|---|
As a step toward understanding the biological function of MSH4 during
mammalian meiosis, we decided to determine whether this protein
interacts with other proteins involved in meiotic recombination.
Different features led us to search for an interaction between hMSH4
and hMLH1. First, MLH1 interacts with MSH proteins in DNA mismatch
repair (1)
. Second, the involvement of MLH1 during meiosis
has been demonstrated in yeast (11)
and in mammals
(12
13
14)
. This protein localizes to sites of crossing over
on meiotic chromosomes (12
, 15
, 16)
and
MLH1-deficient mice are sterile. In these mice, meiotic
failure is associated with greatly reduced levels of chiasmata,
suggesting a critical role for MLH1 in reciprocal recombination.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructions
To construct plasmid encoding hMSH4 fusion protein (pTRC
His-hMSH4), the entire hMSH4 cDNA was inserted in the correct reading
frame into the KpnI site of pTRC His b vector (Invitrogen,
San Diego, Calif.). A plasmid for the production of hMLH1 fusion
protein (pET 28-hMLH1) was generated as follows: hMLH1 cDNA was ligated
in-frame into the XhoI site of pET 28 b vector
(Novagen). pTRC His-hMSH4 and pET 28-hMLH1 vectors express respectively
hMSH4 and hMLH1 fusion proteins, both carrying to their amino-terminal
end the 11 amino acid T7.Tag sequence. This sequence allows the
detection of hMSH4 and hMLH1 fusion proteins by using an anti-T7.Tag
monoclonal antibody. For the expression of various hMSH4 mutants as
glutathione S-transferase (GST) fusion proteins, plasmids were
generated as follows. To amplify specific regions of hMSH4
cDNA, polymerase chain reactions were performed by using
oligonucleotides primers containing a terminal restriction site for
subsequent subcloning. Resulting amplified products were digested with
the correct enzyme and ligated in-frame into the corresponding restriction site of the pGEX-5X-2 vector (Pharmacia, Piscataway, N.J.).
The cDNA inserts were confirmed to be free of mutations by DNA
sequencing. The primer pairs used to generate the various deletion
mutants were as follows. GST-hMSH4-
1: sense 5'
GGAATTCATTTTTTGATCATAACTGGACCA 3', reverse 5'
GGAATTCTTATTCTTCAGTCTTTTCTGGA 3'; GST-hMSH4-
2: sense
5' TCCCCCGGGATGCTGAGGCCTGAGATCT 3', reverse 5'
TCCCCCGGGTCAATTACTCCCTTCTGTAAC 3'; GST-hMSH4-
3: sense 5'
GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse 5'
GCGGATCCACAAGTTCCAAGGTATGTTT 3'; GST-hMSH4-
4: sense 5'
GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse: 5'
TCCCCCGGGCCTATAGTCTTGATTATT 3'; GST-hMSH4-
5: sense 5'
GCGGATCCGGATGCTGAGGCCTGAGAT 3', reverse 5'
TCCCCCGGGCTTGGACTGAACCTCCAT 3'. Restriction sites present in
the oligonucleotides are italicized. For GST-hMSH4-
1,
GST-hMSH4-
2, and GST-hMSH4-
3 constructs, cDNA inserts were
ligated respectively into EcoRI, SmaI and
BamHI restriction sites of the pGEX-5X-2 vector. cDNAs
insert present in either GST-hMSH4-
4 or GST-hMSH4-
5 were cloned
between BamHI and SmaI sites of the pGEX-5X-2
vector.
In vitro translation
The pET 28-hMLH1 plasmid was added to coupled
transcription-translation rabbit reticulocytes lysates (Promega,
Madison, Wis.) with [35S]L-methionine
(Amersham), according to the manufacturers instructions.
Expression of recombinant proteins
E. coli BL21 (DE3) host strain was used for
expression of the various recombinant proteins. For coexpression of the
hMLH1 protein with either full-length or truncated hMSH4 proteins, BL21
(DE3) cells were transformed simultaneously with pET 28-hMLH1 and
either pTRC His-hMSH4 or one of the pGEX-hMSH4 constructs described
above. The resulting transformants were selected on LB plates
containing ampicillin and kanamycin. Fresh overnight cultures of
transformed BL21 (DE3) were diluted 1 in 100 with LB medium containing
appropriate antibiotics. After growth at 37°C to an
A600 of 0.6, each culture was induced by adding 1
mM-IPTG (isopropyl-1-thio-ß-D galactopyranoside) for 3 h.
Induced cells were collected by centrifugation at 4°C, frozen in
liquid nitrogen, and stored at -80°C for further extraction (see
below). To analyze expression of fusion proteins, 2 ml of induced
cultures was used to make whole-cell lysates. Cells were harvested by
centrifugation at 4°C and the pellet was resuspended directly in 200
µl of sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) loading buffer and incubated at 95°C for 3 min. Resulting
protein samples were separated on SDS-8% polyacrylamide gels and
analyzed by Western blotting as follows. After electrophoresis,
proteins were electrotransferred onto Hybond-C extra filters
(Amersham). The filters were incubated overnight in TBS-T buffer
(Tris-buffered saline and 0.05% polyoxyethylene sorbitan monolaurate)
containing 3% bovine serum albumin (BSA fraction V, Sigma, St. Louis,
Mo.). Then the filters were incubated for 1 h with appropriate
antibodies. GP3 polyclonal antibodies (1:2000 dilution) and the
monoclonal Ab-1 antibody (1:100) were used to detect respectively the
full-length hMSH4 fusion protein and the hMLH1 fusion protein. The
monoclonal anti-T7.Tag antibody (1:5000 dilution) allowed detection of
both hMSH4 and hMLH1 fusion proteins; polyclonal anti-GST antibodies
(1:2000 dilution) were used to visualize the various GST-hMSH4 deletion
mutants. After extensive washing in TBS-T buffer, the filters were
incubated for 45 min with appropriate secondary antibodies conjugated
to horseradish peroxidase. The filters were washed again with TBS-T
buffer prior to detection of signal by using ECL chemiluminescent
detection system (Amersham).
Coimmunoprecipitation of hMSH4 and hMLH1 recombinant proteins
When induced bacterial cells transformed with either pTRC
His-hMSH4 or pET 28-hMLH1 were lysed by sonication or lysozyme
treatment, we observed that hMSH4 is mostly soluble, whereas a large
proportion of hMLH1 is present in the insoluble fraction. When the two
proteins are generated in the same bacterial cells, hMSH4 becomes
partially insoluble, as was hMLH1. Therefore, proteins extracts derived
from BL21(DE3) cells doubly transformed with pTRC His-hMSH4 and pET
28-hMLH1 plasmids were made by using a denaturing lysis procedure in
order to release most of the hMSH4 and hMLH1 fusion proteins. For this
purpose, frozen pellets of induced bacterial cells prepared as
described above were resuspending in denaturing buffer (50 mM Tris-HCl,
pH 7.5, 8 M urea, 1 vol. buffer per 10 vol bacterial culture) and
incubated on ice for 30 min. After sonication, the lysate was submitted
to centrifugation at 10,000 g for 30 min at 4°C. To allow
protein renaturation and refolding, 250 µl aliquots of the resulting
supernatant were diluted progressively (20x) in ice-cold buffer A: 25
mM Tris-HCl, pH 7.5, 100 mM KCl, 5 mM MgCl2, 5 mM
DTT, 10% glycerol, 2% BSA with complete EDTA-free protease inhibitor
cocktail (Boehringer Mannheim, Mannheim, Germany) and in the presence
or absence of 1.5 mM ATP. The resulting 5 ml diluted supernatant was
incubated either with DNase I (Boehringer Mannheim) for 30 min at
25°C or in the presence of 4 µg DNA (double- or single-stranded)
for 30 min at 4°C. Then immunoprecipitation was performed by
incubating, for 1 h on ice, the diluted lysate with 20 µl of
hMSH4 anti-peptide serum (GP3) or with 20 µl of the corresponding
preimmune serum. 50 µl of a 50% slurry of protein A-Sepharose beads
(Pharmacia Biotech, Brussels, Belgium), preequilibrated in buffer A,
was added and the reaction was incubated for 1 h at 4°C with
gentle rocking. Immunoprecipitates were recovered by centrifugation and
washed twice with buffer B (50 mM Tris-HCl, pH 8, 150 mM NaCl, 1%
Nonidet P-40, 0.1% SDS, 1 mM DTT, 1 mM PMSF) and once with buffer B
adjusted to 1 M NaCl. The washed beads were resuspended with 25 µl of
SDS-PAGE loading buffer and boiled for 3 min. Resulting protein samples
were separated on SDS-8% polyacrylamide gel and electrotransferred
onto filters for Western blotting analysis. The filters were blotted
with either anti-hMSH4 polyclonal antibodies (GP3), the monoclonal
antibody recognizing hMLH1 (Ab-1), or the monoclonal antibody directed
against the T7.Tag sequence.
GST fusion protein interaction assay
Induced bacterial cells that express the T7.Tag-hMLH1 fusion
protein with one of the GST-hMSH4 deletion mutants (GST-hMSH4-
1,
2,
3,
4, or
5) were used to prepare lysates, as described
above, by using denaturing conditions, followed by 20x dilution in
buffer A. Then 100 µl of a 50% slurry of glutathione S-Sepharose
beads (GST beads) preequilibrated in buffer A was added to 10 ml of
diluted lysates. After an incubation of 2 h at 4°C with gentle
rocking, the GST beads were collected by centrifugation at 1000 rpm for
30 s, the supernatant was removed, and the beads were washed as
described above for protein A-Sepharose beads. The washed beads were
resuspended with 50 µl of SDS-PAGE loading buffer, boiled for 3 min,
and spun at 1000 rpm for 30 s; 25 µl of the resulting
supernatant was loaded on a SDS-8% polyacrylamide gel and analyzed by
Western blotting. Filters were probed with either anti-GST antibodies
in order to detect the various GST-hMSH4 deletion mutants or the
anti-MLH1 monoclonal antibody (Ab-1).
GST fusion protein interaction assay with in vitro
translated hMLH1 protein
GST fusion protein interaction assay was also performed by using
GST-hMSH4 deletion mutants (
1,
2) expressed in E. coli
and in in vitro transcribed and translated hMLH1 protein.
This interaction assay was essentially as described by Guerrette and
colleagues (17)
with some modifications. Frozen pellets of
induced E. coli BL21 (DE3) cells that express either
GST-hMSH4-
1, GST-hMSH4-
2, or GST proteins were resuspended in
lysis buffer C: 20 mM Tris-HCl, pH 8, 500 mM NaCl, 1% Nonidet P40,
10% glycerol, 5 mM DTT with complete EDTA free proteases inhibitor
cocktail (1 vol buffer per 10 vol bacterial culture). Lysozyme was
added to a concentration of 1 mg/ml and left on ice for 30 min. Lysates
were submitted to sonication, followed by centrifugation at 10,000
g for 30 min at 4°C. Resulting supernatants were incubated
with DNase I (20 µg/ml) for 30 min at 25°C. Then GST beads
preequilibrated in buffer C plus 2% BSA were added to lysates such
that ~ 200 ng of GST fusion proteins were bound to 50 µl of
beads. After an incubation of 2 h at 4°C, the GST beads were
washed as described previously. The binding reaction was then performed
with 50 µl of beads and 15 µl of in vitro translated
hMLH1 in 1 ml of binding buffer D: 20 mM Tris-HCl, pH 8, 150 mM NaCl,
0.1% Nonidet P40, 10% glycerol, 0.75 mg/ml BSA, 5 mM EDTA, 2 mM DTT
with complete EDTA free proteases inhibitor cocktail. After 1 h of
incubation at 4°C, the bound complexes were sedimented and washed
four times in binding buffer D. The beads were resuspended in 50 µl
of SDS-PAGE loading buffer. The resulting samples were resolved by
SDS-PAGE electrophoresis; gels were fixed, treated with Amplify
(Amersham), and dried before exposure at -70°C.
Mouse spermatocytes staining
Mouse spermatocytes were prepared from 17- to 21-day-old C57BL/6
males (18)
and stained with antibodies as described
previously (19)
. For double labeling, the following
antibody combinations were used: polyclonal hMSH4 (made in rabbit) and
SCP3 (made in goat) detected with anti-rabbit-FITC and anti-goat
rhodamine, respectively (Jackson Labs, West Grove, Pa.). Triple
labeling with hMSH4 (rabbit), monoclonal MLH1 (mouse), and SCP3 (goat)
was followed by anti-rabbit-FITC, anti-mouse-Cy5, and anti-goat
rhodamine, respectively (Jackson Labs). The cells were counterstained
with 4',6' diamino-2-phenylindole (DAPI) (Sigma) and mounted in DABCO
(Sigma) antifade solution. Image capture was on a Nikon Eclipse E800
Fluorescence microscope equipped with narrow band-pass filters and
computer-assisted cooled CCD camera (Photometrics CH 350).
| RESULTS |
|---|
|
|
|---|
|
Coimmunoprecipitation of hMSH4 and hMLH1
For immunoprecipitation experiments, protein extracts containing
both hMSH4 and hMLH1 fusion proteins were prepared by using a lysis
procedure that included a denaturation step. These resulting lysates
were incubated with anti-MSH4 antibodies or preimmune serum as control
and immune complexes were adsorbed on protein A-Sepharose beads. The
material retained from thoroughly washed beads was recovered by boiling
in SDS-PAGE loading buffer, resolved by gel electrophoresis, and
analyzed by Western blotting with either anti-T7.Tag or anti-MLH1
monoclonal antibodies (Fig. 2
). Western blot analysis showed hMSH4 immunoprecipitation (Fig. 2A
). Furthermore, hMLH1 was found, in addition to hMSH4, in
immunoprecipitates obtained by using anti-MSH4 antibodies whereas
neither of these two proteins was observed when preimmune serum was
used (Fig. 2A
, 2B
). The anti-MSH4 antibodies did
not precipitate hMLH1 in the absence of hMSH4 (Fig. 2C
). As
extracts were treated with DNase I before incubation with antibodies,
we can exclude the possibility that coimmunoprecipitation was due to
individual affinity of proteins for DNA. Taken together, these results
suggest a physical interaction between hMSH4 and hMLH1.
|
In an attempt to elucidate the first steps in the repair process,
several studies have focused on biochemical interactions between the
MutS and MutL homologs in yeast and human. A heterodimer of MutL
homologs interacts with MutS homologs that are already bound to DNA
(20
21
22)
. This interaction requires the presence of ATP or
ATP-
S (a nonhydrolyzable analog of ATP), most probably because ATP
binding by MutS homologs induces conformational changes necessary for
the interaction with MutL-like proteins. This observation led us to
examine the effect of DNA and ATP on hMSH4-hMLH1 interaction. As shown
in Figs. 2
and 3
, the coimmunoprecipitation of hMLH1 with hMSH4 is
observed in the absence of both DNA and ATP. Furthermore, the addition
of DNA (single- or double-stranded), ATP, or both in the reaction did
not appear to modulate the formation of the hMSH4-hMLH1 complex
(Fig. 3
).
|
Identification of the hMSH4 interacting domain
To determine the hMSH4 region involved in binding hMLH1, we
constructed plasmids allowing the expression of various hMSH4 deletion
mutants (Fig. 4
) as GST fusion proteins.
|
We first examined the interaction between hMLH1 and either the
carboxyl-terminal domain of hMSH4 (
1 mutant, amino acid residues
675936) or the amino-terminal region of hMSH4 (
2 mutant, amino
acid residues 1674) by using two procedures.
First, pET 28-hMLH1 plasmid encoding the hMLH1 fusion protein was
introduced in E. coli BL21 (DE3) cells with either
GST-hMSH4-
1 or GST-hMSH4-
2 deletion constructs. As a control,
BL21 (DE3) cells were also cotransformed with the pET 28-hMLH1 vector
and a pGEX vector that encodes GST protein (GST moiety only).
Overexpression of the GST-hMSH4-
1 and
2 mutants was analyzed by
Western blotting. Each deletion construct produced a polypeptide
of expected size (Fig. 5A
). Protein extracts derived from bacteria that express
either hMLH1 with one of the two GST-hMSH4 mutants, hMLH1 with GST or
hMLH1 alone were prepared by using the same procedure as the one
described in coimmunoprecipitation experiments. Equal amounts of the
resulting lysates were incubated with glutathione S-Sepharose beads.
The material retained by GST beads was analyzed by Western blotting
using either anti-GST (Fig. 5A
) or anti-MLH1 (Fig. 5B
) antibodies. To verify that a nearly identical ratio of
hMLH1 protein was present in each protein extract prior to incubation
with GST beads, equal amounts of each lysate were submitted to Western
blotting analysis by using anti-MLH1 antibody (Fig. 5C
).
|
Second, protein extracts derived from bacteria that express
either GST-hMSH4-
1, GST-hMSH4-
2 or GST proteins were prepared by
using a lysis procedure without the denaturation step. The lysates were
incubated with glutathione S-Sepharose beads such that ~ 200 ng
of GST fusion protein was bound to 50 µl of GST beads. Then in
vitro translated hMLH1 protein was added to either GST-hMSH4-
1,
GST-hMSH4-
2, or GST proteins fixed to beads. The resulting bound
complexes were analyzed by electrophoresis, followed by autoradiography
(Fig. 5D
).
By using two different procedures, we have demonstrated that the
GST-hMSH4-
1 mutant corresponding to the carboxyl-terminal part of
hMSH4 and containing an ATP binding site and a helix-turn-helix motif
did not appear to interact with hMLH1 (Fig. 5B
, 5D
). This result is consistent with the coimmunoprecipitation
study, as neither DNA nor ATP was required for hMSH4-hMLH1 interaction.
In contrast, hMLH1 significantly bound to GST-hMSH4-
2 deletion
mutant (Fig. 5B
, 5D
), suggesting that the
interaction region is located between amino acids 1 and 674 of hMSH4.
No binding of hMLH1 to glutathione Sepharose beads (data not shown) or
to GST protein was observed (Fig. 5D
).
Further characterization of the hMSH4 interacting domain
The interaction region was further resolved by truncating the
amino-terminal fragment of hMSH4. Protein extracts derived from
bacteria that express hMLH1 with one of the GST-hMSH4-
3,
4,
5
deletion mutants or with GST as control were prepared by using the
lysis procedure, including a denaturation step as described previously.
Equal amounts of the various lysates were incubated with GST beads and
material bound to beads was analyzed by Western blotting by using
either anti-GST antibodies (Fig. 6A
) or the anti-MLH1 monoclonal antibody (Fig. 6B
).
GST-hMSH4-
3,
4,
5 deletion constructs allow the production of
proteins of expected size (Fig. 6A
). Amino acid residues
1272 of hMSH4 (
5 mutant) appeared to be sufficient to bind hMLH1
protein (Fig. 6B
), suggesting that the most significant
hMLH1 interaction region of hMSH4 is located within the first 272 amino
residues of this protein. It is worth noting that the interaction with
hMLH1 appeared to be reduced when one compares hMSH4 amino acid
residues 1433 (
3 mutant), 1330 (
4 mutant), or 1272 (
5
mutant) with hMSH4 amino acid residues 1674 (
2 mutant) (Fig. 6B
). This reduction of interaction between hMLH1 and
3,
4 and
5 hMSH4 mutants has been observed in several independent
experiments (data not shown). These results suggest that the
interaction region of hMSH4 with hMLH1 may encompass the region located
between amino residues 1 and 674.
|
Colocalization of MSH4 and MLH1 on meiotic chromosomes
During leptonema of early meiotic prophase in mouse spermatocytes,
axial elements, a component of the synaptonemal complex (SC) begin to
form between the sister chromatids of each chromosome. SCP3 is a
component of axial elements, and antibodies against SCP3 can be used to
follow SC formation (23)
. Synapsis of homologous
chromosomes in mouse spermatocytes usually begins even before axial
element formation is complete and involves alignment of homologues and
formation of a central element and transverse filaments, additional
components of the SC. When mouse spermatocytes are stained with the
hMSH4 peptide antibody, MSH4 foci are not seen on asynapsed axial
elements, but are found along the SC as soon as homologues begin to
synapse during zygonema (Fig. 7A
). Completion of autosomal synapsis marks the transition to
pachynema, the next stage of meiotic prophase. MSH4 remains at multiple
sites along all the autosomal SCs during early pachynema, as identified
by the staging criteria of Moses (24)
(Fig. 7B
). As pachynema progresses, the number of MSH4 foci begins
to drop, but the remaining foci exhibit a characteristic pattern. By
around mid-pachynema, there are usually only 23 MSH4 foci per SC and
one of these is often near one end of the SC (Fig. 7C
).
Although the number of foci is greater, the pattern of localization
near the distal (noncentromeric) end of the SC is reminiscent of that
observed for MLH1, a protein shown to be involved in reciprocal
recombination (12
, 16)
. When we triple label spermatocytes
with SCP3, MSH4, and MLH1, MSH4 is at its maximum in early pachynema,
with no MLH1 foci present. By the early-mid pachytene transition, MLH1
foci begin to appear and rapidly reached their maximum number of 1922
per nucleus. It is during this time that MLH1 exhibits maximum
colocalization with MSH4 (Fig. 7E, F
). In this
transient stage, colocalization of MSH4 and MLH1 foci is at its
maximum, between 95 and 100% (9 nuclei). From this substage onward,
the number of MSH4 foci decreases and the percent of colocalization
drops first to 7585% (11 nuclei), then to 4050% (5 nuclei), and
finally to 125% (45 nuclei). These changes in degree of
colocalization reflect a continued loss of MSH4 signal as spermatocytes
progress through pachynema. The remaining MSH4 signals continue to
colocalize with MLH1. By mid-late pachynema, MSH4 foci totally
disappear (Fig. 7D
), whereas MLH1 foci are gradually lost as
spermatocytes progress through late pachynema (Fig. 8
).
|
|
| DISCUSSION |
|---|
|
|
|---|
In addition, we have found that MSH4 does not need to be bound to DNA
in order to form a complex with hMLH1 and that this interaction does
not require the binding or the hydrolysis of ATP. Consistent with these
observations, we have demonstrated that the region of MSH4 involved in
the interaction with MLH1 is located in the amino-terminal part of the
protein, whereas the NTP binding and putative helix-turn-helix domains
are in the carboxyl-terminal region. These results indicate that steps
essential for the assembly of a complex between other MutS and MutL
homologs in mismatch DNA repair (21
, 22)
are not required
for the interaction between MSH4 and MLH1 during meiosis. In
particular, MSH2, unlike MSH4, needs to be bound to DNA prior to
interaction with MLH1 (20
, 21)
. Since MSH4 acts in a
separate process from MSH2, MSH3, and MSH6, it is of interest to
determine the particular attributes of this protein contributing to its
functional specificity. It has been suggested that MSH4 recognizes
different DNA substrates compared to the mismatch repair MSH proteins
(2)
. Alternatively, MSH4 may bind to a similar set of DNA
substrates but act to recruit different downstream proteins. Here we
have shown that MSH4 acts differently from DNA repair MSH proteins to
form a complex with MLH1. Consequently, we suggest that this difference
also contributes to the functional specificity of MSH4. Based on the
conservation of the adenine nucleotide binding and hydrolysis domain
(3)
, it is likely that MSH4 exhibits ATP binding and
hydrolytic activity. However, how these activities contribute to MSH4
function in meiotic recombination remains to be determined. In
vivo, additional factors are likely to interact with MSH4 and MLH1
in the reciprocal recombination process. The recruitment of one or more
of these proteins can be expected to require ATP binding and/or
hydrolytic activity of MSH4. Alternatively, ATP binding and/or ATPase
activity may be necessary for the binding of MSH4 to its DNA
substrates. The importance of these activities for MSH4 function is
supported by the fact that mutations in the conserved ATP binding
domain of MSH5 in yeast (a protein that is definitely recruited to
MSH4) create null alleles (5)
.
The combination of knockout mice and immunolocalization studies is
helping to define the role of MutS and MutL homologs in mammalian
meiosis. Null mutation of the Msh2 gene have no effect on
the fertility of male or female inbred mice (25)
,
suggesting that in meiosis MSH2 might be replaced by another protein of
the MutS family. Mice carrying a disruption in Msh5 show a
defect in chromosome synapsis (9
, 10)
. Here we have shown
that the time of expression of MSH4 and its localization along synapsed
axes of zygotene and early pachytene spermatocytes make MSH4 the likely
MutS partner for MSH5 during chromosome synapsis. Further studies will
be necessary to determine whether chromosome synapsis requires an
interaction between a MSH4-MSH5 heterodimer and MutL-like proteins.
Unlike MLH1, which is not expressed at this step of meiosis, PMS2 is a
good candidate for a MutL-like synaptic protein since synapsis and SC
organization is disrupted in male mice deficient for this protein
(26)
. As the MutL homologs likewise function as
heterodimeric pairs, the second component of the MutL synaptic
heterodimer remains to be identified.
We have also shown that MSH4 acts later in pachynema and that it
colocalizes with MLH1. In MLH1-deficient mice, meiotic failure is
associated with an almost total absence of chiasmata (12)
.
Chiasmata represent the physical manifestation of crossover events.
MLH1 foci are localized to chiasma sites during diplotene in wild-type
mouse oocytes (12)
. All together, these results suggest
that MLH1 plays a role in reciprocal recombination. Furthermore, the
number and positions of autosomal MLH1 foci in human spermatocytes are
similar to those of autosomal chiasma (15)
. Barlow and
Hultén (15)
confirmed that anti-MLH1 labeling is a
tool to detect crossing over sites during pachynema. The
interaction between MSH4 and MLH1 associated with their
colocalization on meiotic chromosomes during early-mid pachynema
suggests that these two proteins act in conjunction, probably in
meiotic recombination process. Since msh5 -/- mice fail to
synapse (9
, 10)
, it is not yet known whether MSH5 also
acts in crossover events. Likewise, it remains unclear whether PMS2 or
an other MutL homologue is the second member of a MutL recombinational
heterodimer. The dual roles of MSH4, first without and then with MLH1,
emphasize the separation of mammalian synaptic and recombination
events. Only the identification of all MSH and MLH partners acting in
synapsis and recombination will afford an understanding of the
molecular mechanisms involved in these two critical steps of mammalian
meiosis.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication September 22, 1999.
Revision received January 31, 2000.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Svetlanov, F. Baudat, P. E. Cohen, and B. de Massy Distinct Functions of MLH3 at Recombination Hot Spots in the Mouse Genetics, April 1, 2008; 178(4): 1937 - 1945. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kan, X. Sun, N. K. Kolas, E. Avdievich, B. Kneitz, W. Edelmann, and P. E. Cohen Comparative Analysis of Meiotic Progression in Female Mice Bearing Mutations in Genes of the DNA Mismatch Repair Pathway Biol Reprod, March 1, 2008; 78(3): 462 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. de Boer, P. Stam, A. J. J. Dietrich, A. Pastink, and C. Heyting Two levels of interference in mouse meiotic recombination PNAS, June 20, 2006; 103(25): 9607 - 9612. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Cohen, S. E. Pollack, and J. W. Pollard Genetic Analysis of Chromosome Pairing, Recombination, and Cell Cycle Control during First Meiotic Prophase in Mammals Endocr. Rev., June 1, 2006; 27(4): 398 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Kolas, A. Svetlanov, M. L. Lenzi, F. P. Macaluso, S. M. Lipkin, R. M. Liskay, J. Greally, W. Edelmann, and P. E. Cohen Localization of MMR proteins on meiotic chromosomes in mice indicates distinct functions during prophase I J. Cell Biol., November 7, 2005; 171(3): 447 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oliver-Bonet, P.J. Turek, F. Sun, E. Ko, and R.H. Martin Temporal progression of recombination in human males Mol. Hum. Reprod., July 1, 2005; 11(7): 517 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A.T. de Vries, E. de Boer, M. van den Bosch, W. M. Baarends, M. Ooms, L. Yuan, J.-G. Liu, A. A. van Zeeland, C. Heyting, and A. Pastink Mouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation Genes & Dev., June 1, 2005; 19(11): 1376 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Argueso, J. Wanat, Z. Gemici, and E. Alani Competing Crossover Pathways Act During Meiosis in Saccharomyces cerevisiae Genetics, December 1, 2004; 168(4): 1805 - 1816. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Neyton, F. Lespinasse, P. B. Moens, R. Paul, P. Gaudray, V. Paquis-Flucklinger, and S. Santucci-Darmanin Association between MSH4 (MutS homologue 4) and the DNA strand-exchange RAD51 and DMC1 proteins during mammalian meiosis Mol. Hum. Reprod., December 1, 2004; 10(12): 917 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. W. Stahl, H. M. Foss, L. S. Young, R. H. Borts, M. F. F. Abdullah, and G. P. Copenhaver Does Crossover Interference Count in Saccharomyces cerevisiae? Genetics, September 1, 2004; 168(1): 35 - 48. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Her, X. Wu, M. D. Griswold, and F. Zhou Human MutS Homologue MSH4 Physically Interacts with von Hippel-Lindau Tumor Suppressor-binding Protein 1 Cancer Res., February 15, 2003; 63(4): 865 - 872. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Argueso, A. W. Kijas, S. Sarin, J. Heck, M. Waase, and E. Alani Systematic Mutagenesis of the Saccharomyces cerevisiae MLH1 Gene Reveals Distinct Roles for Mlh1p in Meiotic Crossing Over and in Vegetative and Meiotic Mismatch Repair Mol. Cell. Biol., February 1, 2003; 23(3): 873 - 886. [Abstract] [Full Text] |
||||
![]() |
E. R. Hoffmann, P. V. Shcherbakova, T. A. Kunkel, and R. H. Borts MLH1 Mutations Differentially Affect Meiotic Functions in Saccharomyces cerevisiae Genetics, February 1, 2003; 163(2): 515 - 526. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Santucci-Darmanin, S. Neyton, F. Lespinasse, A. Saunieres, P. Gaudray, and V. Paquis-Flucklinger The DNA mismatch-repair MLH3 protein interacts with MSH4 in meiotic cells, supporting a role for this MutL homolog in mammalian meiotic recombination Hum. Mol. Genet., July 15, 2002; 11(15): 1697 - 1706. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Moens, N. K. Kolas, M. Tarsounas, E. Marcon, P. E. Cohen, and B. Spyropoulos The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination J. Cell Sci., April 15, 2002; 115(8): 1611 - 1622. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Anderson, K. D. Hooker, and S. M. Stack The Distribution of Early Recombination Nodules on Zygotene Bivalents From Plants Genetics, November 1, 2001; 159(3): 1259 - 1269. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pelttari, M.-R. Hoja, L. Yuan, J.-G. Liu, E. Brundell, P. Moens, S. Santucci-Darmanin, R. Jessberger, J. L. Barbero, C. Heyting, et al. A Meiotic Chromosomal Core Consisting of Cohesin Complex Proteins Recruits DNA Recombination Proteins and Promotes Synapsis in the Absence of an Axial Element in Mammalian Meiotic Cells Mol. Cell. Biol., August 15, 2001; 21(16): 5667 - 5677. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |