| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Research Group Immunobiology and
Institut für Physiologische Chemie I, Heinrich-Heine-Universität Düsseldorf, Germany
1Correspondence: Forschungsgruppe Immunbiologie 14.80, Heinrich-Heine-Universität Düsseldorf, Postfach 10 10 07, D-40001 Düsseldorf, Germany. E-mail: kroencke{at}uni-duesseldorf.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
,25-dihydroxyvitamin
D3 (1,25(OH)2D3) receptor (VDR)
and retinoid X receptor (RXR) with
1,25(OH)2D3 response elements (VDREs), was
used as a model system. NO was applied to this system via the NO donors
SNOC and MAMA/NO and caused a dose-dependent inhibition of VDR-RXR-VDRE
complex formation (IC50 values 0.5–0.8 mM). Ligand-bound
or preformed complexes displayed less sensitivity to NO-induced stress.
These in vitro effects of NO were found to be
reversible. Functional assays in transiently transfected cells
indicated that NO can also act in vivo as a repressor of
1,25(OH)2D3 signaling (IC50
value of the slow NO donor DETA/NO, 0.5 mM). These findings suggest
that NO has a modulatory role on transcription factors depending on
their sensitivity to NO-induced stress, thus providing a mechanism for
a gene regulatory function of NO.—Kröncke, K. D., Carlberg,
C. Inactivation of zinc finger transcription factors provides a
mechanism for a gene regulatory role of nitric oxide.
Key Words: protein–DNA interaction • transcriptional regulation/1 • 25(OH)2D3 receptor 1,25(OH)2D3 signaling
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
For this purpose, it is synthesized
in a regulated manner by two constitutively expressed NO synthases for
short periods of time (2)
. However, NO can also be
synthesized for longer periods of time in an apparently unregulated
manner by an inducible nitric oxide synthase (iNOS), which is expressed
in cells after activation by bacterial products like lipopolysaccharide
and/or proinflammatory cytokines (3)
. Although iNOS has
been found to be expressed during the course of many human diseases
(4)
, which roles it plays in these diseases is still under
discussion. NO, produced by iNOS, creates a NO-induced stress that may
participate in inflammatory and autoimmune-mediated tissue destruction
(5)
. However, it has been indicated that depending on the
situation and the site where NO is synthesized by iNOS, it may also
exert gene regulatory or even protective effects (6
, 7)
.
NO is known to inhibit the DNA binding activity of the yeast zinc
finger transcription factor LAC9 and to induce
Zn2+ release in vitro from the zinc
storage protein metallothionein via S-nitrosylation of cysteine thiol
groups and subsequent disulfide formation, i.e., oxidation of SH groups
(8)
. Moreover, exogenously applied NO has been shown to
induce Zn2+ release within the cytoplasm and
nuclei of cells (9)
. These results suggest that zinc
finger proteins may be primary targets of NO-derived stress.
A large and important family of zinc finger transcription factors
is formed by the nuclear receptor superfamily (10)
.
Nuclear receptors contain a ligand binding domain in their
carboxy-terminal half that also mediates trans-activation
and DNA-independent dimerization and a highly conserved DNA binding
domain (DBD) of 66 to 70 amino acids that is formed by two zinc finger
structures in their amino-terminal part. Important properties of a
nuclear receptor DBD are a specific recognition of hexameric core
binding sites and a specific, directed dimerization with partner
receptor DBDs. The two Zn2+ ions in a nuclear
receptor DBD have a critical role for the coordination of its tertiary
structure through spatial arrangement of a few short -helices that
mediate a selective recognition of response elements with appropriately
spaced core binding sites (11)
. The nuclear
receptors 1,25(OH)2D3
receptor (VDR) and retinoid X receptor (RXR) are representative members
of the superfamily and mediate the genomic effects of the nuclear
hormone 1,25-dihydroxyvitamin D3
(1,25(OH)2D3), which is
the biologically active form of vitamin D3
(12
, 13)
. VDR and RXR bind as a heterodimeric complex to
specific sequences in the promoter of
1,25(OH)2D3 target
genes, commonly referred to as
1,25(OH)2D3 response
elements (VDREs) (14)
. Simple VDREs are formed by a
directly repeated arrangement of two core binding motifs with three
spacing nucleotides (DR3-type VDREs) or by an inverted palindromic
arrangement with nine intervening nucleotides (IP9-type VDREs)
(15)
.
In the present study, complex formation between VDR, RXR, and VDREs was used as a model system for testing the effects of NO-generated stress on these zinc finger transcription factors. The results show that NO can inhibit VDR–RXR heterodimer complex formation in vitro as well as in vivo and provide a mechanism for a gene regulatory function of NO.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 17)
. Denitrosylated
SNOC (SNOC-NO), denitrosylated MAMA/NO
(MAMA/NO-NO), or denitrosylated DETA/NO
(DETA/NO-NO) were obtained by incubating a 100 mM
stock solution of SNOC and a 50 mM stock solution of MAMA/NO,
respectively, for 48 h at 37°C and a 50 mM stock solution of
DETA/NO for 96 h at 37°C.
DNA constructs
The cDNAs for human VDR and human RXR were subcloned into the
pSG5 expression vector (Stratagene, Heidelberg, Germany)
(18)
. Oligonucleotides carrying either the DR3-type VDRE
(core sequence AGAGGTCATGAAGGACA) of the rat ANF
gene promoter (19)
or the IP9-type VDRE (core sequence
TGACCCTGGGAACCGGGTCCA) of the mouse
c-fos promoter (20)
were synthesized with
flanking XbaI sites. The IP9-type VDRE was transferred
together with the thymidine kinase (tk) promoter from the
respective chloramphenicol acetyl transferase reporter gene construct
(20)
into the promoterless luciferase reporter gene
plasmid pGL2 (Promega, Mannheim, Germany).
Gel shift assays
Linearized cDNA from VDR and RXR, respectively, were transcribed
with T7 RNA polymerase and translated using wheat
germ extract as recommended by the supplier (Promega). Equal amounts of
in vitro translated VDR and RXR proteins
(VDRivt and RXRivt, 2.5
µl each) or bacterially expressed GST-VDR and GST-RXR fusion proteins
(VDRGST and RXRGST, kindly
provided by P. Polly) were mixed and incubated in the absence or
presence of 1 µM
1,25(OH)2D3 for 15 min
at room temperature in a total volume of 20 µl binding buffer (10 mM
Hepes, pH 7.9, 100 mM KCl, 0.2 µg/µl poly[d(I-C)], and 5%
glycerol, no reductants such as DTT). Indicated amounts of NO donors
were added and the mixtures were incubated for 30 min or 1 h at
30°C. The DR3-type and the IP9-type VDRE, respectively, were labeled
by a fill-in reaction using [-32P]dCTP and
the Klenow fragment of DNA polymerase I (Promega). In some experiments,
5 µl of NO donor-treated or untreated wheat germ extract was added
and incubation was continued for 30 min. Approximately 1 ng of labeled
probe (50,000 cpm) was added to the receptor-ligand mixture and
incubation was continued for 30 min. Protein–DNA complexes were
resolved on a 5% nondenaturing polyacrylamide gel at room temperature
in 0.5x TBE (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8.3). The
gels were dried and exposed to a Fuji MP2040S imager screen overnight.
The ratio of free probe to protein probe complexes was quantified on a
Fuji FLA2000 reader using Image Gauge software (Raytest,
Sprockhövel, Germany). Experiments were performed at least in
triplicate.
Transfection and luciferase assays
SV40-transformed African green monkey kidney COS-7 cells were
seeded into 6-well plates (105 cells/ml) and
grown overnight in phenol red-free DMEM supplemented with 10%
charcoal-treated fetal calf serum (FCS). Liposomes were formed by
incubating 1 µg of the reporter plasmid, 0.25 µg of pSG5-based
receptor expression vectors for VDR and for RXR, and 1 µg of the
reference plasmid pCH110 (Pharmacia, Freiburg, Germany) with 15 µg
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate (DOTAP, Boehringer Mannheim, Mannheim, Germany) for 15
min at room temperature in a total volume of 100 µl. After dilution
with 0.9 ml phenol red-free DMEM, the liposomes were added to the
cells. Phenol red-free DMEM supplemented with 30% charcoal-treated FCS
(500 µl) was added 4 h after transfection. At this time,
1,25(OH)2D3 (100 nM) or
ethanol (0.1%) and the indicated concentrations of the NO donor
DETA/NO or DETA/NO-NO were also added. The cells
were lysed 20 h after onset of stimulation, using a reporter gene
lysis buffer (Boehringer Mannheim), and the constant light signal
luciferase reporter gene assay was performed as recommended by the
supplier (Boehringer Mannheim). The luciferase activities were
normalized in proportion to ß-galactosidase activity and induction
factors were calculated as the ratio of luciferase activity of
ligand-stimulated cells to that of solvent-treated controls.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). At a concentration of 2 mM, both NO donors completely abolished
complex formation. In contrast, 2 mM of the negative controls,
denitrosylated SNOC (SNOC-NO) or denitrosylated
MAMA/NO (MAMA/NO-NO), had no effect, thus
indicating that NO inhibited complex formation. Half-maximal inhibition
(IC50) of complex formation was estimated to be
0.55 mM for SNOC and 0.8 mM for MAMA/NO, the difference probably due to
the different NO generation kinetics of the compounds. This
demonstrates that NO has an inhibitory effect on VDR-RXR heterodimer
complex formation on VDREs.
|
The inhibitory effect of NO on VDR–RXR complex formation is
reversible
The next question was whether the inhibitory effect of NO on
VDR-RXR heterodimer formation with VDREs is reversible. SNOC-treated
VDR-RXR heterodimers were incubated for this purpose with nonprogrammed
wheat germ extract (as a natural source of reductive activity) for 30
min at 30°C. This treatment appeared to fully restore the ability of
VDR-RXR heterodimers to bind to their VDRE (Fig. 2
, compare lanes 1–3). In contrast, when nonprogrammed wheat germ
extract was pretreated with SNOC, a concentration-dependent inhibition
of the ability to restore VDR-RXR-VDRE complex formation was found
(lanes 4 and 5), whereas SNOC-NO had no effect
(lane 6). However, when SNOC-pretreated nonprogrammed wheat germ
extract was added to untreated VDR-RXR heterodimers, maximal complex
formation was observed (lane 7). This showed that after treatment of
the wheat germ extract with 2 mM SNOC for 1 h, NO was no longer
present in the system to mediate inhibitory effects on VDR–RXR complex
formation. Under the chosen reaction conditions, the restoring activity
was not due to new VDR-RXR protein synthesis (data not shown). These
results indicate that nonprogrammed wheat germ extract contains a
NO-antagonizing and restoring activity that itself can be blocked by
NO.
|
NO inhibits dimerization of VDR with RXR
To investigate whether NO also affects heterodimerization of VDR
and RXR, a combination of in vitro translated (ivt) and
bacterially expressed glutathione-S-transferase fusion (GST)
proteins were used. The latter were used with the idea that GST fusion
proteins lack the restoring activity contained in the wheat germ
extract. The ability of complex formation of
VDRivt-RXRGST heterodimers,
VDRivt-RXRivt heterodimers,
and VDRGST-RXRivt
heterodimers on the DR3-type VDRE was found to be almost identical
(Fig. 3
, lanes 1, 4, and 7). As VDR and RXR do not bind to the VDRE as
monomers, both were individually pretreated with SNOC before addition
to the counterpart. When in vitro translated VDR was treated
with 1 mM SNOC (lane 2) for 1 h (a period sufficient for complete
disappearance of NO from the system; see Fig. 2
, lane 7) before
RXRGST was added, formation of
VDRivt-RXRGST-VDRE
complexes was found to be abolished. As a control, an effect was not
observed after treatment with 1 mM SNOC-NO (lane
3). In the converse experiment, in vitro translated RXR was
treated with either 1 mM SNOC (lane 5) or 1 mM
SNOC-NO (lane 6) before
VDRGST was added. The result was that the
formation of VDRGST-RXRivt
heterodimers was also abolished when RXRivt had
been pretreated with SNOC. This showed that NO inhibits the
heterodimerization of VDR with RXR and indicates that both
heterodimeric partners are targets for the inhibitory effect of NO.
|
DNA bound VDR-RXR heterodimers are less sensitive to NO
In the experiments presented so far, VDR-RXR heterodimers were
incubated with NO donors before binding to the VDRE, i.e., the
influence of NO on VDR-RXR-VDRE complex formation was determined. When
VDR-RXR heterodimers that had already bound to the VDRE were treated
with graded concentrations of SNOC (Fig. 4
), the concentrations of SNOC required to induce a release of VDR-RXR
heterodimers from VDREs were found to be two- to threefold higher than
the SNOC concentrations required to inhibit the DNA binding activity of
SNOC-pretreated VDR-RXR heterodimers (compare with Fig. 1
). This
indicated that DNA-bound VDR-RXR heterodimers appear to be more
resistant to NO-induced stress than those that are not DNA bound.
|
Ligand-bound VDR-RXR heterodimers are less sensitive than
ligand-free VDR-RXR heterodimers
Complex formation of VDR-RXR heterodimers on DNA is known to
depend on the type of VDRE and the presence of the
1,25(OH)2D3 ligand
(21
, 22)
. This raises the question of whether NO may
modulate complex formation of liganded and unliganded VDR-RXR
heterodimers on DR3- and IP9-type VDREs in different ways. Therefore,
complex formations of VDR-RXR heterodimers with the DR3-type VDRE of
the rat ANF gene (Fig. 5A
) and with the IP9-type VDRE of the mouse c-fos
gene (Fig. 5B
) were analyzed in the presence and
absence of 1,25(OH)2D3
and graded SNOC concentrations. Four dose response curves were
obtained, demonstrating the overall tendency that NO has an inhibitory
effect on ligand-bound and ligand-free VDR-RXR heterodimers on both
DR3-type and IP9-type VDREs. The IC50 values for
ligand-bound (~0.6 mM SNOC) and ligand-free (~0.4 mM SNOC) VDR-RXR
heterodimers, respectively, appeared to be identical on both VDRE
types. However, the shapes of the dose response curves were found to be
different: on the DR3-type VDRE the curve consistently declines,
whereas on the IP9-type VDRE (up to a concentration of 0.4 mM SNOC) the
curve slightly inclines by ~25% and then declines even faster than
on the DR3-type VDRE. This suggests that at SNOC concentrations
higher than 0.8 mM, VDR-RXR heterodimers appear to be more robust with
a DR3-type VDRE than with an IP9-type VDRE, whereas SNOC concentrations
lower than 0.4 mM were advantageous for VDR-RXR heterodimer binding to
IP9-type VDREs, but not to DR3-type VDREs.
|
NO represses 1,25(OH)2D3 signaling
in transiently transfected cells
The final question was whether the in vitro effects of
NO on VDR-RXR heterodimer formation can also be found in cultured
cells. A luciferase reporter gene construct carrying the IP9-type VDRE
fused to the minimal tk promoter was transiently transfected
for this purpose, together with expression vectors for VDR and RXR,
into COS-7 cells. After transfection, the cells were stimulated with
100 nM 1,25(OH)2D3 or
solvent (0.1% ethanol) and incubated with graded concentrations of the
slow NO-releasing compound DETA/NO (half-life of 7.7 h at 37°C,
pH 7.4 (9)
). Twenty hours after treatment, luciferase
activity was determined from cell extracts and
1,25(OH)2D3-stimulated
gene activity was calculated. This resulted in a dose response curve
showing a decline of
1,25(OH)2D3 stimulation
by increasing NO concentrations and an IC50 value
of ~0.4 mM DETA/NO (Fig. 6
). These results indicated that in vivo NO is also able to
negatively modulate
1,25(OH)2D3 signaling.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
,25(OH)2D3 signaling
in vivo, which is the first confirmation that the effects of
NO observed in vitro can be related to the in
vivo situation. However, in addition to VDR-RXR heterodimer
proteins, coactivator proteins and various proteins of the basal
transcriptional machinery, the splicing apparatus and the translation
machinery, should be considered because they are also involved in
1,25(OH)2D3 signaling
in vivo. Some of these proteins may also be targets for
NO-induced stress. The NO donor concentrations used appear to be very
high, but limited NO as well as the NO donors half-lives should be
taken into account. It was recently shown that both 2 mM SNOC and 2 mM
DETA/NO, respectively, mediate intracytoplasmic and intranuclear
Zn2+ release in cells in a comparable manner
after 1 and 24 h, respectively (9)
. According to
first-order kinetic laws, 1 mM DETA/NO generates ~3 µM NO/min,
which is comparable to steady-state NO concentrations measured in the
immediate vicinity of an activated cell monolayer (23)
.
Thus, effects of SNOC concentrations used in this study can be assumed
to be comparable to effects that are mediated by iNOS-derived NO
concentrations. VDR-RXR heterodimers, which are already stabilized by complex formation with ligand and/or DNA, were found to be less sensitive to NO-induced stress. This indicates that under in vivo conditions, NO will mostly affect zinc finger transcription factors before they make contact with DNA or ligand, i.e., NO may have inhibitory effects mainly during induction phases, where complexes are formed. This also suggests that complex formation may be regarded as a protective mechanism against NO-induced or oxidative stress.
As shown in this report for VDR and RXR proteins, other members of the
nuclear receptor superfamily probably are also sensitive to NO-induced
stress. Most nuclear receptors form homo- or heterodimeric
complexes on similar types of response elements, i.e., they follow the
same mechanisms of complex formation with DNA and show quite comparable
affinities for these protein–DNA interactions (12
, 24)
.
This would extend the inhibitory effect of NO to basically all nuclear
hormone signaling systems. Moreover, NO has been shown to inhibit the
DNA binding activity of other redox-sensitive transcription factors
such as AP-1 (25)
and NF-
B (26
, 27)
, which
do not contain zinc finger structures but contain cystein residues
within or nearby their DBDs. However, it can be expected that
transcription factors lacking cysteines essential for DNA binding will
not be affected by NO-induced stress. Transcription factors can
probably be ranked according to their sensitivity to NO-induced stress,
where those carrying zinc fingers are the primary targets. This
suggests that the NO concentration that is generated in vivo
during inflammatory processes is the critical parameter that determines
which type of transcription factors may be affected in function.
Oxidative stress, generated by 20 mM
H2O2, was found to destroy
the DNA binding activity of the zinc finger transcription factor Sp1,
but 30 mM of the reductant DTT was able to restore it again
(28)
. In this study the effects of NO-induced stress were
shown to be reversed by using wheat germ extract, which provided
reductive activity and more likely may mimic an intracellular milieu.
Surprisingly, the inhibitory effect of NO was found to be fully
reversible, which makes the regulatory potential of NO even more
interesting. This would suggest that NO does not simply lead to an
irreversible destruction of proteins that are sensitive to NO-induced
stress, but can be antagonized by cellular redox systems such as the
thioredoxin/thioredoxin reductase and glutathione/glutathione reductase
cycles, isomerases, and chaperones (29)
. Restoring zinc
finger structures after NO-induced stress would allow for a more
fine-tuned and specific regulatory action of NO. However, it has to be
demonstrated whether zinc finger transcription factors are repaired or
are most likely newly synthesized after faded NO-induced stress.
In conclusion, a mechanism is presented in this study that would allow for an understanding of the gene regulatory consequences of NO-generated stress during inflammation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
,25(OH)2D3: past, present, and future. J. Bone Miner. Res. 13,1360-1369[Medline]
,25-dihydroxyvitamin D3 response element identified in the mouse c-fos promoter. Biochem. Biophys. Res. Commun. 230,646-651[Medline]
,25-dihydroxyvitamin D3 receptor and the retinoid X receptor on DNA. Nucleic Acids Res 25,4307-4313B DNA binding by nitric oxide. Nucleic Acids Res 24,2236-2242B. Redox Report 2,249-256
This article has been cited by other articles:
|
|
 |
|
  S. Dhakshinamoorthy, S. R. Sridharan, L. Li, P. Y. Ng, L. M. Boxer, and A. G. Porter Protein/DNA arrays identify nitric oxide-regulated cis-element and trans-factor activities some of which govern neuroblastoma cell viability Nucleic Acids Res., August 15, 2007; (2007) gkm594v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. K. Nath, J. Enciso, M. Kuniyasu, X.-Y. Hao, J. A. Madri, and E. Pinter Nitric oxide modulates murine yolk sac vasculogenesis and rescues glucose induced vasculopathy Development, May 15, 2004; 131(10): 2485 - 2496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dhakshinamoorthy and A. G. Porter Nitric Oxide-induced Transcriptional Up-regulation of Protective Genes by Nrf2 via the Antioxidant Response Element Counteracts Apoptosis of Neuroblastoma Cells J. Biol. Chem., May 7, 2004; 279(19): 20096 - 20107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Martinez-Ruiz and S. Lamas S-nitrosylation: a potential new paradigm in signal transduction Cardiovasc Res, April 1, 2004; 62(1): 43 - 52. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-O. Klotz, K.-D. Kroncke, D. P. Buchczyk, and H. Sies Role of Copper, Zinc, Selenium and Tellurium in the Cellular Defense against Oxidative and Nitrosative Stress J. Nutr., May 1, 2003; 133(5): 1448S - 1451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Fan, E. Roy, L. Zhu, T. C. Murphy, M. Kozlowski, M. S. Nanes, and J. Rubin Nitric Oxide Donors Inhibit Luciferase Expression in a Promoter-independent Fashion J. Biol. Chem., March 14, 2003; 278(12): 10232 - 10238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. von Knethen and B. Brune Activation of Peroxisome Proliferator-Activated Receptor {gamma} by Nitric Oxide in Monocytes/Macrophages Down-Regulates p47phox and Attenuates the Respiratory Burst J. Immunol., September 1, 2002; 169(5): 2619 - 2626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-D. Kroncke, L.-O. Klotz, C. V. Suschek, and H. Sies Comparing Nitrosative Versus Oxidative Stress toward Zinc Finger-dependent Transcription. UNIQUE ROLE FOR NO J. Biol. Chem., April 5, 2002; 277(15): 13294 - 13301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-D. KRONCKE Cysteine-Zn2+ complexes: unique molecular switches for inducible nitric oxide synthase-derived NO FASEB J, November 1, 2001; 15(13): 2503 - 2507. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ehrt, D. Schnappinger, S. Bekiranov, J. Drenkow, S. Shi, T. R. Gingeras, T. Gaasterland, G. Schoolnik, and C. Nathan Reprogramming of the Macrophage Transcriptome in Response to Interferon-{gamma} and Mycobacterium tuberculosis: Signaling Roles of Nitric Oxide Synthase-2 and Phagocyte Oxidase J. Exp. Med., October 15, 2001; 194(8): 1123 - 1140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jaiswal, N. F. LaRusso, N. Nishioka, Y. Nakabeppu, and G. J. Gores Human Ogg1, a Protein Involved in the Repair of 8-Oxoguanine, Is Inhibited by Nitric Oxide Cancer Res., September 1, 2001; 61(17): 6388 - 6393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J. Garban and B. Bonavida Nitric Oxide Inhibits the Transcription Repressor Yin-Yang 1 Binding Activity at the Silencer Region of the Fas Promoter: A Pivotal Role for Nitric Oxide in the Up-Regulation of Fas Gene Expression in Human Tumor Cells J. Immunol., July 1, 2001; 167(1): 75 - 81. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
