FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SCHULTE, R.
Right arrow Articles by AUTENRIETH, I. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SCHULTE, R.
Right arrow Articles by AUTENRIETH, I. B.
(The FASEB Journal. 2000;14:1471-1484.)
© 2000 FASEB

Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation of Rel p65-p65 homodimers

RALF SCHULTE*,1,2, GUNTRAM A. GRASSL*,1, SONJA PREGER*, SABINE FESSELE{dagger}, CHRISTOPH A. JACOBI*, MARTIN SCHALLER{ddagger}, PETER J. NELSON{dagger} and INGO B. AUTENRIETH*3

* Max von Pettenkofer-Institut für Hygiene und Medizinische Mikrobiologie, Ludwig-Maximilians-Universität München, D-80336 München, Germany;
{dagger} Medizinische Poliklinik, Ludwig-Maximilians-Universität München, D-80336 München, Germany; and
{ddagger} Klinik für Dermatologie und Allergologie, Ludwig-Maximilians-Universität München, D-80337 München

3Correspondence: Max von Pettenkofer-Institut, Ludwig-Maximilians-Universität München, Pettenkoferstrasse 9a, D-80336 München, Germany. E-mail: Autenrieth{at}m3401.mpk.med.uni-muenchen.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Enteropathogenic Yersinia bacteria trigger the production of the proinflammatory chemokine IL-8, an important chemokine for the recruitment of polymorphonuclear leukocytes (PMN). Yersinia is resistant to phagocytosis by PMN, and the recruitment of these cells is thought to be part of a pathogenic strategy of Yersinia to establish infection by allowing the pathogen to gain access to, and disseminate within, host tissue. We report here that Yersinia expressing the outer membrane protein invasin triggers IL-8 production in epithelial cells. The 195 carboxyl-terminal amino acids of invasin when linked to latex beads are sufficient to trigger IL-8 production. By means of IL-8 promoter reporter gene assays and electrophoretic mobility shift assay experiments, the minimal optimal region of the IL-8 promoter responsive to invasin was identified and invasin-responsive control elements were characterized. Invasin-induced activation of the IL-8 promoter was found to be mediated through a previously identified NF-{kappa}B element. This NF-{kappa}B binding site preferentially binds Rel p65-p65 homodimers as well as some p50-p65 heterodimers in response to stimulation by invasin. Invasin-induced NF-{kappa}B activation correlated with degradation of I{kappa}B{alpha} and the inhibition of NF-{kappa}B by specific inhibitors of I{kappa}B activation blocked invasin-induced IL-8 secretion. Invasin-triggered IL-8 production does not depend on invasin-triggered uptake of bacteria, and is independent of a functional PI3-kinase. This report is the first to demonstrate the molecular basis of IL-8 production triggered by enteropathogenic bacteria. Together, these data elucidate the possible early pathomechanisms operating in Yersinia infection and may have implications for the design of novel therapeutics directed against this enteropathogen.—Schulte, R., Grassl, G. A., Preger, S., Fessele, S., Jacobi, C. A., Schaller, M., Nelson, P. J., Autenrieth, I. B. Yersinia enterocolitica invasin protein triggers IL-8 production in epithelial cells via activation of Rel p65-p65 homodimers.


Key Words: bacteria • chemokine • transcription • NF-{kappa}B


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
AN EARLY HOST response to infection by various pathogens is the acute recruitment of inflammatory cells such as polymorphonuclear leukocytes (PMN) to the site of infection. Intestinal epithelial cells respond to enteric pathogens such as Salmonella, Shigella, pathogenic Escherichia coli, or Yersinia by producing a variety of proinflammatory cytokines including interleukin 8 (IL-8), monocyte chemotactic protein-1, granulocyte/monocyte colony-stimulating factor, and tumor necrosis factor {alpha} (TNF-{alpha}) (1 2 3 4 5 6) . Recent reports using animal models and in vitro systems have identified IL-8 as an important chemoattractant in PMN migration to sites of infection or tissue injury (3 , 7) .

Yersinia enterocolitica causes a broad range of gastrointestinal syndromes ranging from acute enteritis and enterocolitis to mesenteric lymphadenitis (8 , 9) . It has been suggested that the triggering of IL-8 production by Yersinia may be part of its pathogenic strategy. Yersinia that is resistant to phagocytosis by PMN may take advantage of recruited PMN and/or other cells in order to induce tissue pathology and thus gain access to, or disseminate within, host tissue (10 , 11) .

The virulence of Y. enterocolitica is controlled by chromosomal (yst, inv) (12 13 14 15) and plasmid-encoded genes (16 , 17) . The pYV virulence plasmid directs production of the outer membrane protein YadA and secretion of at least 11 antihost proteins called Yops (17 18 19) . Adherence to or internalization of Yersinia by epithelial cells (20 , 21) depends on Yersinia surface proteins including invasin (22 23 24) , attachment-invasion locus (14 , 25) , and Yersinia adhesin A (24 , 26 27 28 29 30) .

The outer membrane protein invasin plays an important role in the early phase of intestinal infection (31) . Invasion of Y. enterocolitica into epithelial cells depends on the interaction between Yersinia invasin and ß1 integrins on the surface of the eukaryotic cell (22) . Infection of HeLa or T84 cells with Y. enterocolitica induces IL-8 transcription and subsequent secretion (32) .

The invasin protein of Y. enterocolitica plays an essential role in Yersinia-triggered IL-8 production. Inv mutant Y. enterocolitica pYV- strain does not induce IL-8 production, whereas a recombinant E. coli strain-expressing Yersinia inv can (33) . Although invasin is required for IL-8 gene activation, host cell invasion appears not to be essential for this process as blocking of Yersinia cell invasion by cytochalasin D or wortmannin does not affect invasin-triggered IL-8 expression and secretion (33) .

The promoter region of the human IL-8 gene contains consensus sequences for several transcription factors including the nuclear factors (NF) IL-6, NF-{kappa}B, AP-1, AP-3, and octamer binding proteins (34) . Although cooperation with other transcription factors including NF-IL-6 and AP-1 (34 35 36 37) , is thought to be necessary, the NF-{kappa}B element has been shown to be crucial for IL-8 transcription (34 35 36 37) .

Previous studies have demonstrated that NF-{kappa}B is induced by a pleiotropic array of agents including various cytokines, double-stranded RNA, phorbol esters, and several viruses (38) . More recent investigations have shown that infection of host cells with pathogenic bacteria is associated with activation of NF-{kappa}B and IL-8 expression in a variety of cell types, including cultured enterocytes. Thus, infection of epithelial cells with bacterial pathogens such as Helicobacter pylori, S. typhimurium, or enteropathogenic E. coli can lead to the activation of NF-{kappa}B (5 , 39 40 41 42 43) . To date, the mechanism by which enteric bacterial pathogens induce NF-{kappa}B activation in epithelial cells is unknown.

The purpose of the present study was to clarify whether and how the outer membrane protein invasin of Y. enterocolitica contributes to the induction of IL-8 expression. We show that bacteria or inert latex particles coated with a truncated Y. enterocolitica invasin protein comprising the carboxyl-terminal 195 amino acids trigger degradation of I{kappa}B{alpha} and subsequent activation of Rel p65-p65 homodimers, which leads to IL-8 expression and production by epithelial cells. These events depend on invasin-mediated attachment of bacteria or beads to epithelial cells, but are independent of invasin-triggered internalization, which depends on functional PI3-kinase activity.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Bacterial strains and growth conditions
Plasmid-cured (pYV-) Y. enterocolitica WA314 (44) , (pYV-) inv mutant Y. enterocolitica WA314 (45) , noninvasive E. coli HB101, and the E. coli HB101 (pINV1914) strain expressing the Y. enterocolica inv (33) were grown in Luria-Bertani broth (LB). For infection experiments, overnight cultures were diluted to an optical density (OD) at 600 nm (OD600) of 0.2 in LB and incubated for 3 h at 27°C or 37°C, respectively.

Cell culture and infection protocol
Human HeLa cervical epithelial cells (ATCC CCL-2.1) were grown in RPMI 1640 (Biochrom KG, Berlin, Germany) and 10% fetal bovine serum (Gibco BRL, Paisley, Scotland), supplemented with 2 mM L-glutamine (Biochrom KG), penicillin (100 U/ml), and streptomycin (100 µg/ml) (Biochrom KG). The cells were grown in a humidified 5% CO2 atmosphere at 37°C. For infection, bacteria grown for 3 h in LB at 27°C or 37°C, respectively, were collected by centrifugation and washed twice in sterile phosphate-buffered-saline (PBS) (pH 7.4). After determination of the OD, appropriate dilutions of the bacteria in PBS were performed before infection. Cells were infected with a bacterium-to-cell ratio of 100:1 or as indicated. The actual number of bacteria administered was determined by plating 0.1 ml of 1:10 serial dilutions on Mueller-Hinton (MH) agar and counting of colony-forming units. Monolayers of HeLa cells (60–70% confluent) were washed twice with PBS and incubated in medium containing heat-inactivated fetal bovine serum without antibiotics. After 1–2 h of equilibration, bacterial samples were added. Monolayers and bacteria were incubated for 2 h or as indicated to allow bacterial adherence and entry. After removal of the medium, cultures were washed three times with PBS to remove extracellular bacteria and further incubated for 6 h or as indicated in the presence of 100 µg of gentamicin/ml to kill remaining extracellular bacteria. Then culture supernatants were removed and centrifuged for 20 min to pellet residual bacteria and cells before IL-8 determination. Cells were lysed with 1% Triton X-100 in PBS. The number of released viable bacteria was determined by plating serial 10-fold dilutions on MH agar. TNF-{alpha} was a gift from G. Adolf from Bender (Vienna, Austria) and was used as a positive control for IL-8 stimulation. Alternatively, invasin-coated beads (see below) or anti-ß1 integrin monocloncal antibodies (clone TS2/16 at 5 µg/ml induced submaximal responses; Endogen, Woburn, Mass.), followed by goat anti-mouse IgG antibodies (20 µg/ml; Sigma, St. Louis, Mo.) were used. MG-132 (Biomol, Hamburg, Germany) and curcumin (Biomol) were used to inhibit NF-{kappa}B activation by incubating HeLa cells 30 min before stimulation or infection as indicated. HeLa cells were treated with 100 nM of wortmannin (Sigma), a PI3-kinase inhibitor, 20 min prior to infection to prevent bacterial internalization.

DNA constructs
Vectors containing fusions between the 5'-flanking region sequences of the human IL-8 gene (34 , 35) or sequentially deleted fragments of the IL-8 gene 5'-flanking region and a Luciferase reporter gene were kindly provided by Ron Crystal (Cornell Medical Center, New York). Vectors were constructed from a pUC8-derived vector (pCMV-luciferase) as described by Nakamura et al. (46) . The pIL-8{kappa}B chloramphenicol acetyltransferase (CAT; wild-type) and pIL-8{kappa}Bm CAT (mutant) were provided by Charles Kunsch (Atherogenics Inc., Norcross, Ga.) and have been described previously (47) . In these reporter constructs, CAT expression is under the control of the human IL-8 genomic sequence from -420 to +101 bp. Specific substitution mutation was introduced into the IL-8 promoter region to disrupt the NF-{kappa}B binding site (designated pIL-8{kappa}B CAT) (47) . ‘Full-length’ IL-8 luciferase (Luc) reporter constructs together with mutant constructs that lack either the NF-{kappa}B, NF-IL-6, or AP-1 binding sites were obtained from Andrew Keates (Beth Israel Deaconess Medical Center, Boston, Mass.). The full-length reporter construct contains a 1512 bp fragment (nucleotides -1481 to +40) of the promoter region of the IL-8 gene (34 , 35) cloned into the pGL2-Basic Luciferase expression vector (Promega, Madison, Wis.). The mutants are based on the full-length construct in which nucleotides -71 to -82 (for NF-{kappa}B mutant), nucleotides -84 to -91 (for NF-IL-6 mutant), or nucleotides -120 to -126 (for AP-1) have been deleted. To normalize for transfection efficiency, cotransfections were performed using pCMV-ß-galactosidase (Clontech, Palo Alto, Calif.) in which ß-galactosidase is constitutively expressed from the CMV promoter. pNF-{kappa}B-Luciferase (Clontech) was used as an NF-{kappa}B transcription reporter vector. Part of the inv gene encoding the 397 or 195 carboxyl-terminal amino acids was amplified from Y. enterocolitica serotype O:8 by polymerase chain reaction (PCR) using the forward primer 5'-ACGTGAATTCCACGTTGACCGTTATTGTGC-3' (EcoRI restriction site underlined) for Inv397, ACGTGAATTCCTACCCAGTACCGAAGATAA (EcoRI-site italicized) for Inv195, and the reverse primer 5'-GCCGCTCGAGCTATTGCGGCTCCGCAC-3' (XhoI restriction site italicized) according to the published sequence (48) . The amplified DNA fragments were digested with EcoRI and XhoI and cloned into pGEX-4T-3 expression vector (Amersham-Pharmacia, Little Chalfont, U.K.) resulting in pINV397 and pINV195, respectively.

Expression and purification of GST-Inv397 and GST-Inv195 fusion protein
E. coli BL21 harboring pGEX-4T-3, pINV397, or pINV195 was grown at 24°C in LB to an OD of 0.7. Expression of the GST and GST-Inv fusion protein was induced with IPTG (isopropyl-ß-D-thiogalactopyranoside) at a final concentration of 0.1 mM. Cells were grown for 2 additional hours before being harvested by centrifugation and frozen at -20°C. Frozen cells were resuspended in PBS containing 1 mM phenylmethylsulfonylfluoride (PMSF) and complete protease inhibitor mixture (Boehringer Mannheim). After disrupting bacterial cells by French press, lysates were cleared for cellular debris by centrifugation. GST-Inv397, GST-Inv195 and GST were purified from supernatants using glutathione Sepharose 4B (Pharmacia Biotech, Brussels, Belgium) and Superdex 200 gel filtration. Purity and identity of GST-Inv397 or GST-Inv195 fusion protein were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot using anti-GST and anti-Inv antisera. Protein concentration was determined by the BCA protein assay (Pierce, Rockford, Ill.).

Coating of proteins to latex beads
For noncovalent coating of beads, purified protein was dialyzed against PBS pH 7.0. About 109 latex beads (1 µm diameter, sulfate-modified; Molecular Probes, Eugene, Oreg.) were washed with 1 ml of PBS and resuspended in 500 µl of PBS. Purified GST, GST-Inv397, or GST-Inv195 fusion protein (0–2 mg) was added and allowed to adsorb to the beads for 3 h at room temperature (RT). After adding 500 µl of 20 mg/ml bovine serum albumin (BSA), the solution was incubated at RT for another hour. Then beads were washed in PBS containing 1 mg/ml BSA and stored at 4°C in 500 µl of PBS containing 0.2 mg/ml BSA. To determine the coupling efficiency, the protein concentration of the starting solution and of the supernatant before adding BSA was determined. Integrity of coated GST-Inv397 or GST-Inv195 fusion protein was checked by Western blot analysis.

IL-8 ELISA
The amount of IL-8 secreted into the supernatant was determined as described previously (32) using an enzyme-linked immunosorbent assay (ELISA) with optimal concentrations of a mouse anti-human IL-8 monoclonal antibody (mAb) (G265–5; PharMingen, San Diego, Calif.) and a biotinylated mouse anti-human IL-8 mAb (G265–8; PharMingen) as detecting antibody. IL-8 concentrations were calculated from the straight-line portion of a standard curve using recombinant human IL-8 (PharMingen).

Reverse transcription-PCR analysis
Total RNA of infected HeLa cells in 6-well plates was extracted using 1 ml of TRIzol reagent (Gibco BRL). Five micrograms of RNA was reverse transcribed as described by Schulte et al. (33) . cDNA products were amplified by PCR in 50 µl (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2), 200 µM each of dATP, dCTP, dGTP, and dTTP in the presence of 25 pmol each of 5' and 3' primer (4) and 2.0 U of AmpliTaq Gold DNA polymerase (Perkin Elmer, Überlingen, Germany). The temperature profile of the amplification consisted of 25 cycles of 1 min denaturation at 95°C and 2.5 min annealing and extension at 60°C (IL-8) or 72°C (ß-actin) (4) . Negative controls were performed by omitting RNA from the cDNA synthesis and specific PCR amplifications. PCR products were separated in 2% agarose gels. Quantification was performed using a FluoroS Imager (Bio-Rad, München, Germany).

Transient transfection
For transient transfection assays, 1 x 105 HeLa cells were seeded in 12-well plates, and cotransfected 24 h later with 1 µg of CAT or Luc reporter constructs using ExGen (Euromedex; Souffelweyersheim, France) transfection reagent according to the manufacturer’s instructions, and incubated for 12 h at 37°C. The constructs were cotransfected with 0.25 µg of ß-galactosidase construct (pCMV-ß-gal) to determine transfection efficiency. For stimulation, transfected cells were washed twice with PBS and incubated in antibiotic-free medium. HeLa cells were infected with bacteria at a MOI (multiplicity of infection) of 100 and incubated at 37°C. After 2 h, cells were washed twice with PBS to remove extracellular bacteria and incubated for an additional 6 h in the presence of 100 µg gentamicin/ml. Then supernatants were removed to determine IL-8 secretion. HeLa cells were washed twice with PBS and lysed. Lysates were centrifuged and supernatants were removed for protein determination, measurement of ß-galactosidase, and determination of CAT or Luc activity.

Reporter gene activity
To determine CAT activity, cells were washed twice with PBS and once with TEN (40 mM Tris/HCl pH 7.8; 1 mM EDTA pH 8.0; 150 mM NaCl). Cells were incubated with 200 µl TEN for 5 min on ice and finally resuspended. After centrifugation at 12,000 rpm for 1 min at 4°C, cells were resuspended in 100 µl 0.25 M Tris/HCl pH 8.0. Finally, cells were lysed by three successive rounds of freezing and thawing. Luc activity was measured as follows. Cell lysates were added to a solution containing 25 µg of n-butyryl coenzyme A, 0.2 µCi [C14] chloramphenicol in a final volume of 50 µl 0.25 M Tris/HCl (pH 8.0). The reaction was allowed to proceed for 1 h at 37°C and then stopped by adding 200 µl of mixed xylene (Sigma-Aldrich, Steinheim). The organic phase was then extracted twice with 100 µl of 0.25 M Tri/HCl, pH 8.0, and the 100 µl of the organic phase was counted in a scintillation counter MicroBeta TriLux (Wallac, Turku, Finland). To evaluate Luc activity, cells were washed with PBS and lysed with 0.1% Triton X-100 in 25 mM Tris-phosphate pH 7.8, 10% glycerol, and 1 mM DTT. Lysates were centrifuged at 12.000 rpm for 5 min at 4°C. CAT activity in supernatants were assayed in Luc buffer containing 20 mM tricine; 1.07 mM (MgCO3)4 Mg(OH)2 x 5H2O; 0.1 mM EDTA; 33.3 mM D/L-DTT; 270 µM Li3-coenzyme A; 470 µM D(-)-luciferin; 530 µM Mg-ATP. Luminescence was measured with a MicroBeta TriLux (Wallac). The protein concentration of supernatants was determined by the Bradford method (Bio-Rad protein assay). ß-Galactosidase activity was determined according to a standard protocol (49) . Levels of CAT and Luc expression were normalized by ß-galactosidase activity and total protein concentration.

I{kappa}B immunoblotting
To examine the presence of I{kappa}B{alpha} or I{kappa}Bß at different times after infection, 5 x 105 HeLa cells in 6-well plates were infected at a MOI of 100. Bacterial infection was synchronized by centrifugation for 5 min at 500 g at 20°C. At indicated time points, cells were washed twice with PBS and 400 µl lysis buffer (10 mM Tris, pH 8.0, 60 mM KCl, 1 mM EDTA, 0.5% Nonidet P-40, 1 mM DTT, 1 mM PMSF, 1 mM benzamidine, 20 mM ß-glycerophosphate, 5 mM p-nitrophenyl phosphate, and 0.1 mM Na3VO4) was added. Cells were scraped off, transferred into an Eppendorf tube, and centrifuged to pellet cell debris. Proteins were separated by 10% SDS-PAGE and electrotransferred to polyvinylidene difluoride membrane. Immunostaining for I-{kappa}B was performed with polyclonal anti-I-{kappa}B{alpha} or I-{kappa}Bß antibodies (Santa Cruz Biotechnology, Santa Cruz, Calif.). Immunoreactive bands were visualized by incubation with donkey anti-rabbit antibodies conjugated to horseradish peroxidase using enhanced chemiluminescence reagents (Amersham).

Electrophoretic mobility shift assay (EMSA)
HeLa cells (5x106) were infected as described above or incubated with GSTINV397 beads at a MOI of 2000. At various intervals after infection or stimulation, nuclear extracts were prepared according to the protocol described by Schreiber et al. (50) . Aliquots of the supernatant containing nuclear proteins were stored at -70°C. Protein concentrations were determined by the Bradford assay. The oligonucleotide probes described below were labeled with [{gamma}32P]ATP (NEN) by using the T4-Polynucleotide kinase (Boehringer Mannheim, Mannheim, Germany) and then purified on a NucTrap probe purification column (Stratagene, San Diego, Calif.). The following oligonucleotides were used: NF-{kappa}B consensus (NF-{kappa}Bc): 5'-AGTTGAGGGGACTTTCCCAGGC-3' (Santa Cruz); NF-{kappa}B mutant (NF-{kappa}Bm): 5'-AGTTGAGGCGACTTTCCCAGGC-3' (Santa Cruz); IL-8-{kappa}B consensus (IL-8{kappa}Bc): 5'-ATCGTGGAATTTCCTCTGA-3' (Metabion, Munich, Germany); IL-8-{kappa}B mutant (IL-8{kappa}Bm): 5'-ATCcTGcAATgTCgTCTGA-3' (Metabion); hIL8: 5'GGGCCATCAGTTGCAAATCGTGGAATTTCCTCTGACATAATGAAAAGAT-3'; C/EBP consensus (C/EBPc): 5'-TGCAGATTGCGCAATCTGCA-3'; C/EBP mutant (C/EBPm): 5'-TGCAGAGACTAGTCTCTGCA-3'; RANTES E:5'-CTTTTCCGTTTTGTGCAATTTCACTTATG-3'. Promoter sequence analysis for transcription factor binding sites was performed by using professional MatInspector software (Genomatix, Munich, Germany) as described by Quandt et al. (51) . Nuclear extracts (3 to 6 µg) were incubated with 30,000 cpm of the 32P-labeled oligonucleotide probe for 45 min on ice in a buffer containing 5% glycerol, 90 mM NaCl, 1 mM dithiothreitol 1 mM EDTA pH 8.0, 10 mM Tris-HCl pH 7.2, and 1 µg dIdC. For supershift analysis, antibodies against p50, p52 (UBI), p53, p65, c-Rel, RelB, and C/EBP (Santa Cruz) were included in the binding reaction. Samples were resolved on a 5% nondenaturating polyacrylamide gel using 0.5 x TBE (25 mM Tris-HCl, 25 mM boric acid, 0.5 mM EDTA) as running buffer. Gels were transferred to Whatman 3M paper and dried under vacuum. Protein binding was assessed via autoradiography.

Transmission electron microscopy
One hour after infection, cells were washed three times with PBS, harvested by trypsin/EDTA treatment, washed twice with medium containing 10% fetal calf serum, and once with PBS. After centrifugation at a speed of 150 g for 10 min, the resulting pellets were fixed for 2 h in 2% formaldehyde/2.5% glutaraldehyde in 0.1 M phosphate-buffer (pH 7.3) for 2 h at room temperature. Postfixation was based on 1% osmium tetroxide containing 1% K-dichromate in 0.85% NaCl at pH 7.3 at room temperature for 45 min. After several washings and dehydration procedures, the specimen were embedded in glycide ether. The small blocks of cells were cut using an ultra microtome (Ultracut, Reichert, Vienna, Austria). Semi-thin sections (1 µm) were studied with a light microscope after staining with 1% toluidine blue and 1% pyronine G (Merck, Darmstadt, Germany). The sections were viewed at a magnification of x400. Ultra-thin sections (80 nm) were stained with 0.5% uranyl acetate for 10 min at 30°C and 2.7% lead citrate for 5 min (Ultrastainer, LKB, Sweden) at 20°C. Grids were examined using a Zeiss EM 902 transmission electron microscope (Zeiss, Oberkochen, Germany) operating at 80 kV at magnifications between x2000 and x30,000.

Immunofluorescence staining and confocal laser scan microscopy
Immunofluorescence microscopy (CLSM) was performed as recently described by V. Kempf et al. (unpublished results). In brief, after 3% paraformaldehyde (Sigma) fixation of the monolayers, extracellular bacteria or beads were stained with polyclonal rabbit anti-Yersinia invasin antibodies, followed by FITC-conjugated goat anti-rabbit antibodies (Dianova, Hamburg, Germany). After three washings, cells were permeabilized by 2% Triton X-100 in PBS, washed, and intracellular bacteria or beads were stained by anti-Yersinia invasin antibodies, followed by Cy-5-conjugated goat anti-rabbit antibodies (Dianova). F-actin was stained by TRITC-conjugated phalloidin (Sigma). The fluorescence images were obtained with a confocal laser scan microscope (Leica TCS 4D).

Statistics
Data shown in the figures are from representative experiments. Comparable results were obtained in additional experiments. Differences between mean values were analyzed using the Student’s t test. P<0.05 was considered statistically significant.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Y. enterocolitica invasin is essential for Yersinia-induced IL-8 mRNA expression
To investigate the potential role of Yersinia invasin in induction of IL-8 production, we analyzed IL-8 mRNA levels in HeLa cells after infection with inv-expressing Y. enterocolitica pYV- or Y. enterocolitica pYV- inv mutant strain, as well as after infection with E. coli-expressing Y. enterocolitica invasin (E. coli pINV1914). Reverse transcription-PCR demonstrated that Y. enterocolitica pYV- and E. coli pINV1914 induced IL-8 mRNA production when compared with noninfected controls (Fig. 1 ). In contrast, infection with Yersinia inv mutant or inv-negative E. coli strain did not induce significant IL-8 mRNA expression (Fig. 1) . Gentamicin-killed E. coli pINV1914 induced comparable IL-8 mRNA expression levels (not shown). These results suggest that Yersinia invasin is essential for induction of the IL-8 gene.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. IL-8 mRNA production in HeLa cells after infection with Y. enterocolitica pYV-, Y. enterocolitica pYV- inv, E. coli, or E. coli pINV1914. HeLa cells were infected at a bacterium-to-cell ratio of 100 to 1. Three hours after infection total RNA was extracted, reverse transcribed, and amplified using specific primers for IL-8 or ß-actin. Data shown are from a representative experiment. Comparable results were obtained in additional experiments.

Yersinia invasin-coated latex beads are internalized and trigger IL-8 production in HeLa cells
The aforementioned findings suggest that particles such as killed bacterial cells carrying invasin may induce IL-8 activation in HeLa cells. To test this hypothesis, we cloned a 397 and a 195 amino acid carboxyl-terminal fragment of Yersinia invasin, known to be sufficient to bind to ß1 integrins on the host cell surface (52) , onto a GST expression vector. Inert latex beads coated with the purified GST-Inv397 or GST-Inv195 fusion protein were first tested in cell internalization assays as described by Dersch and Isberg (53) . For this purpose, HeLa cells were incubated with beads coated with either purified GST-Inv397, GST-Inv195, or GST for 60 min and further processed for transmission electron microscopy. Electron microscopic analysis revealed that beads coated with GST only occasionally adhered to and were internalized by HeLa cells (Fig. 2A ). In contrast, beads coated with GST-Inv397 or GST-Inv195 efficiently adhered to and were internalized by HeLa cells in a way resembling the zipper mechanism by which Yersinia bacteria are internalized into HeLa cells (24) (Fig. 2B , C , D ).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Internalization of invasin-coated latex beads into HeLa cells. HeLa cells were inoculated with either GST- or GST-Inv397-coated beads at a MOI of 2000, incubated for 60 min at 37°C, and further processed for transmission electron microscopy. A) HeLa cells inoculated with GST beads. Intracellular GST beads are observed only occasionally in two of the shown HeLa cells. B) HeLa cells incubated with GST-Inv397 beads. High numbers of intracellular beads can be observed in all cells. C, D) Higher magnification of HeLa cells ingesting GST-Inv397 beads, suggesting a zipper-like uptake with accumulation of actin (arrow). E) IL-8 production by HeLa cells incubated with medium (none), TNF-{alpha} (100 ng/ml), Y. enterocolitica pYV- (MOI 100), anti-ß1 integrin monoclonal antibody (clone TS2/16 at 5 µg/ml), or anti-ß1 integrin monoclonal antibody (clone TS2/16 at 5 µg/ml) followed by polyclonal goat anti-mouse IgG (20 µg/ml). IL-8 production was determined by ELISA in supernatants collected 6 h after stimulation. Values represent the means ± SD of triplicate samples. F–H) IL-8 production by HeLa cells induced by GST- or GST-Inv-coated beads. Titration of bead per cell ratio (F). Beads coated with different protein concentrations (G, H). GST-INV397 beads (black bars); GST-Inv195 beads (hatched bars); GST beads (gray); medium control (open bars).

Next, HeLa cells were incubated with GST, GST-Inv195, or GST-Inv397-coated beads and IL-8 production was determined in culture supernatants by ELISA. The results show that GST-Inv397 or GST-Inv195, but not GST-coated beads, induced IL-8 secretion by HeLa cells in a dose-dependent manner (Fig. 2E , F , G , H ). Submaximal IL-8 production was achieved with beads coated with 500 µg GST-Inv397/ml at a bead-to-cell ratio of 2000 to 4000 whereas GST-Inv195 were less efficient in stimulating IL-8 (Fig. 2F , G , H ). The addition of soluble GST-Inv397 or GST-Inv195 to HeLa cells did not induce IL-8 production (not shown). GST-Inv195 or GST-Inv397-coated beads induced ~20% less IL-8 levels than TNF-{alpha}, but twofold higher IL-8 levels than stimulation with cross-linked anti-ß1 integrin antibodies (Fig. 2E , F , G , H ).

Identification of the minimal IL-8 promoter fragment required for invasin-mediated activation of the IL-8 gene
To localize the minimal promoter fragment of the human IL-8 gene necessary and sufficient to mediate Yersinia-induced IL-8 expression, we analyzed the Luc activity of HeLa cells transfected with IL-8 promoter/luciferase fusion constructs after bacterial infection. HeLa cells were transiently transfected with either full-length IL-8 promoter constructs (pN1481L, which spans the region from -1481 to +44) or 5'-truncated promoter constructs (pN130L or pN112L, which span the regions from -130 to +44, or -112 to +44, respectively). Transfectants were stimulated either with TNF-{alpha} (positive control) or infected with Y. enterocolitica pYV- or E. coli strains.

Analysis of Luc activity of HeLa cells transfected with the full-length (pN1481L) construct revealed a threefold increase in response to TNF-{alpha} activation or infection by Y. enterocolitica or E. coli pINV1914 (Fig. 3A ). In contrast, Y. enterocolitica inv mutant or the parental E. coli strain were not able to stimulate Luc activity (Fig. 3A ). Consistent with previous results (6) , Y. enterocolitica pYV+, which suppresses IL-8 secretion in epithelial cells, did not induce Luc activity in transfected HeLa cells (Fig. 3A ), which suggests that inv-expressing Y. enterocolitica and E. coli can influence IL-8 expression in HeLa cells at the level of transcription.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. A) Promoter activity of the 5'-flanking region of the IL-8 gene in response to infection with inv-expressing bacteria was evaluated in HeLa cells transfected with fusion genes, including the IL-8 promoter (pN1481L) or sequentially deleted 5'-flanking regions of the IL-8 promoter (pN130L, pN112L) fused to luciferase reporter gene. pLuc0 served as a negative control. 24 h after transfection, HeLa cells were infected at a MOI of 100 or stimulated with TNF-{alpha} (50 ng/ml). After 6 h cells were washed, lysed, and Luc activity was determined as described in Materials and Methods. Luc activity is presented as fold stimulation over nonstimulated cells (given a value of 1) and standardized against ß-galactosidase activity and protein concentration. Values represent the means ± SD of fold stimulation over nonstimulated cells of triplicate samples. B) Oligonucleotide probes used in EMSA experiments. The putative binding sites for Rel proteins and C/EBP are indicated.

HeLa cells transfected with pN130L or pN112L reporter constructs showed comparable results indicating that the promoter fragment from nucleotide -112 to +44 contains the essential regulatory elements for invasin-mediated induction of IL-8 transcription. These sequences were subjected to analysis with MatInspector software (51) . The pN112L reporter construct contains one putative NF-{kappa}B and two putative NF-IL-6 binding sites, suggesting a potential role for these elements in invasin-mediated IL-8 transcriptional activation. The NF-{kappa}B binding site does not show a strong consensus for the binding of p50 but does identify the region as a ‘good’ c-rel and p65 binding site (Fig. 3B ).

Activation of IL-8 transcription by invasin-expressing bacteria is mediated by Rel proteins
To assess whether NF-{kappa}B-like and/or NF-IL-6 binding sequences within the IL-8 promoter contribute to the stimulatory activity by invasin-producing bacteria, transient transfections with IL-8 promoter/Luc reporter constructs with mutations in either the NF-{kappa}B (pIL-8-{kappa}B), NF-IL-6 (pIL-8-NF-IL-6), or AP-1 (pIL-8-AP-1) binding site were performed. Mutation of the AP-1 or NF-IL-6 site did not significantly change stimulation of Luc activity after infection of transfected HeLa cells with Y. enterocolitica pYV- (data not shown). In contrast, HeLa cells transfected with a construct in which the NF-{kappa}B binding site is mutated did not respond to infection by production of Luc activity (not shown). Together, these results suggest that Yersinia invasin-mediated induction of the IL-8 gene requires at least a functional NF-{kappa}B binding site.

Activation of NF-{kappa}B in HeLa cells infected with Y. enterocolitica, invasin-expressing E. coli, or invasin-coated beads
The experiments described above suggest that the NF-{kappa}B site is essential for invasin-mediated activation of the IL-8 promoter in HeLa cells. To determine which Rel factors are actually induced in HeLa cells after infection with invasin-producing bacteria, nuclear extracts from invasin-stimulated HeLa cells were prepared and EMSA was performed. These experiments revealed that infection with Y. enterocolitica pYV- and E. coli pINV1914 or incubation with beads coated with invasin induces NF-{kappa}B binding activity in the nuclei, which was absent in unstimulated cells or in cells treated with Yersinia inv mutant strain, E. coli, or GST-coated beads (Fig. 4A and data not shown). NF-{kappa}B binding activity in HeLa cells after Yersinia infection was detected in a range of 45 to 90 min after infection, with maximum activity at 60 min (data not shown). Moreover, activation of nuclear {kappa}B-DNA binding complex was observed in the presence of wortmannin (Fig. 4A ), an inhibitor of the PI3-kinase, which blocks invasion of E. coli pINV1914 (Fig. 4B ) or Y. enterocolitica (33) into epithelial cells, suggesting that bacterial invasion and PI3-kinase activity are not required for NF-{kappa}B activation.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. A) EMSA: determination of transcription factor activation (NF-{kappa}Bc probe) in nuclear extracts of HeLa cells 60 min after stimulation with invasin-expressing or invasin-deficient Y. enterocolitica or E. coli in the absence or presence of wortmannin. Two dominant bands are visible (arrow). B) Confocal laser scan microscopy of HeLa cells infected with E. coli pINV1914 in the absence (-Wo) or presence (+Wo) of wortmannin (100 nM). Double immunostaining including anti-invasin antibodies was performed as described in Materials and Methods. Extracellular bacteria appear green, intracellular bacteria appear blue. Actin cytoskeleton, red.

To characterize the Rel proteins that mediate this effect, HeLa cells were stimulated with Inv397-coated beads and the nuclear extracts were incubated with oligonucleotide probe hIL-8, representing bp -101 to -53 (Fig. 3B ). The EMSA data depicted in Fig. 5 indicate that stimulation of HeLa cells with Inv397-coated beads induced two complexes that bound to the IL-8 promoter sequence. Competition experiments with cold oligonucleotides revealed that NF-{kappa}Bc but not C/EBP consensus nucleotides could compete for binding to these complexes. In addition, supershift analysis with antibody reagent specific for anti-p65, anti-p50, and anti-C/EBPpan antibodies revealed that only the Rel protein-specific anti-p65 and anti-p50 antibodies induced supershifts identifying the complexes as p50-p65 heterodimers and p65-p65 homodimers (Fig. 5) . Thus, no specific binding of C/EBP family members could be demonstrated in these cells.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 5. EMSA: determination of transcription factor activation in nuclear extracts of HeLa cells 60 min after stimulation with Inv397-coated beads. hIL-8 probe was incubated with nuclear extracts from nonstimulated cells or from cells incubated with GST beads (negative control), Inv397-coated beads, or TNF-{alpha}. In competition experiments, nuclear extracts from HeLa cells were incubated with the labeled hIL-8 probe in the presence or absence of a 100-fold excess of the unlabeled oligonucleotides. NF-{kappa}B consensus (NF-{kappa}Bc), NF-{kappa}B mutant (NF-{kappa}Bm), C/EBP consensus (C/EBPc), C/EBP mutant (C/EBPm), RANTES E (C/EBP) oligonucleotide. An EMSA supershift experiment was performed using polyclonal antibodies recognizing Rel proteins (p50, p65) or proteins of the C/EBP family (C/EBPpan).

Binding of invasin-induced Rel proteins to IL-8 {kappa}B consensus sequence
We then focused on the role of Rel proteins in invasin-induced control of IL-8 expression. To establish the specificity of Rel proteins binding to the IL-8{kappa}B consensus sequence, nuclear extracts of invasin-stimulated HeLa cells were incubated with IL-8{kappa}B consensus or IL-8{kappa}B mutant oligonucleotide probe. As evident from Fig. 6A , specific complexes bound to IL-8{kappa}B consensus but not to the mutated sequence of the IL-8{kappa}Bm oligonucleotide probe.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 6. A) EMSA: determination of transcription factor activation in nuclear extracts of HeLa cells 60 min after stimulation with Inv397-coated beads. IL-8 {kappa}B consensus (IL-8 {kappa}Bc) and mutant (IL-8 {kappa}Bm) probe were incubated with nuclear extracts from nonstimulated cells or from cells incubated with GST beads (negative control) or Inv397-coated beads. B) Effect of a mutated NF-{kappa}B binding site on promoter activity in stimulated HeLa cells transfected with pIL-8{kappa}B consensus (wild-type) CAT and pIL-8{kappa}B mutant (mutant) CAT. Chloramphenicol acetyltransferase (CAT) expression is under the control of the IL-8 genomic sequence from -420 to +101 bp (pIL-8CAT). Specific substitution mutation was introduced into the IL-8 promoter region to disrupt the NF-{kappa}B binding site (pIL-8{kappa}Bm CAT). 24 h after transfection, HeLa cells were infected at a MOI of 100 or stimulated with TNF-{alpha} (50 ng/ml). After 6 h cells were washed, lysed, and CAT activity was determined as described in Materials and Methods. Values represent the means ± SD of fold stimulation over nonstimulated cells of triplicate samples. C) EMSA (probe IL-8{kappa}Bc) supershift experiment was performed using polyclonal antibodies recognizing various Rel proteins (p50, p52, p65, c-Rel, and RelB).

To confirm the functional relevance of these data, an IL-8 promoter/CAT reporter construct representing bp -410 to +101 in which the NF-{kappa}B binding site has been mutated by nucleotide exchange (pIL-8mCAT) to the sequence of the aforementioned IL-8 {kappa}Bm (47 , 54) was used. Mutation of the NF-{kappa}B binding site significantly reduced invasin-mediated CAT activity in pIL-8{kappa}Bm CAT-transfected HeLa cells (Fig. 6B ). These results confirm that activation of the IL-8 promoter in HeLa cells in response to infection with either Y. enterocolitica or E. coli-expressing inv requires an intact binding site for NF-{kappa}B.

To better characterize the Rel proteins binding to the IL-8 {kappa}B element, EMSA supershift experiments were performed. Antibody reagent specific for p65 completely shifted both complexes whereas anti-p50 antibodies shifted only the lower complex (Fig. 6C ). In contrast, anti-cRel and anti-RelB antibodies caused slight supershifts but anti-p52 had no effect. These results suggest that the invasin-induced upper band is comprised of p65-p65 homodimers and the lower complex is primary classical p50-p65 heterodimers.

NF-{kappa}B consensus sequence binds p50/p50 and p50/p65 complexes while IL-8-{kappa}B consensus sequence binds p50/p65 and p65/p65 complexes
According to the computer-based analysis, the ‘NF-{kappa}B’ binding site of the IL-8 promoter does not show a strong consensus for the binding of p50; our results suggest a prominent role for p65-p65 homodimers in invasin-mediated activation of IL-8 expression (Fig. 6) . To provide direct evidence for this hypothesis, EMSA competition and supershift experiments (including comparison binding of labeled NF-{kappa}B consensus and IL-8{kappa}B consensus oligonucleotide probes) were performed. The data presented in Fig. 7 Aclearly demonstrate that nuclear extracts of invasin-stimulated HeLa cells comprise various complexes, some of which bind predominantly to NF-{kappa}B consensus probe whereas others bind predominantly to IL-8{kappa}B consensus oligonucleotide probe.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 7. A) EMSA and competition experiment. Determination of NF-{kappa}B activation in nuclear extracts of HeLa cells 60 min after stimulation with Inv397-coated beads by EMSA. Nuclear extracts from HeLa cells after stimulation with Inv397-coated beads were incubated with the labeled NF-{kappa}Bc or IL-8{kappa}Bc probe in the presence or absence of a 100-fold excess of the unlabeled oligonucleotides. NF-{kappa}B consensus (NF-{kappa}Bc), NF-{kappa}B mutant (NF-{kappa}Bm), or IL-8 {kappa}B consensus (IL-8{kappa}Bc) oligonucleotide. B) For supershift analysis, binding assays including probe NF-{kappa}Bc were performed in the presence of polyclonal antibodies recognizing various Rel proteins (p50, p52, p65, c-Rel, and RelB). C) Inhibition of Yersinia-induced IL-8 secretion by NF-{kappa}B inhibitors. HeLa cells were pretreated with different concentrations of MG-132 or Curcumin for 30 min. Subsequently, cells were infected with Y. enterocolitica pYV- or stimulated with TNF-{alpha} for 4 h. IL-8 concentration in supernatants was analyzed by ELISA. Values represent the means ± SD of triplicate samples.

Subsequently, EMSA supershift experiments (including the NF-{kappa}B consensus oligonucleotide probe) were performed and revealed that the addition of anti-p65 antibodies completely shifted the p50-p65 heterodimers, whereas anti-p50 antibodies shifted both p50-p50 and p50-p65 complexes (Fig. 7B ). Moreover, anti-p52 antibodies caused a significant supershift and shifted complexes, including both p50-p50 as well as p50-p65 complexes. In contrast, anti-cRel and anti-RelB antibodies caused slight supershifts.

In addition, we used an NF-{kappa}B/luciferase reporter vector pNF-{kappa}B-Luc. When HeLa cells transfected with pNF-{kappa}B-Luc were infected with bacteria, a two- to threefold stimulation of Luc activity after infection with Y. enterocolitica pYV- and E. coli pINV1914 was observed whereas Y. enterocolitica pYV- inv or E. coli did not stimulate significant levels of Luc activity (not shown). These results further confirm that infection of HeLa cells with Y. enterocolitica pYV- or E. coli pINV1914 leads to activation of NF-{kappa}B.

Inhibition of NF-{kappa}B activation blocks invasin-induced IL-8 secretion
To show a link between NF-{kappa}B activation and IL-8 secretion, inhibitors of NF-{kappa}B activation were used to modulate invasin-triggered IL-8 production. MG-132 blocks NF-{kappa}B activation by specifically interfering with I{kappa}B degradation (55) . Curcumin is an antioxidant that inhibits NF-{kappa}B activation (56 , 57) . HeLa cells were pretreated with various amounts of inhibitors before infection with Y. enterocolitica pYV-. As shown in Fig. 7C , MG-132 and curcumin treatment markedly inhibited Y. enterocolitica-induced IL-8 secretion (by ~ 90% using 20 µM MG-132 and ~ 80% using 40 µM curcumin) (Fig. 7C ). These results indicate that activation of NF-{kappa}B by inv-expressing bacteria leads to IL-8 expression and subsequent secretion.

I{kappa}B{alpha} degradation in HeLa cells infected with invasin-producing E. coli
In the next step, we investigated whether bacteria expressing the inv gene were capable of inducing I{kappa}B degradation in HeLa cells. HeLa cells were infected with E. coli or E. coli pINV1914 and the level of I{kappa}B was determined by Western blot analysis. Infection of HeLa cells with Y. enterocolitica pYV- or E. coli pINV1914 showed only a weak degradation of I{kappa}B{alpha} within 45 to 60 min after infection (data not shown). However, when synthesis of I{kappa}B{alpha} was blocked by treating the cells with cycloheximide prior to the infection, a significant degradation of I{kappa}B{alpha} after stimulation with E. coli pINV1914 or Y. enterocolitica pYV-, but not upon infection with E. coli or Y. enterocolitica pYV- inv, was found (Fig. 8 ). Comparable results were obtained after stimulation with Inv397-coated beads. Significant degradation of I{kappa}Bß was not observed (not shown). These results show that invasin-producing bacteria induce degradation of I{kappa}B{alpha}, an essential early event in the activation of NF-{kappa}B.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 8. I{kappa}B{alpha} degradation in HeLa cells after infection with E. coli or E. coli pINV1914. HeLa cells were infected at a bacterium-to-cell ratio of 100. At indicated times after infection, cytoplasmic cell fractions were analyzed for the presence of I{kappa}B{alpha} by Western blotting using a polyclonal antiserum as described in Materials and Methods.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
An increasing body of evidence suggests that infection of epithelial cells with bacterial pathogens such as H. pylori, S. typhimurium, or enteropathogenic E. coli leads to activation of NF-{kappa}B and IL-8 production and secretion (39 40 41 42 43) . The mechanism by which these different bacterial pathogens induce IL-8 expression and secretion is not yet clear. However, a close contact between the pathogen and the host cells as well as a type III protein secretion machinery is essential for NF-{kappa}B activation by the aforementioned microorganisms (39 40 41 42) . In contrast, Yersinia-induced IL-8 production does not require a type III protein secretion machinery that is encoded by the virulence plasmid pYV of Yersinia. In fact, Y. enterocolitica pYV- bacteria that lack the type III protein secretion system induce IL-8 production, whereas the presence of the pYV plasmid-encoded type III secretion machinery in Y. enterocolitica wild-type strains may even suppress IL-8 secretion (6) . In the light of the present study and in keeping with previous published data (45 , 58) , it is conceivable that suppression of IL-8 secretion by Y. enterocolitica pYV+ may rely on the inhibition of NF-{kappa}B activation by YopP/YopJ.

The most salient finding of this study is that exposure of human epithelial cells to inert bead particles coated with the carboxyl-terminal 195 amino acids of Y. enterocolitica invasin results in degradation of I{kappa}B{alpha}, activation of the transcription factor NF-{kappa}B, and expression of the human IL-8 gene.

The production of IL-8 is largely controlled on the transcriptional level and activated NF-{kappa}B is a prime regulator of IL-8 gene expression in response to different stimuli (34 , 35 , 36 , 51) . In addition to NF-{kappa}B, the human IL-8 promoter contains binding motifs for other transcription factors, i.e., AP-1 and NF-IL-6 (34 , 35) . NF-{kappa}B and NF-IL-6 have been described to synergistically activate IL-8 gene transcription (34 35 36 37 , 59) . In Jurkat T lymphocytes, it has been shown that NF-{kappa}B and members of the NF-IL-6 family functionally cooperate in transcriptional activation of the IL-8 gene (58) . Analysis of IL-8 promoter reporter constructs revealed that the promoter fragment spanning from nucleotide -112 to +44 contains the essential cis-acting elements required to mediate invasin-triggered up-regulation in HeLa cells. This essential IL-8 promoter fragment contains one NF-{kappa}B and two putative NF-IL-6 binding sites. In the experiments presented here, we were not able to demonstrate a contribution of C/EBP family members to control IL-8 expression in HeLa cells by either reporter gene analysis or EMSA analysis. By contrast, NF-{kappa}B is absolutely required for invasin-mediated activation of the IL-8 gene.

By means of electrophoretic mobility shift assays, we showed that NF-{kappa}B p50-p65 heterodimer, p65-p65, and p50-p50 homodimers are activated in HeLa cells after infection with invasin-producing bacteria or exposure to GST-Inv397-coated beads. The IL-8 {kappa}B element appears to preferentially bind p65-p65 homodimers. Exposure of HeLa cells to E. coli pINV1914 or GST-Inv-coated beads induced degradation of I{kappa}B{alpha}, suggesting a mechanisms for activation of NF-{kappa}B (38) . However, in the experimental conditions used here, degradation of I{kappa}B{alpha} in HeLa cells was observed only in the presence of an inhibitor of protein translation, suggesting the induction of rapidly operating feed back loops or a selective induction of I{kappa}B{alpha}, but not I{kappa}Bß, degradation as observed in Listeria monocytogenes-infected cells (60) .

Blocking of invasin-triggered IL-8 secretion by MG132 or curcumin, both of which inhibit NF-{kappa}B, suggests that the induction of IL-8 secretion by invasin in HeLa cells relies significantly on invasin-mediated NF-{kappa}B activation. Similar observations have been reported in H. pylori infection. Thus, inhibition of IL-8 transcription and subsequent secretion by NF-{kappa}B inhibitors have been shown in gastric epithelial cells after Helicobacter pylori infection (40) .

The question that arises now is whether, during Peyer’s patch infection, the proinflammatory action of invasin via activation of NF-{kappa}B or the antiinflammatory action of YopP/YopJ via inhibition of NF-{kappa}B predominates. Preliminary data from our laboratory show that in the early phase of intestinal Yersinia infection, a rapid increase of cytokine and chemokine mRNA expression can be observed, suggesting an activation of NF-{kappa}B. Moreover, previous data from other groups suggest that invasin plays an important role during colonization of Peyer’s patches (31 , 61) . In keeping with these observations, we found that invasin is crucial for translocation of Y. enterocolitica through M cells and that Yersinia bacilli-colonizing Peyer’s patches at least partially express invasin (unpublished results). On the other hand, YopJ plays an important role during intestinal Yersinia infection (58) . Therefore, it is possible that both activation and inhibition of NF-{kappa}B may occur in infected Peyer’s patches and that the resulting ‘netto effect’ may be decisive for the pathogenesis of yersiniosis.

Killed invasin-exposing E. coli pINV1914 could induce nuclear {kappa}B DNA binding activity and IL-8 production in HeLa cells (data not shown), suggesting that the binding of invasin-expressing bacteria to the host cell surface is sufficient to induce signal transduction pathways that lead to NF-{kappa}B activation. More strikingly, inert latex beads coated with purified recombinant GST-Inv protein induced NF-{kappa}B activation as well as elevated levels of IL-8 mRNA and IL-8 secretion. This finding suggests that Y. enterocolitica invasin, a known ligand of host cell ß1 integrins, induces activation of host cell NF-{kappa}B, thereby up-regulating transcription of the IL-8 gene. Nevertheless, at present we cannot exclude that additional bacterial components may be involved in NF-{kappa}B activation by Yersinia. LPS, however, a common bacterial surface component, does not appear to play a role in this process as addition of LPS in the presence or absence of bacteria did not demonstrate any effect on IL-8 transcription or secretion by epithelial cells (data not shown).

In a previous study (33) we showed that inhibition of Y. enterocolitica internalization into epithelial cells by wortmannin, an inhibitor of the PI3-kinase, does not interfere with Yersinia-induced IL-8 secretion. This finding suggests that bacterial adherence rather than bacterial invasion is the trigger for IL-8 secretion by epithelial cells. In keeping with this observation, we found that invasin-mediated activation of NF-{kappa}B in HeLa cells proceeds in the presence of wortmannin. These data are supported by a recent report by Eaves-Pyles and colleagues (42) , which showed that activation of NF-{kappa}B in Caco-2 cells by Salmonella ssp. occurs in the absence of invasion. From these data we can conclude that invasin triggers at least two pathways: one leading to activation to NF-{kappa}B, followed by IL-8 transcription; the other leading to activation of PI3-kinase, followed by internalization of bacteria. Preliminary data from our laboratory suggest that invasin-induced signaling in epithelial cells involves p38 mitogen-activated protein (MAP) kinase, but not MAPKK (G. A. Grassl et al., unpublished results).

The invasin proteins of Y. enterocolitica and Y. pseudotuberculosis are outer membrane proteins that are involved in the penetration of these bacteria into mammalian cells (22) . Invasin binds to ß1 integrins with high affinity. The integrin binding domain of invasin has been mapped to the carboxyl-terminal 192 amino acids of the molecule (62) . Expression of this fragment alone on the cell surface of noninvasive bacteria is sufficient to confer the invasive phenotype of Y. pseudotuberculosis (52) . Binding of invasin to ß1 integrins on epithelial host cells induces tyrosine phosphorylation, cytoskeletal rearrangement, and subsequent internalization of the bacterium into the host cell (24 , 63) . In B cells invasin induces expression of several activation markers and proliferation (64) . In human T cells, invasin provides costimulatory activity through interaction with the ß1 integrins (65) . The mechanisms by which binding of invasin to ß1 integrins leads to these different types of cellular responses are unknown. Considering the findings reported here, it is conceivable that activation of NF-{kappa}B by invasin might be a key step in these cellular responses.

In summary, our data suggest that invasin-coated particles such as bacteria or beads bind to ß1 integrins on the surface of HeLa cells. This leads to activation of NF-{kappa}B, thereby inducing transcription of the IL-8 gene. In human monocytic cell lines, ligand binding of integrin or ligation of ß1 integrins with antibodies causes a rapid tyrosine phosphorylation of proteins (66) . In addition, integrin ligation leads to nuclear translocation of the p50 and p65 subunits of NF-{kappa}B and to increased levels of mRNAs for immediate-early genes, including IL-1ß (67 , 68) . The actual signal transduction pathways leading to activation of NF-{kappa}B in epithelial cells on invasin ligations are a matter of ongoing research.

The specific interaction of Yersinia invasin with ß1 integrins resembles the action principle of pattern recognition molecules/receptors (69) and triggers effector mechanisms of the innate immune system. Hence, Yersinia-induced IL-8 production may account for recruitment of PMN, one of the earliest host responses to infection. However, Yersinia may subvert this host defense mechanisms by switching on plasmid-encoded genes, which render them resistant against phagocytosis by these cells. Invasin binds more efficient to ß1 integrins than the natural ligand, fibronectin, suggesting that invasin represents an optimized surface for integrin binding in comparison with host substrates, possibly as a result of convergent evolution (70) . In keeping with these findings, we found that invasin induces IL-8 responses in epithelial cells to levels nearly as strong as, e.g., the agonist TNF-{alpha}.


   ACKNOWLEDGMENTS
 
We thank Petra Dersch, University of Berlin, for stimulating discussions, Dr. Martin Aepfelbacher and Dr. Wolf-Dietrich Hardt (Munich) for critically reading the manuscript, and Jürgen Heesemann (Munich) for continuous support. R.S. is the recipient of a fellowship from the Bundesministerium für Bildung und Forschung). This work was supported by a grant from the Deutsche Forschungsgemeinschaft.


   FOOTNOTES
 
1 These authors contributed equally to this work.

2 Present address: Plantamed GmbH, Kerschensteinerstr. 11–15, D-92318 Neumarkt OPf, Germany.

Received for publication September 20, 1999. Revision received January 25, 2000.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Eckmann, L., Jung, H. C., Schürer-Maly, C., Panja, A., Morzycka-Wroblewska, E., Kagnoff, M. F. (1993) Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin-8. Gastroenterology 105,1689-1697[Medline]
  2. Eckmann, L., Kagnoff, M. F., Fierer, J. (1993) Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry. Infect. Immun. 61,4569-4574[Abstract/Free Full Text]
  3. Eckmann, L., Kagnoff, M. F., J. Fierer, J. (1995) Intestinal epithelial cells as watchdogs for the natural immune sytem. Trends Microbiol 3,118-120[Medline]
  4. Jung, H. C., Eckmann, L., Yang, S.-K., Panja, A., Fierer, J., Morzycka-Wroblewska, E., Kagnoff, M. (1995) A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Invest. 95,55-65
  5. Savkovic, S. D., Koutsouris, A., Hecht, G. (1997) Activation of NF-{kappa}B in intestinal epithelial cells by enteropathogenic Escherichia coli. Am. J. Physiol. 273,C1160-C1167
  6. Schulte, R., Wattiau, P., Hartland, E. L., Robins-Browne, R. M., Cornelis, G. R. (1996) Differential secretion of interleukin-8 by human epithelial cell lines upon entry of virulent or nonvirulent Yersinia enterocolitica. Infect. Immun. 64,2106-2113[Abstract]
  7. Hoch, R. C., Schraufstatter, I. U., Cochrane, C. G. (1996) In vivo, in vitro, and molecular aspects of interleukin-8 and the interleukin-8 receptors. J. Lab. Clin. Med. 128,134-145[Medline]
  8. Bottone, E. J. (1977) Yersinia enterocolitica. A panoramic view on a charismatic microorganism. Crit. Rev. Microbiol. 5,211-241
  9. Cover, T. L., Aber, R. C. (1989) Yersinia enterocolitica. N. Engl. J. Med. 321,16-24[Medline]
  10. Autenrieth, I. B., Kempf, V., Sprinz, T., Preger, S., Schnell, A. (1996) Defense mechanisms in Peyer’s patches and mesenteric lymph nodes against Yersinia enterocolitica involve integrins and cytokines. Infect. Immun. 64,1357-1368[Abstract]
  11. McCormick, B. A., Nusrat, A., Parkos, C. A., D'Andrea, L., Hofman, P. M., Carnes, D., Liang, T. W., Madara, J. L. (1997) Unmasking of intestinal epithelial lateral membrane beta1 integrin consequent to transepithelial neutrophil migration in vitro facilitates inv-mediated invasion by Yersinia pseudotuberculosis. Infect. Immun. 65,1414-1421[Abstract]
  12. Delor, I., Kaeckenbeek, A., Wauters, G., Cornelis, G. R. (1990) Nucleotide sequence of yst, the Yersinia enterocolitica gene encoding the heat-stable enterotoxin, and prevalence of the gene among the pathogenic and nonpathogenic yersiniae. Infect. Immun. 58,2983-2988[Abstract/Free Full Text]
  13. Isberg, R. R., Voorhis, D. L., Falkow, S. (1989) Mammalian cell adhesion functions and the cellular penetration of enteropathogenic Yersinia species. Mol. Microbiol. 3,1449-1453[Medline]
  14. Miller, V. L., Falkow, S. (1988) Evidence for two genetic loci in Yersinia enterocolitica that can promote invasion of epithelial cells. Infect. Immun. 56,1242-1248[Abstract/Free Full Text]
  15. Pai, C. H., Mors, V. (1978) Production of enterotoxin by Yersinia enterocolitica. Infect. Immun. 19,908-911[Abstract/Free Full Text]
  16. Cornelis, G. R. (1994) Yersinia pathogenicity factors. Curr. Top. Microbiol. Immunol. 192,243-263[Medline]
  17. Cornelis, G. R. (1998) The Yersinia deadly kiss. J. Bacteriol. 180,5495-5504[Free Full Text]
  18. Straley, S. C., Skrzypek, E., Plano, G. V., Plano, J. B. (1993) Yop of Yersinia spp. pathogenic for humans. Infect. Immun. 61,3105-3110[Free Full Text]
  19. Forsberg, A., Rosqvist, R., Wolf-Watz, H. (1994) Regulation and polarized transfer of the Yersinia outer proteins (Yops) involved in antiphagocytosis. Trends Microbiol 2,14-19[Medline]
  20. Lee, W. H., McGrath, P. P., Carter, P. H., Eide, E. L. (1977) The ability of some Yersinia enterocolitica to invade HeLa cells. Can. J. Microbiol. 23,1714-1722[Medline]
  21. Miller, V. L., Finlay, B. B., Falkow, S. (1988) Factors essential for the penetration of mammalian cells by Yersinia. Curr. Top. Microbiol. Immunol. 138,15-39[Medline]
  22. Isberg, R. R., Leong, J. M. (1990) Multiple ß1 chain integrins are receptors for invasin, a protein that promotes bacterial penetration into mammalian cells. Cell 60,861-871[Medline]
  23. Pepe, C. J., Miller, V. (1990) The Yersinia enterocolitica inv gene product is an outer membrane protein that shares epitopes with Yersinia pseudotuberculosis invasin. J. Bacteriol. 172,3780-3789[Abstract/Free Full Text]
  24. Young, V. B., Falkow, S., Schoolnik, G. K. (1992) The invasin protein of Yersinia enterocolitica: internalization of invasin-bearing bacteria by eukaryotic cells is associated with reorganization of the cytoskeleton. J. Cell Biol. 116,197-207[Abstract/Free Full Text]
  25. Miller, V. L., Farmer, J. J., III, Hill, W. E., Falkow, S. (1989) The ail locus is found uniquely in Yersinia enterocolitica serotypes commonly associated with disease. Infect. Immun. 57,121-131[Abstract/Free Full Text]
  26. Heesemann, J., Grüter, L. (1987) Genetic evidence that the outer membrane protein Yop1 of Yersinia enterocolitica mediates adherence and phagocytosis resistance to human epithelial cells. FEMS Microbiol. Lett. 40,37-41
  27. Emsdy, L., Heesemann, J., Wolf-Watz, H., Skurnik, M., Kapperud, G., O’Toole, P., Wadström, T. (1989) Binding to collagen by Yersinia enterocolitica and Yersinia pseudotuberculosis: evidence for yopA-mediated and chromosomally encoded mechanisms. J. Bacteriol. 171,6674-6679[Abstract/Free Full Text]
  28. Skurnik, M., Wolf-Watz, H. (1989) Analysis of the yopA gene encoding the Yop1 virulence determinants of Yersinia spp. Mol. Microbiol. 3,517-529[Medline]
  29. Bliska, J. B., Copass, M. C., Falkow, S. (1993) The Yersinia pseudotuberculosis adhesin YadA mediates intimate bacterial attachment to and entry into Hep-2 cells. Infect. Immun. 61,3914-3921[Abstract/Free Full Text]
  30. Schulze-Koops, H., Burkhardt, H., Heesemann, J., von der Mark, K., Emmrich, F. (1993) Plasmid-encoded outer membrane protein YadA mediates specific binding of enteropathogenic Yersiniae to various types of collagen. Infect. Immun. 60,2153-2159[Abstract/Free Full Text]
  31. Pepe, C. J., Miller, V. (1993) Yersinia enterocolitica invasin: a primary role in the initiation of infection. Proc. Natl. Acad. Sci. USA 90,6473-6477[Abstract/Free Full Text]
  32. Schulte, R., Autenrieth, I. B. (1998) Yersinia enterocolitica-induced interleukin-8 secretion by human intestinal epithelial cells depends on cell differentiation. Infect. Immun. 66,1216-1224[Abstract/Free Full Text]
  33. Schulte, R., Zumbihl, R., Kampik, D., Fauconnier, A., Autenrieth, I. B. (1998) Wortmannin blocks Yersinia invasin-triggered internalization, but not interleukin-8 production by epithelial cells. Med. Microbiol. Immunol. 187,53-60[Medline]
  34. Mukaida, N., Okamoto, S., Ishikawa, Y., Matsushima, K. (1994) Molecular mechanism of interleukin-8 gene expression. J. Leukoc. Biol. 56,554-558[Abstract]
  35. Mukaida, N., Mahe, Y., Matsushima, K. (1990) Cooperative interaction of nuclear factor-{kappa}B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J. Biol. Chem. 265,21128-21133[Abstract/Free Full Text]
  36. Yasumoto, K., Okamoto, S., Mukaida, N., Murakami, S., Mai, M., Matsushima, K. (1992) Tumor necrosis factor alpha and interferon gamma synergistically induce interleukin-8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-{kappa}B-like binding sites of the interleukin 8 gene. J. Biol. Chem. 267,22506-22511[Abstract/Free Full Text]
  37. Matsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Matsushima, K., Kishimoto, T., Akira, S. (1993) Transcription factors NF-IL-6 and NF-{kappa}B synergistically activate transcription of the inflammatory cytokines, interleukin-6 and interleukin-8. Proc. Natl. Acad. Sci. USA 90,10193-10197[Abstract/Free Full Text]
  38. Baeuerle, P. A. (1998) Pro-inflammatory signaling: last pieces in the NF-kappaB puzzle?. Curr. Biol. 8,19-21[Medline]
  39. Keates, S., Hitti, Y. S., Upton, M., Kelly, C. P. (1997) Helicobacter pylori infection activates NF-{kappa}B in gastric epithelial cells. Gastroenterology 113,1099-1109[Medline]
  40. Münzenmaier, A., Lange, Ch, Glocker, E., Covacci, A., Moran, A., Bereswill, S., Baeuerle, P. A., Kist, M., Pahl, H. L. (1997) A secreted/shed product of Helicobacter pylori activates transcription factor nuclear factor-{kappa}B. J. Immunol. 159,6140-6147[Abstract]
  41. Sharma, S., Tummuru, M. K. R., Blaser, M. J., Kerr, L. D. (1998) Activation of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor-{kappa}B in gastric epithelial cells. J. Immunol. 160,2401-2407[Abstract/Free Full Text]
  42. Eaves-Pyles, T., Szabo, C., Salzman, A. L. (1999) Bacterial invasion is not required for activation of NF-{kappa}B in enterocytes. Infect. Immun. 67,800-804[Abstract/Free Full Text]
  43. Elewaut, D., DiDonato, J. A., Kim, J. M., Troung, F., Eckmann, L., Kagnoff, M. F. (1999) NF-{kappa}B is a central regulator of the intestinal epithelial cell innate immune response induced by infection with enteroinvasive bacteria. J. Immunol. 163,1457-1466[Abstract/Free Full Text]
  44. Heesemann, J., Grüter, L. (1983) Construction of a mobilizable Yersinia enterocolitica virulence plasmid. J. Bacteriol. 155,761-767[Abstract/Free Full Text]
  45. Ruckdeschel, K., Roggenkamp, A., Schubert, S., Heesemann, J. (1996) Differential contribution of Yersinia enterocolitica virulence factors to evasion of microbicidal action of neutrophils. Infect. Immun. 64,724-733[Abstract]
  46. Nakamura, H., Yoshimura, K., Jaffe, H. A., Crystal, R. G. (1991) Interleukin-8 gene expression in human bronchial epithelial cells. J. Biol. Chem. 266,19611-19617[Abstract/Free Full Text]
  47. Kunsch, C., Rosen, C. A. (1993) NF-{kappa}B subunit-specific regulation of the interleukin-8 promoter. Mol. Cell. Biol. 13,6137-6146[Abstract/Free Full Text]
  48. Young, V. B., Miller, V. L., Falkow, S., Schoolnik, G. K. (1990) Sequence, localization and function of the invasin protein of Yersinia enterocolitica. Mol. Microbiol. 4,1119-1128[Medline]
  49. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual 2nd Ed Cold Spring Harbor Laboratory Press Cold Spring Harbor, New York.
  50. Schreiber, E., Matthias, P., Mueller, M. M., Schaffner, (1989) Rapid detection of octamer binding proteins with ‘mini-extracts’ prepared from a small number of cells. Nucleic Acids Res 17,6419[Free Full Text]
  51. Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T. (1995) MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23,4878-4884[Abstract/Free Full Text]
  52. Leong, J. M., Fournier, R. S., Isberg, R. R. (1990) Identification of the integrin binding domain of the Yersinia pseudotuberculosis invasin protein. EMBO J 9,1979-1989[Medline]
  53. Dersch, P., Isberg, R. R. (1999) A region of the Yersinia pseudotuberculosis invasin protein enhances integrin-mediated uptake into mammalian cells and promotes self-association. EMBO J 18,1199-1213[Medline]
  54. Kunsch, C., Lang, R. K., Rosen, C. A., Shannon, M. F. (1994) Synergistic transcriptional activation of the IL-8 gene by NF-{kappa}B p65 (RelA) and NF-IL-6. J. Immunol. 153,153-164[Abstract]
  55. Grisham, M. B., Palombella, V. J., Elliott, P. J., Conner, E. M., Brand, S., Wong, H. L., Pien, C., Mazzola, L. M., Destree, A., Parent, L., Adams, J. (1999) Inhibition of NF-kappa B activation in vitro and in vivo: role of 26S proteasome. Methods Enzymol 300,345-363[Medline]
  56. Schreck, R., Baeuerle, P. A. (1991) A role of oxygen radicals as second messengers. Trends Cell Biol 1,39[Medline]
  57. Schreck, R., Rieber, P., Baeuerle, P. A. (1991) Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kappa B transcription factor and HIV-1. EMBO J 10,2247-2258[Medline]
  58. Monack, D. M., Mecsas, J., Bouley, D., Falkow, S. (1998) Yersinia-induced apoptosis in vivo aids in the establishment of a systemic infection of mice. J. Exp. Med. 188,2127-2137[Abstract/Free Full Text]
  59. Mastronarde, J. G., He, B., Monick, M. M., Mukaida, N., Matsushima, K., Hunninghake, G. W. (1996) Induction of interleukin (IL)-8 gene expression by respiratory syncytial virus involves activation of nuclear factor (NF)-{kappa}B and NF-IL-6. J. Infect. Dis. 174,262-267[Medline]
  60. Hauf, N., Goebel, W., Fiedler, F., Sokolovic, Z., Kuhn, M. (1997) Listeria monocytogenes infection of P 388D1 macrophages results in a biphasic NF-{kappa}B(RelA/p50)activation induced by lipoteichoic acid and bacterial phospholipases and mediated by I{kappa}-B{alpha} and I{kappa}-Bß degradation. Proc. Natl. Acad. Sci. USA 94,9394-9399[Abstract/Free Full Text]
  61. Clark, M. A., Barry, H. H., Jepson, M. A. (1998) M-cell surface beta 1 integrin expression and invasin-mediated targeting of Yersinia pseudotuberculosis to mouse Peyer’s patch M cells. Infect. Immun. 66,1237-1243[Abstract/Free Full Text]
  62. Van Nhieu, G. T., Isberg, R. R. (1991) The Yersinia pseudotuberculosis invasin protein and human fibronectin bind to mutually exclusive sites on the {alpha}5 ß1 integrin receptor. J. Biol. Chem. 266,24367-24275[Abstract/Free Full Text]
  63. Rosenshine, I., Duronio, V., Finlay, B. (1992) Tyrosine protein kinase inhibitors block invasin-promoted bacterial uptake by epithelial cells. Infect. Immun. 60,2211-2217[Abstract/Free Full Text]
  64. Lundgren, E., Carballeira, N., Vazquez, R., Dubinina, E., Bränd’en, H., Persson, H., Wolf-Watz, H. (1996) Invasin of Yersinia pseudotuberculosis activates human peripheral B cells. Infect. Immun. 64,829-835[Abstract]
  65. Brett, S. J., Mazurov, A. V., Charles, I. G., Tite, J. P. (1993) The invasin protein of Yersinia ssp. provides co-stimulatory activity to human T cells through interaction with beta1 integrins. Eur. J. Immunol. 23,1608-1614[Medline]
  66. Kornberg, L. J., Earp, H. E., Turner, C. E., Prockop, C., Juliano, R. L. (1991) Signal transduction by integrins: increased tyrosine phosphorylation caused by clustering of ß1 integrins. Proc. Natl. Acad. Sci. USA 88,8392-8396[Abstract/Free Full Text]
  67. Lin, T. H., Rosales, C., Mondal, K., Bolent, J. B., Haskill, S., Juliano, R. L. (1995) Integrin-mediated tyrosine phosphorylation and cytokine message induction in monocytic cells. J. Biol. Chem. 270,16189-16197[Abstract/Free Full Text]
  68. Yurochko, A. D., Liu, D. Y., Eiermann, D., Haskill, S. (1992) Integrins as a primary signal transduction molecule regulating monocyte immediate-early gene induction. Proc. Natl. Acad. Sci. USA 89,9034-9038[Abstract/Free Full Text]
  69. Hoffmann, J. A., Kafatos, F. C., Janeway, C. A., Jr, Ezekowitz, R. A. B. (1999) Phylogenetic perspectives in innate immunity. Science 284,1313-1318[Abstract/Free Full Text]
  70. Hamburger, Z. A., Brown, M. S., Isberg, R. R., Bjorkman, P. J. (1999) Crystal structure of invasin: a bacterial integrin-binding protein. Science 286,291-295[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
A. Rodrigues, D. B.C. Queiroz, L. Honda, E. J. R. Silva, S. H. Hall, and M. C. W. Avellar
Activation of Toll-Like Receptor 4 (TLR4) by In Vivo and In Vitro Exposure of Rat Epididymis to Lipopolysaccharide from Escherichia Coli
Biol Reprod, December 1, 2008; 79(6): 1135 - 1147.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. S. Frick, K. Fink, F. Kahl, M. J. Niemiec, M. Quitadamo, K. Schenk, and I. B. Autenrieth
Identification of Commensal Bacterial Strains That Modulate Yersinia enterocolitica and Dextran Sodium Sulfate-Induced Inflammatory Responses: Implications for the Development of Probiotics
Infect. Immun., July 1, 2007; 75(7): 3490 - 3497.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. O'Kane, J. J. Boyle, D. E. Horncastle, P. T. Elkington, and J. S. Friedland
Monocyte-Dependent Fibroblast CXCL8 Secretion Occurs in Tuberculosis and Limits Survival of Mycobacteria within Macrophages
J. Immunol., March 15, 2007; 178(6): 3767 - 3776.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
A. McNally, T. Dalton, R. M. L. Ragione, K. Stapleton, G. Manning, and D. G. Newell
Yersinia enterocolitica isolates of differing biotypes from humans and animals are adherent, invasive and persist in macrophages, but differ in cytokine secretion profiles in vitro.
J. Med. Microbiol., December 1, 2006; 55(Pt 12): 1725 - 1734.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Suzuki, Y. Yoshikawa, H. Ashida, H. Iwai, T. Toyotome, H. Matsui, and C. Sasakawa
High Vaccine Efficacy against Shigellosis of Recombinant Noninvasive Shigella Mutant That Expresses Yersinia Invasin
J. Immunol., October 1, 2006; 177(7): 4709 - 4717.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
O. T. Buhler, C. A. Wiedig, Y. Schmid, G. A. Grassl, E. Bohn, and I. B. Autenrieth
The Yersinia enterocolitica Invasin Protein Promotes Major Histocompatibility Complex Class I- and Class II-Restricted T-Cell Responses
Infect. Immun., July 1, 2006; 74(7): 4322 - 4329.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Doerre, K. P. Mesires, K. M. Daley, T. McCarty, S. Knoetig, and R. B. Corley
Reductions in I{kappa}B{epsilon} and Changes in NF-{kappa}B Activity during B Lymphocyte Differentiation
J. Immunol., January 15, 2005; 174(2): 983 - 991.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Schmid, G. A. Grassl, O. T. Buhler, M. Skurnik, I. B. Autenrieth, and E. Bohn
Yersinia enterocolitica Adhesin A Induces Production of Interleukin-8 in Epithelial Cells
Infect. Immun., December 1, 2004; 72(12): 6780 - 6789.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. Riess, S. G.E. Andersson, A. Lupas, M. Schaller, A. Schafer, P. Kyme, J. Martin, J.-H. Walzlein, U. Ehehalt, H. Lindroos, et al.
Bartonella Adhesin A Mediates a Proangiogenic Host Cell Response
J. Exp. Med., November 15, 2004; 200(10): 1267 - 1278.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Yoshida, A. Kumar, Y. Koyama, H. Peng, A. Arman, J. A. Boch, and P. E. Auron
Interleukin 1 Activates STAT3/Nuclear Factor-{kappa}B Cross-talk via a Unique TRAF6- and p65-dependent Mechanism
J. Biol. Chem., January 16, 2004; 279(3): 1768 - 1776.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Haase, C. J. Kirschning, A. Sing, P. Schrottner, K. Fukase, S. Kusumoto, H. Wagner, J. Heesemann, and K. Ruckdeschel
A Dominant Role of Toll-Like Receptor 4 in the Signaling of Apoptosis in Bacteria-Faced Macrophages
J. Immunol., October 15, 2003; 171(8): 4294 - 4303.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
D. Boulanger, F. Bureau, D. Melotte, J. Mainil, and P. Lekeux
Increased Nuclear Factor {kappa}B Activity in Milk Cells of Mastitis-Affected Cows
J Dairy Sci, April 1, 2003; 86(4): 1259 - 1267.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Hauf and T. Chakraborty
Suppression of NF-{kappa}B Activation and Proinflammatory Cytokine Expression by Shiga Toxin-Producing Escherichia coli
J. Immunol., February 15, 2003; 170(4): 2074 - 2082.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
K. H. Mellits, J. Mullen, M. Wand, G. Armbruster, A. Patel, P. L. Connerton, M. Skelly, and I. F. Connerton
Activation of the transcription factor NF-{kappa}B by Campylobacter jejuni
Microbiology, September 1, 2002; 148(9): 2753 - 2763.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. Grosdent, I. Maridonneau-Parini, M.-P. Sory, and G. R. Cornelis
Role of Yops and Adhesins in Resistance of Yersinia enterocolitica to Phagocytosis
Infect. Immun., August 1, 2002; 70(8): 4165 - 4176.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
L. R. James, D. Tang, A. Ingram, H. Ly, K. Thai, L. Cai, and J. W. Scholey
Flux Through the Hexosamine Pathway Is a Determinant of Nuclear Factor {kappa}B- Dependent Promoter Activation
Diabetes, April 1, 2002; 51(4): 1146 - 1156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SCHULTE, R.
Right arrow Articles by AUTENRIETH, I. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SCHULTE, R.
Right arrow Articles by AUTENRIETH, I. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS