FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by SCHIAVONE, N.
Right arrow Articles by CAPACCIOLI, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by SCHIAVONE, N.
Right arrow Articles by CAPACCIOLI, S.
(The FASEB Journal. 2000;14:174-184.)
© 2000 FASEB

A conserved AU-rich element in the 3' untranslated region of bcl-2 mRNA is endowed with a destabilizing function that is involved in bcl-2 down-regulation during apoptosis

NICOLA SCHIAVONE*,1, PAOLO ROSINI*,1, ALESSANDRO QUATTRONE*,1,2, MARTINO DONNINI*, ANDREA LAPUCCI*, LORENZO CITTI, ANNA BEVILACQUA§, ANGELO NICOLIN§3 and SERGIO CAPACCIOLI*3

* Department of Experimental Pathology and Oncology, University of Florence, Florence, Italy;
Institute of Mutagenesis and Differentiation, CNR, Pisa, Italy; and
§ Department of Pharmacology, University of Milan, Milan, Italy

3Correspondence: Sergio Capaccioli, Department of Experimental Pathology and Oncology, University of Florence, Viale G.B. Morgagni 50, 50134 Florence, Italy. E-mail: sergio{at}cesit1.unifi.it; or Angelo Nicolin, Department of Pharmacology, University of Milan, Via Vanvitelli 32, 20129 Milan, Italy. E-mail: angelo.nicolin{at}unimi.it


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The control of mRNA stability is becoming recognized as a crucial point of gene expression regulation. A common element responsible for mRNA decay modulation is the adenine- and uracil-rich element that is found in the 3' untranslated region of numerous mRNAs subjected to fast expression changes in response to various stimuli. Previously we identified a post-transcriptional regulation level for the antiapoptotic bcl-2 gene, which could be involved in t(14;18) lymphoma-associated bcl-2 overexpression. Here we demonstrate that bcl-2 mRNA is endowed with an adenine- and uracil-rich element (ARE) characterized by high evolutionary conservation not only among all chordates examined, but even between chordates and the nematode Caenorhabditis elegans (ced-9 gene). As for other well-established destabilizing AREs, the insertion of the bcl-2 ARE downstream from stable ß-globin mRNA causes an enhanced decay of the ß-globin transcript, which proves its functional role. This possibility is corroborated by the fact that the pathway leading to the modulating activity of bcl-2 ARE is influenced by PKC, since the addition of DAG and TPA markedly attenuated the bcl-2 ARE destabilizing potential. Conversely, it is noteworthy that when C2-ceramide is added to the culture medium as the apoptotic agent, the ß-globin transcript harboring the bcl-2 ARE undergoes a dramatic increase in decay. This observation clearly indicates that the destabilizing function of bcl-2 ARE is enhanced by apoptotic stimuli and suggests that this element could be involved in a post-transcriptional mechanism of bcl-2 down-regulation during apoptosis. The half-life of the mRNA of bcl-2 in Jurkat cells is prolonged by PKC stimulation and shortened by C2-ceramide addition, strongly supporting the view that bcl-2 mRNA stability plays a physiological role in modulating bcl-2 expression, particularly in its down-regulation during apoptosis. Thus, this element becomes a new candidate for mediating those bcl-2 gene expression changes—from apoptosis-associated down-regulation to tumor-associated overexpression—observed thus far that profoundly influence single cell fate and tissue homeostasis. Schiavone, N., Rosini, P., Quattrone, A., Donnini, M., Lapucci, A., Citti, L., Bevilacqua, A., Nicolin, A., Capaccioli, S. A conserved AU-rich element in the 3' untranslated region of bcl-2 mRNA is endowed with a destabilizing function that is involved in bcl-2 down-regulation during apoptosis.


Key Words: bcl-2 regulation • RNA decay • RNA half-life • gene regulation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The bcl-2 gene is a key determinant of neoplastic cell expansion whose oncogenic activity has been ascribed primarily to its ability to promote cell survival (reviewed in 1 ). This effect is due to a block or delay of the apoptotic execution pathway exerted when bcl-2 acts both as a mitochondrial ion channel and as a docking protein (2) . In line with its biological function, bcl-2 expression modulation, either up or down, has dramatic effects on cell fate. Up-regulation of bcl-2 expression by cytokines such as interleukin 5 (IL-5), IL-6, IL-7, interferon {alpha} (IFN{alpha}) (3 4 5 6) , and other signaling factors such as basic fibroblast growth factor and tumor necrosis factor {alpha} (TNF-{alpha}) (7 8) is associated with prolonged survival and apoptotic protection in hematopoietic cell lines, while the expression of viral and cellular genes such as LMP-1 from EBV (9) , c-myb, and K-ras, (10 11) also protects from cell death by enhancing bcl-2 expression. Vice versa, IL-2 or IL-3 removal from cytokine-dependent cell lines (12 13) down-regulates bcl-2 levels, an effect also obtained with Fas activation and p53 overexpression (14 15) . This down-regulation is invariably associated with apoptosis or with enhanced susceptibility to apoptosis-triggering agents. The link between bcl-2 down-regulation and apoptosis is supported by a substantial body of literature showing how a wide variety of apoptotic stimuli exert their death-inducing effect in vitro and in vivo while down-regulating bcl-2. In addition, experiments of antisense oligonucleotide-mediated bcl-2 ‘knockdown’ demonstrate that the reduction in bcl-2 expression under a critical threshold is per se apoptogenic (16) . These data strongly suggest that a programmed fall in Bcl-2 protein levels occurring at a certain point during cell death is a fundamental step of permissiveness for different apoptotic pathways, such as those primed by Fas and TNF-{alpha} receptor binding, ceramide production, and DNA damaging agents (14 , 17) .

Given its fundamental importance for cell fate, bcl-2 expression control has been the object of numerous studies of transcriptional (18 19) , translational (20) , and post-translational (21 22) regulation. Little or no attention has been dedicated to bcl-2 mRNA stabilization as a control point.

We previously identified in t(14;18) lymphoma B cell lines a hybrid bcl-2/IgH antisense transcript that starts from the IgH locus and, encompassing the bcl-2/IgH fusion point, spans the 3' untranslated region of the bcl-2 gene (23) . Targeting this antisense bcl-2/IgH transcript with complementary oligonucleotides resulted in the down-regulation of bcl-2 mRNA and Bcl-2 protein, culminating in the massive apoptosis of treated cells (24) . On the basis of these observations, we postulated that the bcl-2/IgH antisense transcript could be responsible for stabilizing the relevant mRNA probably by inactivating some negative regulatory elements. The adenine- and uracil-rich elements (AU-rich elements, AREs) have been described in the 3'-UTR of numerous mRNA of cytokines and proto-oncogenes. AREs comprise a major group of cis-acting elements that target these mRNAs for rapid degradation (25 26) . AREs have been divided into two main classes. Class I AREs, found mainly in proto-oncogenes, contain one to three copies of dispersed AUUUA motifs in an U-rich region and mediate distributive synchronous poly(A) shortening, followed by degradation of mRNA body. Class II AREs are found mainly in cytokines and contain multiple clusters of AUUUA motifs. These AREs direct asynchronous deadenylation, suggesting a processive poly(A) digestion, followed by mRNA decay (26 27 28) . The mechanism by which AREs exert a post-transcriptional control of gene expression appears to be mediated by their interaction with cytoplasmic and nuclear RNA binding proteins, whose role in modulating mRNA stability remains to be clarified (29 30 31 32 33 34 35) . ARE deletions have been described as being associated with the activation of some proto-oncogenes, such as c-fos (36) and c-myc (37) , suggesting a role for these sequences in the control of gene expression.

Here we describe a new modulation mechanism of bcl-2 expression based on a conserved ARE present in the untranslated region (3'UTR) of the bcl-2 mRNA that appears to be involved in bcl-2 down-regulation during apoptosis and could therefore play a key role in numerous physiological and pathological states.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell cultures and treatments
The mouse fibroblast NIH 3T3 cell line and the human T-leukemia Jurkat cell line were used for this study. NIH 3T3 fibroblasts, transfected as described below, were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% calf serum (CS), 2 mM glutamine, 50 IU/ml penicillin, and 50 µg/ml streptomycin in a humidified atmosphere of 10% CO2 at 37°C. The Jurkat cells were maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) and the same glutamine and antibiotic concentrations as above in 5% CO2 at 37°C. Protein kinase C (PKC) was activated with 50 nM 12-O-tetradecanoylphorbol-13-acetate (TPA) or 5 µM DAG (both from Calbiochem, La Jolla, Calif.), which was added either at the time of serum stimulation (NIH 3T3 cells) or 6 h after transcriptional block (Jurkat cells) induced by DRB (20 µg/ml; Sigma, St. Louis, Mo.). Apoptosis was triggered by adding 50 µM C2-ceramide (Sigma) either 2 h after serum stimulation (NIH 3T3 cells) or at the time of DRB addition (Jurkat cells).

Plasmids
Plasmids inserted with the rabbit ß-globin gene transcriptionally driven by the serum-inducible c-fos promoter, fused or not with the c-fos ARE in the 3' UTR [namely pBBB+ARE or pBBB4, respectively (38) ], were obtained from Dr. Ann-Bin Shyu (University of Texas, Houston Health Science Center Medical School, Houston, Tex.). An analogous plasmid (pBBB-U1) inserted with the bcl-2 ARE was produced as follows. The 5' primer AGATCTAGTCAACATGCCTGC and the 3' primer GGATCCGGTGATCCGGCCAACAAC (flanked at the 5'-end by BglII or BamHI restriction sites, respectively) were used in a polymerase chain reaction (PCR) to amplify the 396 bp U1 segment containing the 3' UTR ARE sequence from the human bcl-2 cDNA fragment 58 (39) . This U1 segment was first cloned in the TA cloning site of the pCR-II plasmid according to the TA Cloning Kit specifications (Invitrogen Corporation, San Diego, Calif.) in order to produce the pCRII-U1 plasmid. The BglII/BamHI fragment excised from pCRII-U1 was subcloned in the BglII unique site of the rabbit ß-globin encoding plasmid, pBBB4, to produce pBBB-U1. The pBS{Delta}ß plasmid was constructed based on the pBBB4 plasmid, from which a 1.9 Kb EcoRI/BamHI fragment (with a portion of the rabbit ß-globin included) was excised and inserted into pBluescript-SK polylinker (Stratagene, La Jolla, Calif.). In this manner the rabbit ß-globin gene resulted in an antisense orientation with respect to the T3 promoter. All constructs were verified by DNA sequencing. The pGAPM plasmid (40) containing a portion of the human glyceraldeyde-3-phosphate dehydrogenase (GAPDH) coding region was obtained from Dr. Gregory J. Goodall (Hanson Center for Cancer Research, Adelaide, Australia). The puromycin resistance-encoding plasmid pBABE-puro was obtained from Dr. Gerard I. Evan (Imperial Cancer Research Fund, London, U.K.). The RNA marker was obtained using the RNA Marker Template Set (Sigma).

Cell transfections
NIH 3T3 fibroblasts were cotransfected with either pBBB4, pBBB+ARE, or pBBB-U1 and the puromycin resistance-encoding plasmid pBABE-puro at a 20:1 ratio, using the calcium phosphate method. A day after transfection, 2 µg/ml puromycin was added to select for positive clones. After 2 wk of growth, selected clones were pooled to avoid homogeneity of the plasmid integration site and frozen in liquid nitrogen according to standard procedures.

mRNA decay experiments
The effects either of PKC stimulation or of C2-ceramide-mediated apoptosis induction on bcl-2 mRNA stability were evaluated in Jurkat cells by reverse transcriptase (RT)-PCR (see below) in DRB-mediated transcriptional block conditions. The effect of bcl-2 ARE insertion on ß-globin mRNA stability was determined by the serum-inducible transcriptional pulse system described by Shyu et al. (38) . Transfected NIH 3T3 cells were serum-starved in DMEM supplemented with 0.5% CS for 24 h and stimulated by the addition of 15% FCS. Cells were collected at time intervals; total RNA was extracted by Ultraspec RNA (Biotech Laboratories, Inc. Houston, Tex.) and quantitated by an RNase protection assay (Boehringer Mannheim, Mannheim, Germany) carried out according to the manufacturer’s specifications. Rabbit ß-globin mRNA and its derivatives were detected by a 238-nucleotide 32P-labeled RNA probe obtained from the NcoI-linearized pBS{Delta}ß, using the T3 RNA polymerase (Boehringer Mannheim). This probe hybridizes to a 188-nucleotide segment of the rabbit ß-globin mRNA complementary to a region located within the second exon. GAPDH mRNA, used as the internal standard, was detected by a 32P-labeled RNA probe obtained from the pGAPM plasmid digested with DdeI, using the T7 RNA polymerase (Promega, Madison, Wis.). This probe hybridizes to a 120-nucleotide stretch of the endogenous murine GAPDH mRNA (40) . Labeled transcripts were produced by incorporation of [{alpha}-32P] UTP (800 Ci/mmol; Amersham, Amersham, U.K.) using an RNA labeling kit according to Amersham’s instructions. Electrophoresis was done on a 6% polyacrylamide, 8 M urea gel and the radioactive bands were detected and quantified with a Storm PhosphorImager and Image QuaNT software (Molecular Dynamics, Sunnyvale, Calif.).

Quantitation of bcl-2 mRNA by RT-PCR
Total RNA was extracted by Ultraspec RNA (Biotech Laboratories) at the times indicated and quantitated by a highly sensitive, semiquantitative RT-PCR protocol essentially as described previously (41) . In brief, 5 µg of total RNA was reverse transcribed by 2000 U of Mo-MLV reverse transcriptase (Promega) with random examers (12.5 µM); the 50 µl reaction contained 50 mM Tris (pH 8.3), 75 mM KCl, 3 mM MgCl2, 1 mM DTT, 500 µM each dATP, dTTP, dCTP, dGTP, and 10 U Rnasin (Promega). The following conditions were used for the PCR reactions: 2 µl of cDNA, 1x reaction buffer (Dynazime), 2.5 mM MgCl2, 200 µM dNTP, 1 µM of each primer, and 2 U Taq DNA polymerase (Dynazime) in a total volume of 50 µl. DNA was denatured for 1 min at 94°C prior to 28 (bcl-XL and ß-actin) or 32 (bcl-2) PCR cycles, obtaining amounts of amplification products falling within the range of PCR amplification linearity. The primers for bcl-2 cDNA were located in separate exons in genomic DNA so that we could eliminate the possibility of genomic DNA contamination. The sequences of bcl-2 primers were 5' GGA CAA CAT CGC CCT GTG 3' (sense primer), 5'AGT CTT CAG AGA CAG CCA GGA 3' (antisense primer) leading to a 148-bp product; the sequences for bcl-XL primers (173-bp product) where 5' CCA TGG GGT AAA CTG GGG TCG CAT T 3' (sense primer), 5' GGG CCC AGC CGC CGT TCT CCT GGA T 3' (antisense primer); ß-actin sense primer: 5' GCG GGA AAT CGT GCG TGA CAT T 3', ß-actin antisense primer: 5' GAT GGA GTT GAA GGT AGT TTC GTG 3' (234-bp product). The PCR products were run on 2% agarose gels with 50 base pair ladder marker (Pharmacia Biotech, Brussels, Belgium). The amplified DNA was stained with ethidium bromide and the fluorescence intensity was quantitated using standard densitometric software. PCR products relative to bcl-2 mRNA were normalized to the values of PCR products relative to either the ß-actin or the bcl-XL mRNAs used as internal standards.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The 3'-UTR of bcl-2 contains a evolutionary conserved AU-rich sequence
Cis-acting AREs endowed with putative RNA destabilizing properties are present in many short-lived mammalian mRNAs for cytokines and transcription factors (26) . We identified in the 3' untranslated region (3' UTR) of the bcl-2 mRNA a 107-nucleotide element endowed with the features known for other mRNA destabilizing AREs, i.e., the very high prevalence of A and U residues and the presence of a cluster with repetitions of the pentamer AUUUA, comprising the UUAUUUAUU motif that has been demonstrated to be a key mRNA destabilization determinant (40 , 42) . Based on this structure, bcl-2 ARE has all the requisites of a class II ARE according to the classification proposed by Chen and Shyu (26) . A phylogenetic analysis clearly shows the remarkably high evolutive conservation of this element being shared by the human, mouse, and chicken bcl-2 genes and by the bcl-2 hortologue in the nematode Caenorhabditis elegans, the ced-9 gene (Fig. 1 ). Although only mammals contain the complete UUAUUUAUU motif, the homology of the 107-nucleotide bcl-2 ARE was very high in all the chordates examined (91% human vs. mouse, 79% human vs. chicken, 77% mouse vs. chicken) and, at a lower degree, even between chordates and C. elegans (69% human vs. C. elegans, 67% mouse vs. C. elegans and 75% chicken vs. C. elegans). This last degree of conservation is particularly remarkable considering the great evolutive distance separating chordates from nematodes, the relatively low amino acid identity between the bcl-2 and ced-9 gene products (43) , and the lower level of homology present in the 3' UTR regions flanking this ARE (not shown).



View larger version (24K):
[in this window]
[in a new window]
  		Figure 1. An evolutionary conserved AU-rich element is present in the 3' UTR of the bcl-2 gene. A nucleotide alignment of an upstream portion of the 3'-UTR of the bcl-2 mRNA gene was performed comparing the human (H. sapiens), mice (M. musculus), chicken (G. gallus) bcl-2, and nematode (C. elegans) ced-9 sequences (Genbank accession numbers on the right). The number of the first nucleotide of the conserved stretch is indicated. A(Un)A motifs are shown in boldface and AUUUA motifs are underlined. A consensus sequence defined by the sharing of nucleotides by three (lowercase) or all species considered (uppercase) is reported at the bottom. The multiple alignment comparison is a manually adjusted result of a ClustalW algorithm output.

Destabilizing activity of the bcl-2 ARE
The functional activity of the bcl-2 ARE as an mRNA destabilizing factor was tested by a combination of two well-established strategies (38 , 39) . NIH 3T3 cells stably transfected with a rabbit ß-globin gene (reporter gene) fused in 3' to the human bcl-2 ARE and transcriptionally driven by the c-fos serum-inducible promoter (BBB-U1 cells, with ß-globin upstream from the bcl-2 ARE) were used for this purpose. NIH 3T3 cells transfected with the same ß-globin gene but harboring instead the c-fos ARE (BBB+ARE cells, with ß-globin upstream from the c-fos ARE) or without any insert (BBB4 cells, with ß-globin alone) were used as positive or negative controls, respectively. In these models, one rapid on-off switching of the reporter genes’ transcriptional activity is induced when serum is added after serum starvation, avoiding the administration of general transcriptional inhibitors. After isolation of total RNA, the mRNA levels of the reporter genes and that of GAPDH (used as the internal standard) were assessed by RNase protection. A 24 h serum starvation, followed by 15% fetal serum addition induced a transient transcriptional pulse of the transfected chimeric gene, which reached a maximum within 2 h (Fig. 2A ). After 6 h, the ß-globin mRNA devoid of any insert appeared to be at about the same maximal level, indicating a very slow degradation rate, whereas the ß-globin mRNAs with either the c-fos ARE or the bcl-2 ARE inserted underwent a significant marked decay, which appeared less pronounced for the bcl-2 ARE than for the c-fos ARE. Gel band quantification gave the final point value of -60% for the bcl-2 ARE and -83% for the c-fos ARE compared to the ß-globin negative control (Fig. 2B ).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 2. The bcl-2 ARE is an mRNA destabilizing element. NIH 3T3 cells were stably transfected with the chimeric constructs pBBB4 (rabbit ß-globin gene) and pBBB-U1 (rabbit ß-globin gene upstream to human bcl-2 ARE). After serum starvation, 15% FCS was added and total RNA was extracted from the transfected cell lines at the indicated time intervals. A) Representative PAGE analysis after RNase protection assay using two probes matching with a 188-nucleotide segment of the rabbit ß-globin mRNA or a 120-nucleotide segment of the murine GAPDH mRNA, respectively. B) PhosphorImager-derived values of the ß-globin protected fragments have been normalized for the relevant values of the endogenous GAPDH-protected fragments. Results are the mean ± SE of five independent experiments (P<0.0003 at the 8th h).

More detailed time course experiments carried out in the same system for up to 8 h (Fig. 3A ) indicated that the insertion of bcl-2 ARE induced a decay of the stable ß-globin mRNA corresponding to a half-life of ~4 h, while the c-fos ARE was responsible for shortening the half-life of ß-globin mRNA to 3 h (Fig. 3B ).



View larger version (29K):
[in this window]
[in a new window]
  		Figure 3. Kinetic pattern of rabbit ß-globin mRNA degradation by the bcl-2 and c-fos AREs. pBBB-U1- and pBBB+ARE-transfected NIH 3T3 cells (BBB+ARE, rabbit ß-globin gene upstream to human c-fos ARE) were subjected to the same treatment as in Fig. 2 ; RNA extractions were carried out at indicated times in order to evaluate the rabbit ß-globin half-life modulation by bcl-2 ARE or c-fos ARE. A, B) As in the legend of Fig. 2 . Results are the mean ± SE of three experiments.

PKC-mediated modulation of bcl-2 ARE activity
Although almost nothing is known about the pathways leading to mRNA modulation by the AREs, a role in this process has been proposed for PKC due principally to the increase in the steady-state levels of some ARE-bearing cytokine mRNAs (reviewed in ref 26 ). The possibility that the bcl-2 ARE function is affected by PKC activation has been verified using the previously described transcriptional pulse system of the BBB-U1-transfected NIH 3T3 fibroblasts (where the ß-globin gene fused to the bcl-2 ARE is transcriptionally driven by the serum inducible c-fos promoter). After serum addition, cells were treated with TPA (50 nM) or DAG (5 µM) for a maximum of 8 h to stimulate PKC. Total RNA was extracted and decay of the reporter gene was evaluated by RNase protection. Figure 4 shows that TPA- and DAG-induced stimulation of PKC provoked a significant attenuation of the ß-globin-monitored, destabilizing activity of bcl-2 ARE both at the 4th (+111% with TPA; +44% with DAG) and 8th hour (+72% with TPA; +55% with DAG) as compared to untreated control. Similar results were obtained in experiments with the calcium ionophore ionomycin (data not shown), further supporting the role of the calcium-dependent PKC pathways in bcl-2 ARE modulation.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 4. PKC stimulation by TPA and DAG counteracts the bcl-2 mRNA destabilizing activity of bcl-2 ARE. A) Starved cells were treated with TPA (50 nM) and DAG (5 µM) at the time of serum addition. At the indicated time intervals, total RNA was extracted and analyzed by PAGE after RNase protection, as described previously. B) Quantitation of the bands was carried out as reported in legends of Figs. 2 and 3 . Results are the mean ± SE of five independent experiments (P<0.0001 and P<0.002 for TPA, P<0.0002 and <0.001 for DAG at hours 4 and 8, calculated vs. untreated control at the 4th and 8th hour).

PKC-mediated modulation of bcl-2 mRNA steady-state levels
The previous results were obtained using an ectopic expression system by which the effects of the bcl-2 ARE were monitored in the highly stable ß-globin mRNA in order to better demonstrate the intrinsic destabilizing potential of this element. The possibility that the ARE-mediated functional activity of bcl-2 3' UTR was really affecting the endogenous bcl-2 mRNA stability was indirectly explored by TPA treatment of Jurkat cells to see whether TPA-mediated PKC stimulation resulted in a specific change of bcl-2 mRNA decay. After 6 h treatment with 20 µg/ml DRB, which induced an almost complete transcriptional block (not shown), 50 nM TPA was added for a further 2 h. Controls without TPA addition were also carried out. Total RNA was then extracted and bcl-2 mRNA levels were evaluated by a semiquantitative RT-PCR protocol using ß-actin mRNA as the internal standard (Fig. 5 ). As expected, the DRB-mediated transcriptional block without TPA treatment (lane 2) induced a decay of bcl-2 mRNA of ~80%. Symmetrically, the 2 h treatment with TPA without the transcriptional block (lane 3) induced a marked enhancement of the bcl-2 mRNA steady-state levels, which were more than doubled (+118%) compared to those of untreated cells. This effect could be attributable not only to bcl-2 ARE stabilization, but also to the transcriptional induction starting from the bcl-2 promoter, since TPA is known to have this effect (13) . But when mRNA de novo synthesis is blocked with DRB (lane 4), a clear TPA-mediated enhancement of bcl-2 mRNA steady-state levels is again present. This enhancement (+51%) could be bona fide attributed to the bcl-2 mRNA stabilization mediated by the PKC activation effect on bcl-2 ARE.



View larger version (37K):
[in this window]
[in a new window]
  		Figure 5. PKC stimulation by TPA prolongs bcl-2 mRNA half-life in Jurkat cells. T-leukemia Jurkat cell line was treated with DRB (20 µg/ml) for 6 h to block mRNA synthesis and with TPA (50 nM) for two additional hours to activate PKC. Total RNA was extracted for cDNA synthesis and bcl-2 mRNA was evaluated by an internal standard-based semiquantitative RT-PCR assay. After scanning densitometry, each bcl-2/ß-actin ratio was reported in the top diagram. The experiments were done in triplicate.

Enhancement of bcl-2 mRNA decay by apoptotic stimuli
To obtain some clue to the biological role of bcl-2 ARE, the possibility that bcl-2 down-regulation associated with apoptosis could be mediated by an enhancement of bcl-2 mRNA decay was explored. The half-life of the transcript with or without C2-ceramide addition was determined at 4 h using DRB as transcriptional inhibitor. After having induced a DRB-mediated transcriptional block (20 µg/ml DRB), Jurkat cells were treated with 50 µM C2-ceramide, a dose able to induce a massive apoptosis within 16 h (data not shown). Cells were harvested at the 2nd and 4th hour of treatment, when C2-ceramide did not appear to induce any effect. After extracting total RNA, bcl-2 mRNA levels were evaluated by a semiquantitative RT-PCR protocol and compared with those of bcl-XL mRNA found to be stable upon ceramide treatment according to previous reports (17) . Bcl-2 and bcl-XL transcripts were constitutively present in untreated cells (Fig. 6 , time 0). C2-ceramide treatment of transcriptionally blocked Jurkat cells resulted in a marked enhancement of bcl-2 mRNA decay (-51% at 2 h, -77% at 4 h) compared to C2-ceramide-untreated control (-28% at 2 h, -52% at 4 h), but did not affect the intracellular levels of bcl-XL mRNA, which remained substantially stable in both cases. The resultant t1/2 (min), calculated by linear regression subsequent to densitometric analysis, was 113.1 ± 24.6 (C2-ceramide-treated samples) against 230.5 ± 28.3 (C2-ceramide-untreated controls).



View larger version (25K):
[in this window]
[in a new window]
  		Figure 6. Increased decay of bcl-2 mRNA half-life in Jurkat cells by synthetic C2-ceramide. Jurkat cells were treated at time 0 with 20 µg/ml of DRB or with DRB and 50 µM of C2-ceramide as indicated. Total RNA was extracted after 2 h and 4 h; upon reverse transcription, cDNA was amplified for bcl-2 or bcl-XL in separate reactions. The relative yield of bcl-2 to bcl-XL mRNA was obtained from values falling within the linear range of PCR amplification. Data are presented as the mean ± SE of three independent experiments.

Enhancement of bcl-2 decay by apoptotic stimuli is mediated by its ARE
Finally, we searched for direct proof that bcl-2 ARE per se could be responsible for enhancing the bcl-2 mRNA decay observed in Jurkat cells after ceramide-induced apoptosis. NIH 3T3 cells expressing the serum-inducible rabbit ß-globin harboring the bcl-2 ARE (BBB-U1) or not (BBB4) were used. After serum starvation, 15% FCS was added to the culture medium in order to switch on/off the reporter genes. Two hours later, medium was removed and substituted with medium containing 50 µM C2-ceramide and 0.5% CS. The total RNA was extracted at 0, 2, 4, and 6 h and mRNA levels of reporter gene were evaluated by the RNase protection assay (Fig. 7A ). The percentage of RNA degradation is shown in Fig. 7B .



View larger version (37K):
[in this window]
[in a new window]
  		Figure 7. bcl-2 ARE is involved in mRNA decay enhancement by apoptotic stimuli. The effect of C2-ceramide (50 µM) on ß-globin transcript decay was evaluated in BBB4- and BBB-U1-transfected NIH 3T3 cells. Total RNA was extracted at the indicated time intervals and analyzed by RNase protection. A) Representative PAGE analysis after RNase protection assay probed as indicated in Fig. 2 . B) PhosphorImager-derived values were calculated as in Figs. 2 and 3 . Results are the mean ± SE of three independent experiments (P<0.001 BBB-U1 vs. BBB-U1+C2-ceramide).

Compared to the values obtained at the maximal rate of the transcriptional pulse (i.e., at the 2nd hour), the levels of ß-globin mRNA devoid of bcl-2 ARE underwent a very slow decrease (-16% at the 6th hour) that was only slightly more pronounced after C2-ceramide addition (-26% at the 6th hour). Therefore, data obtained at the 6th h after the transcriptional pulse indicate that C2-ceramide does not substantially affect the ß-globin mRNA levels in BBB4-expressing cells (half-life >10 h). As expected, in the absence of any treatment, the ß-globin mRNA with inserted the bcl-2 ARE underwent an evident decay (-65% at the 6th hour); such decay was dramatically enhanced after C2-ceramide addition to the culture medium. In fact, in BBB-U1-expressing cells, the addition of C2-ceramide dramatically decreased ß-globin mRNA levels (-80% at the 4th hour and -96% at the 6th hour). As a consequence, the insertion of bcl-2 ARE is responsible for shortening the half-life of ß-globin mRNA in response to C2-ceramide addition of ~threefold, i.e., from 2.6 h to 0.8 h.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have described here a new mechanism of modulation of bcl-2 gene expression that is involved in bcl-2 mRNA down-regulation during apoptosis. This mechanism depends on an evolutionarily conserved AU-rich sequence located in the upper portion of the 3' UTR of bcl-2 mRNA that is endowed with a relatively high {Delta}G (predicting the absence of secondary structures at physiological pH) and is associated in the cell cytoplasm with numerous trans-acting RNA binding proteins (unpublished results). We previously had postulated bcl-2 expression control at the level of mRNA stability after a study designed to clarify the molecular basis of bcl-2 deregulation in t(14;18) lymphoma cell lines. In these cell lines, where the bcl-2 gene is juxtaposed to the IgH locus producing a bcl-2/IgH chimeric gene, we described the existence of a chimeric antisense bcl-2/IgH transcript stemming from the IgH locus, encompassing the bcl-2/IgH translocation site and overlapping at least the conserved region of the bcl-2 3'UTR studied here (23) . By means of antisense oligonucleotides, we demonstrated that this chimeric transcript is responsible for up-regulating bcl-2 expression, and we supposed that this could happen by masking a negative regulatory element present in the 3' UTR of the bcl-2 mRNA (23 , 44) . Now we describe in exactly the same region in which the negative regulative element was hypothesized (23) the presence of a typical AU-rich motif endowed with clear mRNA destabilizing properties.

The AREs are the main regulatory elements of mRNA stability that are recognized; in some cases they are also implicated in translation efficiency (29) . These motifs are present in the 3' UTR of numerous short-lived mammalian mRNAs for different genes: from cytokines to transcription factors, to growth factors, to cell membrane proteins (44 45) . Their half-life modulating function has been formally demonstrated for many of these mRNAs, including GM-CSF, IL-2, IL-3, IFNß, c-fos, c-myc, and TNF-{alpha} (26) . Although it is difficult to derive a common consensus sequence from these different AREs, all these regions range in size from 50 to 150 nucleotides, contain multiple copies of the pentanucleotide AUUUA, and have a high overall content of A and U residues. Besides its impressive evolutive conservation, the 107-nucleotide AU-rich element we identify in the 3' UTR of the bcl-2 mRNA is endowed with all the features of a typical ARE. Because of the particular distribution of the AUUUA pentamers near an UUAUUUAUU nonamer, bcl-2 ARE is ascribed to the class II AREs according to the classification proposed by Shyu et al. (26 , 28) . The AREs of this class usually impart a biphasic kinetic of degradation to their relevant mRNA, are sensitive to actinomycin D treatment, and do not necessarily act on translation.

The rate of bcl-2 mRNA decay was classically evaluated in Jurkat cells by adding DRB to the culture medium in order to induce a general inhibition of RNA transcription. Nevertheless, to overcome the possible aspecific effects of a general transcriptional block, the role of bcl-2 ARE on RNA stability has been studied in NIH 3T3 cells transfected with pBBB-U1 or pBBB4 constructs. In these cells, the transcription of the ß-globin gene, harboring bcl-2 ARE or not, was driven by the serum-responsive promoter of c-fos so that a specific transcriptional pulse of ß-globin gene was generated by serum stimulation without the use of any transcriptional inhibitors. Although little is known about the molecular mechanism underlying ARE activity on their mRNA, a reasonable hypothesis is that this activity is influenced by PKC, since PKC stimulation with TPA enhances the stability of numerous ARE-bearing mRNAs (46 47 48) and also induces changes in ARE binding proteins, such as loss of the AU-B (49) and up-regulation of AUBF (50) . Here we demonstrate that the bcl-2 ARE is also partially inactivated in its destabilizing function by PKC stimulation (Fig. 4) and that this post-transcriptional level of regulation plays a role in PKC-mediated enhancement of bcl-2 expression in Jurkat cells (Fig. 5) . Since bcl-2 induction is known to be mediated by PKC stimulation in other cell systems (13 , 51 52) , the possibility exists that at least part of the PKC-dependent signaling for bcl-2 induction has a target in the bcl-2 mRNA ARE.

Finally, we investigate the possibility that bcl-2 ARE mediate a decrease in bcl-2 mRNA cellular levels observed during apoptosis, being involved in a regulative mechanism of mRNA stability. Although the decrease in bcl-2 mRNA cellular levels in response to apoptotic stimuli has been well documented in the literature (12 13 14 15 , 17) , its mechanism is not yet clear. In particular, it has not been ascertained whether this down-regulation could be attributable to decreased transcriptional activity, increased mRNA decay, or both. Considering that the AU-rich element we identify in the 3'-UTR of bcl-2 mRNA appears to be endowed with functional activity, the hypothesis that it may be involved in bcl-2 mRNA decay during apoptosis appears very likely. Indeed, the results reported in this paper are in favor of this possibility because 1) the down-regulation of bcl-2 we observed in Jurkat cells in response to C2-ceramide application is mediated, at least in part, to the increased decay of bcl-2 mRNA (Fig. 6) , and 2) the decay of the reporter gene after C2-ceramide application requires bcl-2 ARE insertion (Fig. 7) .

Ceramide has often been indicated as a second lipidic messenger that modulates a variety of biological processes such as cell growth, differentiation, or apoptosis (53 54) . The same apoptotic stimuli that have been reported to induce bcl-2 mRNA down-regulation—that is, TNF-{alpha}, Fas ligand, or X-rays (14 , 17) —have also been reported to be associated with an early production of ceramide (55) , which appears to be a common mediator of different apoptotic pathways. On the basis of these observations, we have selected exogenous C2-ceramide as a very suitable drug for evaluating the effect of apoptosis induction on bcl-2 mRNA decay.

Besides its expression being regulated by various stimuli, bcl-2 is often overexpressed in tumors. The first evidence of this phenomenon emerged from analysis of the bcl-2 expression level in follicular lymphomas bearing the t(14;18) translocation with which this gene is involved and by which it was cloned (56 57) . Thereafter, bcl-2 overexpression has been recognized as a general feature of hematological and solid malignancies of various types (58 59) . To date, hundreds of papers have been published correlating bcl-2 overexpression with the neoplastic phenotype and disease prognosis, but little if nothing has been discovered about the molecular basis of this overexpression. Sequencing of the bcl-2 coding region in bcl-2-overexpressing solid tumor specimens revealed a substantial absence of mutations, and only one report has described an amplification region involving the bcl-2 locus (60) . Therefore, the realization of this new level of up-regulation of bcl-2 will offer other opportunities for experimental testing. Similarly, the well-established phenomenon of bcl-2 down-regulation as a fundamental step of different apoptotic pathways, demonstrated both in vitro and in vivo (14 , 17) , is a good candidate for a post-transcriptional control for the fast kinetic with which it occurs in at least some models.

The further functional and molecular characterization of the sequence determinants and the RNA binding factors acting in cis and in trans, respectively, might contribute the understanding of their biological significance.


   ACKNOWLEDGMENTS
 
We thank Dr. C. Moroni for invaluable suggestions. We also thank Dr. A. Tempestini and M. Cutrì for expert assistance in the image analysis, Dr. V. Boddi for statistical analysis, Dr. M. Forrest for the linguistic revision of the manuscript, and Dr. R. Abbate for use of the Storm system. Finally, we thank Dr. S. Korsmeyer for the human bcl-2 cDNA plasmid, Dr. G. J. Goodall for the pGAPM plasmid, Dr. G. I. Evan for the pBABE-puro plasmid, and Dr. A. B. Shyu for pBBB4 and the pBBB+ARE plasmids. This work was supported by grants from AIRC, MURST, Istituto Superiore di Sanità, and Ente Cassa di Risparmio di Firenze.


   FOOTNOTES
 
1 These authors contributed equally to this work.

2 Present address: Laboratory of Adaptive Systems, NINDS/NIH, 36 Convent Drive MSC 4124, Bethesda, MD 20892, USA.

Received for publication March 29, 1999. Revised for publication September 13, 1999.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Strasser, A., Huang, D. C., Vaux, D. L. (1997) The role of the bcl-2/ced-9 gene family in cancer and general implications of defects in cell death control for tumourigenesis and resistance to chemotherapy. Biochim. Biophys. Acta 1333,F151-F178[Medline]
  2. Reed, J. C. (1997) Double identity for proteins of the Bcl-2 family. Nature (London) 387,773-776[Medline]
  3. Ochiai, K., Kagami, M., Matsumura, R., Tomioka, H. (1997) IL-5 but not interferon-gamma (IFN-gamma) inhibits eosinophil apoptosis by up-regulation of bcl-2 expression. Clin. Exp. Immunol. 107,198-204[Medline]
  4. Teague, T. K., Marrack, P., Kappler, J. W., Vella, A. T. (1997) IL-6 rescues resting mouse T cells from apoptosis. J. Immunol. 158,5791-5796[Abstract]
  5. Hernandez-Caselles, T., Martinez-Esparza, M., Sancho, D., Rubio, G., Aparicio, P. (1995) Interleukin-7 rescues human activated T lymphocytes from apoptosis induced by glucocorticoesteroids and regulates bcl-2 and CD25 expression. Hum. Immunol. 43,181-189[Medline]
  6. Jewell, A. P., Worman, C. P., Lydyard, P. M., Yong, K. L., Giles, F. J., Goldstone, A. H. (1994) Interferon-alpha up-regulates bcl-2 expression and protects B-CLL cells from apoptosis in vitro and in vivo. Br. J. Haematol. 88,268-274[Medline]
  7. Konig, A. (1997) Basic fibroblast growth factor (bFGF) upregulates the expression of bcl-2 in B cell chronic lymphocytic leukemia cell lines resulting in delaying apoptosis. Leukemia 11,258-265[Medline]
  8. Genestier, L., Bonnefoy-Berard, N., Rouault, J. P., Flacher, M., Revillard, J. P. (1995) Tumor necrosis factor-alpha up-regulates Bcl-2 expression and decreases calcium-dependent apoptosis in human B cell lines. Int. Immunol. 7,533-540[Abstract/Free Full Text]
  9. Henderson, S., Rowe, M., Gregory, C., Croom-Carter, D., Wang, F., Longnecker, R., Kieff, E., Rickinson, A. (1991) Induction of bcl-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 65,1107-1115[Medline]
  10. Salomoni, P., Perrotti, D., Martinez, R., Franceschi, C., Calabretta, B. (1997) Resistance to apoptosis in CTLL-2 cells constitutively expressing c-Myb is associated with induction of BCL-2 expression and Myb-dependent regulation of bcl-2 promoter activity. Proc. Natl. Acad. Sci. USA 94,3296-3301[Abstract/Free Full Text]
  11. Fan, J., Bertino, J. R. (1997) K-ras modulates the cell cycle via both positive and negative regulatory pathways. Oncogene 14,2595-2607[Medline]
  12. Tangye, S. G., Raison, R. L. (1997) Cytokines and cross-linking of sIgM augment PMA-induced activation of human leukaemic CD5+ B cells. Immunol. Cell Biol. 75,127-135[Medline]
  13. Rinaudo, M. S., Su, K., Falk, L. A., Halder, S., Mufson, R. A. (1995) Human interleukin-3 receptor modulates bcl-2 mRNA and protein levels through protein kinase C in TF-1 cells. Blood 86,80-88[Abstract/Free Full Text]
  14. Suzuki, A., Matsuzawa, A., Iguchi, T. (1996) Down regulation of Bcl-2 is the first step on Fas-mediated apoptosis of male reproductive tract. Oncogene 13,31-37[Medline]
  15. Miyashita, T., Krajewski, S., Krajewska, M., Wang, H.-G., Lin, H-K., Hoffman, B., Lieberman, D., Reed, J.C. (1994) Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 9,1799-1805[Medline]
  16. Ziegler, A., Luedke, G. H., Fabbro, D., Altmann, K. H., Stahel, R. A., Zangemeister-Wittke, U. J. (1997) Induction of apoptosis in small-cell lung cancer cells by an antisense oligodeoxynucleotide targeting the Bcl-2 coding sequence. J. Natl. Cancer Inst. 89,1027-1036[Abstract/Free Full Text]
  17. Chen, M., Quintans, J., Fuks, Z., Thompson, C., Kufe, D. W., Weichselbaum, R. R. (1995) Suppression of Bcl-2 messenger RNA production may mediate apoptosis after ionizing radiation, tumor necrosis factor alpha, and ceramide. Cancer Res 55,991-994[Abstract/Free Full Text]
  18. Young, R. L., Korsmeyer, S. (1993) A negative regulatory element in the bcl-2 5'-untranslated region inhibits expression from an upstream promoter. Mol. Cell. Biol. 13,3686-3697[Abstract/Free Full Text]
  19. Miyashita, T., Harigai, M., Hanada, M., Reed, J. (1994) Identification of a p53-dependent negative response element in the bcl-2 gene. Cancer Res 54,3131-3135[Abstract/Free Full Text]
  20. Harigai, M., Miyashita, T., Hanada, M., Reed, J. (1996) A cis-acting element in the BCL-2 gene controls expression through translational mechanisms. Oncogene 12,1369-1374[Medline]
  21. Blagosklonny, M. V., Giannakakou, P., el-Deiry, W. S., Kingston, D. G., Higgs, P. I., Neckers, L., Fojo, T. (1997) Raf-1/bcl-2 phosphorylation: a step from microtubule damage to cell death. Cancer Res 57,130-135[Abstract/Free Full Text]
  22. Haldar, S., Chintapalli, J., Croce, C. M. (1996) Taxol induces bcl-2 phosphorylation and death of prostate cancer cells. Cancer Res 56,1253-1255[Abstract/Free Full Text]
  23. Capaccioli, S., Quattrone, A., Schiavone, N., Calastretti, A., Copreni, E., Bevilacqua, A., Canti, G., Gong, L., Morelli, S., Nicolin, A. (1996) A bcl-2/IgH antisense transcript deregulates bcl-2 gene expression in human follicular lymphoma t(14;18) cell lines. Oncogene 13,105-115[Medline]
  24. Morelli, S., Delia, D., Capaccioli, S., Quattrone, A., Schiavone, N., Bevilacqua, A., Tomasini, S., Nicolin, A. (1997) The antisense bcl-2-IgH transcript is an optimal target for synthetic oligonucleotides. Proc. Natl. Acad. Sci. USA 94,8150-8155[Abstract/Free Full Text]
  25. Belasco, J., Brawerman, G. (1993) Control of Messenger RNA Stability Academic Press San Diego, California.
  26. Chen, C. Y. A., Shyu, A. B. (1995) AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20,465-470[Medline]
  27. Shyu, A. B., Belasco, J. G., Greenberg, M. E. (1991) Two distinct destabilizing elements in the c-fos message trigger the deadenylation as a first step in rapid mRNA decay. Genes Dev 5,221-231[Abstract/Free Full Text]
  28. Xu, N., Chen, C. Y. A., Shyu, A. B. (1997) Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key sequence features controlling mRNA deadenylation and decay. Mol. Cell. Biol. 17,4611-4621[Abstract]
  29. Ross, J. (1995) mRNA stability in mammalian cells. Microbiol. Rev. 59,423-450[Abstract/Free Full Text]
  30. Biamonti, G., Riva, S. (1994) New insights into the auxiliary domains of eukaryotic RNA binding proteins. FEBS Lett 340,1-8[Medline]
  31. Nakamaki, T., Imamura, J., Brewer, G., Tsuruoka, N., Koeffler, H. P. (1995) Characterization of adenosine-uridine-rich RNA binding factors. J. Cell. Physiol. 165,484-492[Medline]
  32. Antic, D., Keene, J. D. (1997) Insights from model systems—embryonic lethal abnormal visual RNA binding proteins involved in growth, differentiation and posttranscriptional gene expression. Am. J. Hum. Genet. 61,273-278[Medline]
  33. Fan, X. C., Steits, J. A. (1998) Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J 17,3448-3460[Medline]
  34. Pemg, S. S.-Y., Chen, C.-Y. A., Xu, N., Shyu, A.-B. (1998) RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J 17,3461-3470[Medline]
  35. Carballo, E., Lai, W. S., Blackshear, P. J. (1998) Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science 281,1001-1005[Abstract/Free Full Text]
  36. Meijlink, F., Curran, T., Miller, A. D., Verma, I. M. (1985) Removal of a 67-base-pair sequence in the noncoding region of protooncogene fos converts it to a transforming gene. Proc. Natl. Acad. Sci. USA 82,4987-4991[Abstract/Free Full Text]
  37. Aghib, D. F., Bishop, J. M., Ottolenghi, S., Guerrasio, A., Serra, A., Saglio, G. (1990) A 3' truncation of MYC caused by chromosomal translocation in a human T-cell leukemia increases mRNA stability. Oncogene 5,707-711[Medline]
  38. Shyu, A. B., Greenberg, M. E., Belasco, J. G. (1989) The c-fos transcript is targeted for rapid decay by two distinct mRNA degradation pathways. Genes Dev 3,60-72[Abstract/Free Full Text]
  39. Seto, M., Ulrich, J., Hockett, R. D., Graninger, W., Bennett, S., Goldman, P., Korsmeyer, S. J. (1988) Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J 7,123-131[Medline]
  40. Lagnado, C. A., Brown, C. Y., Goodall, G. J. (1994) AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A). Mol. Cell. Biol. 14,7984-7995[Abstract/Free Full Text]
  41. Quattrone, A., Papucci, L., Santini, V., Schiavone, N., Noferini, D., Calastretti, A., Copreni, E., Morelli, S., Rossi Ferrini, P. L., Nicolin, A., Capaccioli, S. (1995) Quantitation of bcl-2 oncogene in cultured lymphoma/leukemia cell lines and in primary leukemia B-cells by a highly sensitive RT-PCR method. Haematologica 80,495-504[Abstract/Free Full Text]
  42. Zubiaga, A. M., Belasco, J. G., Greenberg, M. E. (1995) The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell. Biol. 15,2219-2230[Abstract]
  43. Hengartner, M. O., Horvitz, H. R. (1994) C. elegans cell survival gene ced-9 encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 6,665-676
  44. Asson-Batres, M. A., Spurgeon, S. L., Diaz, J., DeLoughery, T. G., Bagby, G. C., Jr (1994) Evolutionary conservation of the AU-rich 3' untranslated region of messenger RNA. Proc. Natl. Acad. Sci. USA 91,1318-1322[Abstract/Free Full Text]
  45. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., Cerami, A. (1986) Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA 83,1670-1674[Abstract/Free Full Text]
  46. Zaidi, S. H., Malter, J. S. (1994) Amyloid precursor protein mRNA stability is controlled by a 29-base element in the 3'-untranslated region. J. Biol. Chem. 269,24007-24013[Abstract/Free Full Text]
  47. Iwai, Y., Bickel, M., Pluznik, D. H., Cohen, R. B. (1991) Identification of sequences within the murine granulocyte-macrophage colony-stimulating factor mRNA 3'-untranslated region that mediate mRNA stabilization induced by mitogen treatment of EL-4 thymoma cells. J. Biol. Chem. 266,17959-17965[Abstract/Free Full Text]
  48. Marer, F., Medcalf, R. L. (1996) Plasminogen activator inhibitor type 2 gene induction by tumor necrosis factor and phorbol ester involves transcriptional and post-transcriptional events. Identification of a functional nonameric AU-rich motif in the 3`-untranslated region. J. Biol. Chem. 271,26074-26080[Abstract/Free Full Text]
  49. Bohjanen, P. R., Petryniak, B., June, C. H., Thompson, C. B., Lindsten, T. (1991) An inducible cytoplasmic factor (AU-B) binds selectively to AUUUA multimers in the 3' untranslated region of lymphokine mRNA. Mol. Cell. Biol. 11,3288-3295[Abstract/Free Full Text]
  50. Malter, J. S., Hong, Y. (1991) A redox switch and phosphorylation are involved in the post-translational up-regulation of the adenosine-uridine binding factor by phorbol ester and ionophore. J. Biol. Chem. 266,3167-3171[Abstract/Free Full Text]
  51. Suzuki, A., Goto, Y., Iguchi, T. (1997) Progression of PDMT is accompanied by lack of Fas and intense expression of Bcl-2 and PKC-epsilon. Carcinogenesis 18,883-887[Abstract/Free Full Text]
  52. Whitman, S. P., Civoli, F., Daniel, L. W. (1997) Protein kinase CbetaII activation by 1-beta-D-arabinofuranosylcytosine is antagonistic to stimulation of apoptosis and Bcl-2alpha down-regulation. J. Biol. Chem. 272,23481-23484[Abstract/Free Full Text]
  53. Hannun, Y. A. (1996) Functions of ceramide in coordinating cellular responses to stress. Science 274,1855-1859[Abstract/Free Full Text]
  54. Mathias, S., Pena, L. A., Kolesnick, R. N. (1998) Signal transduction of stress via ceramide. Biochem. J. 335,465-480
  55. Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J., Szabo, E., Zon, L. I., Kyriakis, J. M., Haimovitz-Friedman, A., Fuks, Z., Kolesnick, R. N. (1996) Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis. Nature (London) 380,75-79[Medline]
  56. Cleary, M. L., Smith, S. D., Sklar, J. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell 47,19-28[Medline]
  57. Tsujimoto, Y., Croce, C. M. (1986) Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc. Natl. Acad. Sci. USA 83,5214-5218[Abstract/Free Full Text]
  58. Reed, J. C. (1997) Bcl-2 family proteins: regulators of apoptosis and chemoresistance in hematologic malignancies. Semin. Hematol. 34,9-19[Medline]
  59. Lu, Q. L., Abel, P., Foster, C. S., Lalani, E. N. (1996) bcl-2: role in epithelial differentiation and oncogenesis. Hum. Pathol. 27,102-110[Medline]
  60. Monni, O., Joensuu, H., Franssila, K., Klefstrom, J., Alitalo, K., Knuutila, S. (1997) BCL-2 overexpression associated with chromosomal amplification in diffuse large B-cell lymphoma. Blood 90,1168-1174[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Pharmacol.Home page
L. Papucci, E. Witort, A. M. Bevilacqua, M. Donnini, M. Lulli, E. Borchi, K. S. A. Khabar, A. Tempestini, A. Lapucci, N. Schiavone, et al.
Impact of Targeting the Adenine- and Uracil-Rich Element of bcl-2 mRNA with Oligoribonucleotides on Apoptosis, Cell Cycle, and Neuronal Differentiation in SHSY-5Y Cells
Mol. Pharmacol., February 1, 2008; 73(2): 498 - 508.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Biol.Home page
R. Mazroui, S. Di Marco, E. Clair, C. von Roretz, S. A. Tenenbaum, J. D. Keene, M. Saleh, and I.-E. Gallouzi
Caspase-mediated cleavage of HuR in the cytoplasm contributes to pp32/PHAP-I regulation of apoptosis
J. Cell Biol., January 10, 2008; 180(1): 113 - 127.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Grinstein, Y. Du, S. Santourlidis, J. Christ, M. Uhrberg, and P. Wernet
Nucleolin Regulates Gene Expression in CD34-positive Hematopoietic Cells
J. Biol. Chem., April 27, 2007; 282(17): 12439 - 12449.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
Y. Otake, S. Soundararajan, T. K. Sengupta, E. A. Kio, J. C. Smith, M. Pineda-Roman, R. K. Stuart, E. K. Spicer, and D. J. Fernandes
Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of bcl2 mRNA
Blood, April 1, 2007; 109(7): 3069 - 3075.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
A. Bevilacqua, L. Ghisolfi, S. Franzi, G. Maresca, R. Gherzi, S. Capaccioli, A. Nicolin, and G. Canti
Stabilization of Cellular mRNAs and Up-Regulation of Proteins by Oligoribonucleotides Homologous to the Bcl2 Adenine-Uridine Rich Element Motif
Mol. Pharmacol., February 1, 2007; 71(2): 531 - 538.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Chowdhury, S. Krishnan, C. G. Tsokos, J. W. Robertson, C. U. Fisher, M. P. Nambiar, and G. C. Tsokos
Stability and Translation of TCR {zeta} mRNA Are Regulated by the Adenosine-Uridine-Rich Elements in Splice-Deleted 3' Untranslated Region of {zeta}-Chain
J. Immunol., December 1, 2006; 177(11): 8248 - 8257.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page