(The FASEB Journal. 1999;13:1083-1088.)
© 1999 FASEB
Mitochondrial DNA 4977 bp deletion and OH8dG levels correlate in the brain of aged subjects but not Alzheimer's disease patients
ANGELA MARIA SERENA LEZZA*,
PATRIZIA MECOCCI
,
ANTONELLA CORMIO*,
M. FLINT BEAL
,
ANTONIO CHERUBINI
,
PALMIRO CANTATORE*,
UMBERTO SENIN
and
MARIA NICOLA GADALETA*1
* Department of Biochemistry and Molecular Biology, University of Bari, 70125 Bari, Italy;
Department of Gerontology and Geriatrics, University of Perugia, 06122 Perugia, Italy; and
Neurology Research, MGH Harvard Medical School, Massachusetts General Hospital, Boston, Massachusetts 02114, USA
1Correspondence: Department of Biochemistry and Molecular Biology, University of Bari, Via Orabona 4, 70125 Bari, Italy. E-mail: m.n.gadaleta{at}biologia.uniba.it
 |
ABSTRACT
|
|---|
The levels of mitochondrial DNA 4977 bp deletion (mtDNA4977)
and mitochondrial DNA 8'-hydroxy-2'-deoxyguanosine (OH8dG)
were determined in the same samples from two brain areas of healthy
subjects and Alzheimer's disease (AD) patients. A positive correlation
between the age-related increases of mtDNA4977 and of
OH8dG levels was found in the brain of healthy individuals.
On the contrary, in both brain areas of AD patients,
mtDNA4977 levels were very low in the presence of high
OH8dG amounts. These results might be explained assuming
that the increase of OH8dG above a threshold level, as in
AD patients, implies consequences for mtDNA replication and neuronal
cell survival.Lezza, A. M. S., Mecocci, P., Cormio, A.,
Beal, M. F., Cherubini, A., Cantatore, P., Senin, U., Gadaleta,
M. N. Mitochondrial DNA 4977 bp deletion and OH8dG
levels correlate in the brain of aged subjects but not Alzheimer's
disease patients.
Key Words: aging mtDNA deletions mtDNA oxidative damage neurodegenerative disease
 |
INTRODUCTION
|
|---|
HUMAN mtDNA IS a
16569 bp-long circular molecule that codes for 2 ribosomal RNAs
(rRNAs),2
22 transfer RNAs (tRNAs),
and 13 polypeptides, which are part of four out of the five
mitochondrial respiratory chain complexes (1)
.
mtDNA is prone to oxidative damage (2
3
4)
, since it lacks a
histone-like coverage and is very close to the inner mitochondrial
membrane, the major cellular source of reactive oxygen species (ROS).
This was demonstrated by the presence in the mitochondrial DNA (mtDNA)
of aged rat liver (5)
and aged human brain (6)
of high levels of
8'-hydroxy-2'-deoxyguanosine (OH8dG), a
marker of DNA oxidative damage (7)
. Other mtDNA modifications such as
point mutations and deletions have been found with aging (2)
; in
particular, the so-called `common deletion', which removes a region
delimited by the ATPase 8 and ND5 genes, is the most frequently
reported mtDNA deletion in human tissues (8)
. In aging,
mtDNA4977 preferentially accumulates in brain and
muscle, tissues highly dependent on oxidative metabolism and composed
of terminally differentiated cells (2)
.
A correlation between ROS and mtDNA deletions was suggested, although
no direct experimental evidence that ROS do in fact cause mtDNA
deletions has yet been presented (9)
. Measurement of the two most
frequently reported kinds of mtDNA damage in the same specimens could
better reveal their eventual relationship in aging and other situations
where an oxidative stress is active. To accomplish this objective, we
measured the levels of OH8dG and
mtDNA4977 in the same brain samples from the
parietal and frontal cortex of aged healthy subjects and Alzheimer's
disease (AD) patients. The latter were chosen since oxidative stress,
oxidative damage, and mitochondrial dysfunction have been reported in
AD (10
11
12
13)
. The mtDNA4977 (14
15
16
17)
and
OH8dG levels (6,
18)
have already been measured
in the brain of aging subjects and AD patients; however, these studies
dealt with only one type of mtDNA damage at a time.
We report here that a positive correlation between these two kinds of
mtDNA damage exists in the aging human brain; on the contrary, such a
correlation does not occur in AD brain, where to a level of
OH8dG higher than that in control brain always
corresponds a lower level of mtDNA4977.
 |
MATERIALS AND METHODS
|
|---|
Materials
DNase I, spleen 3'-exonuclease (phosphodiesterase II), snake
venom 5'-exonuclease (phosphodiesterase I), alkaline phosphatase,
RNase, 2'-deoxyguanosine, and all other reagents used for quantitative
analysis of OH8dG were from Sigma Chemical
Company (St. Louis, Mo.); ultrapure phenol, mannitol, sucrose, sodium
dodecyl sulfate (SDS), and proteinase K were from Life Technologies
(Gaithersburg, Md.); chloroform, ethanol, methanol, and isoamyl alcohol
were from Fisher (Pittsburgh, Pa.); HindIII,
PstI, dNTPs, 10x reaction buffer, and Taq DNA
polymerase were from Boehringer (Mannheim, Germany); scintillation
mixture Maxifluor was from J. T. Baker (Deventer, The
Netherlands); Na acetate was from Carlo Erba (Rodano, Milan, Italy);
oligonucleotides were from MedProbe (Oslo, Norway);
[32P] dATP was from Amersham (Little
Chalfont, U.K.); and reagents for polyacrylamide gels were from Serva
(Heidelberg, Germany).
Sources of DNA samples
Postmortem brain tissue specimens were obtained from the frontal
and parietal cortices of six control subjects (three men, three women,
age range 6386 years) and seven patients suffering from AD (four men,
three women, age range 5179 years). The postmortem intervals in the
two groups were 14.2 ± 1.7 h for the controls and 13.3 ± 2.3 h for the AD patients. Controls were not taking
psychoactive medications at the time of death and were assessed to be
free from mitochondrial encephalomyopathies and other neurological
disorders. The causes of death were bronchopneumonia for three
subjects, coronary artery disease for two subjects, and congestive
heart failure for one subject. Diagnosis of AD, clinically based on DSM
III-R criteria, was confirmed neuropathologically from the elevated
number of cortical senile plaques and neurofibrillary tangles. The
cerebral cortex was dissected from the white matter on a -10°C cold
plate and then stored at -70°C until mitochondria were isolated.
Frontal cortex consisted of cortex in front of the precentral gyrus and
above the sylvian fissure; parietal cortex consisted of the areas
posterior to the precentral gyrus and the parietoccipital sulcus, and
above the sylvian fissure.
Isolation of mitochondria
Cerebral tissue (1216 g wet weight) was homogenized in 2 ml of
MSB-Ca2+ buffer (0.21 M mannitol, 0.07 M sucrose,
0.05 M Tris-HCl, pH 7.5, and 3 mM CaCl2) per gram
of tissue in a motor-driven glass-Teflon homogenizer, as described in
ref 6
. Mannitol was used because it is a good scavenger of oxygen
radicals. The homogenate was centrifuged at 1500 g for 15
min in a swinging bucket rotor. The supernatant was centrifuged at
20,000 g for 20 min to pellet the mitochondria (6)
. The
cerebral mitochondria, pelleted at the end of this centrifugation, were
resuspended in MSB-EDTA buffer (0.21 M mannitol, 0.07 M sucrose, 0.05 M
Tris-HCl, pH 7.5, and 0.01 M EDTA) and partitioned in two different
aliquots, respectively, for the quantitation of
OH8dG and mtDNA4977.
Quantitative analysis of OH8dG
The quantitative method used for OH8dG has
already been reported (6,
18)
. Pelleted mitochondria, resuspended in
MSB-EDTA, were treated with both RNase and DNase I before being lysed
to eliminate nuclear DNA and RNA contamination. Then they were lysed by
addition of 2% SDS and 400 µg/ml proteinase K. Samples were
incubated at 37°C for 4 h. DNA extraction was performed on each
sample into a fume hood with N2-enriched
atmosphere and at half-light. The used phenol was freshly distilled and
saturated with aqueous buffer. After three extractions with
phenol-chloroform-isoamyl alcohol (25:24:1), mtDNA was precipitated
with 1/10 volume of 3 M Na acetate (pH 7.4) and two volumes of ethanol
at -20°C overnight. The precipitate was collected, dried, and
dissolved in 10 mM Tris HCl, 1 mM EDTA (pH 7.5). The mean yield of
mtDNA from the two brain areas of healthy subjects and AD patients was
1015 µg/g tissue, as spectrophotometrically determined. mtDNA was
digested with DNase I (200 U/mg DNA), spleen exonuclease (0.01 U/mg
DNA), snake venom exonuclease (0.5 U/mg DNA), and alkaline phosphatase
(10 U/mg DNA) in the presence of 40 mM Tris HCl (pH 8.5) containing 10
mM MgCl2 and incubated for 4 h at 37°C.
The OH8dG content was determined in samples
containing 3035 µg mtDNA each by high-performance liquid
chromatography (HPLC) with a 16-sensor coulometric electrode array
cell. The apparatus (ESA model CEAS 550650) consisted of a
refrigerated autosampler, two HPLC pumps controlled by an Epson Equity
III + computer, and a column sensor compartment, which was maintained
at 26 ± 0.01°C. The mobile phase A consisted of 80 mM lithium
phosphate with 0.022 g/l SDS (pH 2.7), whereas the mobile phase B
consisted of 100 mM lithium phosphate with 0.035 g/l SDS (pH 2.7) and
50% methanol. The flow rate was 1 ml/min and the sample run time was
45 min. The initial gradient was from 3 to 4% methanol over 20 min,
followed by an increase to 40% methanol over 25 min.
Quantitative analysis of mtDNA4977
The quantitative method used for mtDNA4977
was the kinetics polymerase chain reaction (PCR) set up by some of us
(19,
20)
. Cerebral mitochondria were lysed by the addition of 1% SDS,
0.1 µg/µl proteinase K and digested at 37°C for 30 min. The
lysate was extracted with an equal volume of phenol-chloroform-isoamyl
alcohol (25:24:1). DNA was precipitated with 0.3 M Na acetate (pH 5.3)
and two volumes of ethanol at -80°C for 1 h. The DNA was
resuspended in 100200 µl of water and digested with
HindIII and PstI at 37°C for 4 h. The
digestion was carried out to prevent, in the following amplification
reactions, the formation of competing nonspecific products deriving
from the predominant, undeleted mtDNA. Quantitative PCR was performed
using a Perkin Elmer DNA thermal cycler in 100 µl reaction mixtures
containing mtDNA (0.52.5 ng of mtDNA for total mtDNA determination or
0.051 µg of mtDNA for deleted mtDNA quantitation), 20 µM of dNTP,
50 pmol of each primer, 2.5 U of Taq DNA polymerase, 1x
reaction buffer made of 10 mM Tris-HCl (pH 8.3), 1.5 mM
MgCl2, 50 mM KCl, and 50 µCi of 3000 Ci/mM
[32P] dATP. The reactions were started by
the addition of the enzyme after a 5 min denaturation at 94°C. The
PCR profiles were as follows: 1 min at 94°C, 1 min at 55°C, and 1
min at 72°C for 25 cycles, using the primers ND1-For 5'
CCCGATGGTGCAGCCGC 3' (nt 30073023 on the L strand) and 3.5 Rev 5'
CTAAGGTCGGGGCGGTGAT 3' (nt 35383520 on the H strand) for total mtDNA;
1 min at 94°C, 1 min at 65°C, and 1 min at 72°C for 30 cycles
using the primers ATP-For 5' CCCCTCTAGAGCCCACTGTAAAGC 3' (nt 82828305
on the L strand) and 13 REV-bis 5' CTAGGGTAGAATCCGAGTATGTTG 3' (nt
1392813905 on the H strand) for deleted mtDNA. Nucleotide positions
were numbered according to ref 21
. The exponential phase of the
amplification was followed by taking aliquots at determined cycles;
they were run on 5% polyacrylamide gels (0.75 mm, 10 cm x 8 cm)
in 1X TBE (0.09M Tris-borate, 0.002 M EDTA) at 130 volts for 1 h.
The radiolabeled PCR products visualized by autoradiography were cut
out of the gel, dried at 80°C for 4 h in scintillation vials,
and counted. The incorporated radioactivity was transformed in
concentration (mol/µl) and used in a plot vs. the number of cycles.
The extrapolation at 0 cycles of the experimental line allowed
determination of the absolute initial concentrations of the template
species without the need for external amplifications as referring
standards (19,
20)
. The method was previously validated with known
quantities of mtDNA in the range used for the experimental
determinations.
Data analysis
Statistical significance was set at P<0.05. All
statistical computations were performed using the computer program
Statistica/Mac by Stat Soft, Inc. (Tulsa, Okla.). The mean ±
SE was calculated for each group of data.
Comparisons were made by unpaired Student's t test, and
correlation was examined using linear and nonlinear regression.
 |
RESULTS
|
|---|
The percentages of mtDNA4977 and the levels
of mtDNA OH8dG were determined in the gray matter
of frontal and parietal cortices of healthy subjects and AD patients.
The percentage of mtDNA4977 was measured by a
kinetics PCR method. Two representative autoradiograms showing the
amplification of deleted and total mtDNA and the corresponding
semilogarithmic plot used to quantitate the respective level of
mtDNA4977 are reported in Fig. 1
. mtDNA OH8dG levels were measured by means of a
HPLC-EC (HPLC-electrochemical) method, as reported in Materials and
Methods. The levels of mtDNA4977 and of
OH8dG vs. the subjects ages of death are plotted
in Fig. 2
. As seen in Fig. 2A, B
, the mtDNA4977
and OH8dG levels increased with age in the two
brain areas of healthy subjects. The increase in both kinds of mtDNA
damage showed a significant exponential trend only in the frontal area,
whereas in the parietal area it did not reach statistical significance,
probably because of the smaller age range of the samples. On the
contrary, in both areas of AD patients (Fig. 2C, D
), the
mtDNA4977 level increased exponentially with age
whereas the OH8dG content remained unchanged at
all examined ages. Therefore, a positive and highly significant linear
correlation between mtDNA4977 and
OH8dG levels (R = 0.989,
P<0.001) was found only in the frontal area of the healthy
subjects, where both variables fitted significant exponential
age-related trends. The same correlation was not demonstrable in the AD
patients because of the lack of a significant age trend for the
OH8dG levels. Moreover, by comparing
mtDNA4977 levels in the frontal or parietal brain area,
respectively, from healthy subjects and AD patients (Fig. 2A, C
or Fig. 2B, D
), it appears that the deletion level
was lower, in both brain areas, in the AD patients than in the healthy
subjects; it was particularly low in the younger-deceased patients,
whereas it approached control values in the older ones. On the
contrary, the OH8dG content in both brain areas
was about one order of magnitude higher in AD patients than in the
healthy subjects at all ages examined.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1. Quantitative determination of the mtDNA4977 level in the
parietal cortex of a 51-year-old AD patient. A)
Autoradiogram of the gel showing the progressive increase of the 669 bp
product derived from deleted mtDNA. The numbers at the top of the lanes
refer to the number of cycles. M = bp size marker (pBR 322 x
HinfI). The starting amount of template DNA for PCR was
50 ng mtDNA. B) Autoradiogram of the gel of the 532 bp
product derived from total mtDNA. The other details are as in panel
A. The starting amount of template DNA for PCR was 0.5
ng mtDNA. C) Semilogarithmic plot of the products
concentrations (moles/µl) vs. cycles numbers. The two PCR kinetics
reach a plateau phase after a different number of cycles, depending on
the abundance of the respective DNA template species.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2. Age-dependent accumulation of mtDNA4977 and
OH8dG in the frontal and in the parietal cortices of
healthy subjects and Alzheimer's disease patients. The level of
mtDNA4977 was expressed as the percentage of mtDNA-deleted
molecules with respect to total mtDNA molecules. The level of
OH8dG was expressed as the percentage of OH8dG
with respect to total OH8dG+dG present in mtDNA.
Percentages of mtDNA4977 and mtDNA OH8dG vs.
age of death were reported, respectively, in the frontal cortex
(A) and the parietal cortex (B) of
healthy subjects, and in the frontal cortex (C) and
parietal cortex (D) of AD patients. The values ±
SE are the averages from three separate HPLC injections and
mtDNA4977 determinations; the OH8dG values,
where appropriate, are multiplied for 101 or
102. () mtDNA4977;
()
OH8 DG.
|
|
To compare the mtDNA4977 and
OH8dG levels of frontal and parietal cortices of
all the examined healthy and AD subjects, we aggregated, by brain
region and independently of the subjects ages, all the values reported
in Fig. 2
. The results are reported in Fig. 3
. The mean values of mtDNA4977 and
OH8dG levels did not show significant differences
between frontal and parietal areas either in the healthy or the AD
group. Significant differences, on the contrary, were found both in
frontal and parietal areas when controls and AD patients were compared;
namely, the OH8dG level in the AD patients was
about six- to eightfold higher than in the healthy subjects, whereas
the mtDNA4977 percentage in the AD patients was
about threefold lower than in the controls.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. Comparison of the mtDNA4977 and mtDNA OH8dG
mean levels in frontal and parietal cortices of controls and AD
patients. The data are the mean values ± SE of the
levels reported in Fig. 2
. For the mtDNA4977 level in
controls: frontal cortex 0.550 ± 0.152 (n=5) and
parietal cortex 0.372 ± 0.069 (n=4); in AD
patients: frontal cortex 0.124 ± 0.048 (n=4) and
parietal cortex 0.113 ± 0.057 (n=6).
OH8G content (multiplied by 10) in controls: frontal cortex
0.005 ± 0.002 (n=4) and parietal cortex 0.013 ± 0.003 (n=4); in AD patients: frontal cortex
0.038 ± 0.004 (n=4) and parietal cortex 0.072 ± 0.012 (n=6). Significance levels: * =
P < 0.05 in comparisons between AD patients and
controls.
|
|
 |
DISCUSSION
|
|---|
In this paper we examined the relationship between
mtDNA4977 and OH8dG levels
measured in the brain of the same aging healthy subjects and AD
patients. The values of mtDNA4977 reported here
are comparable to those previously determined by other authors in the
brains of healthy subjects (14,
15)
and AD patients (16,
17)
. As to the
OH8dG levels, they are in the range already
reported by some of us for the same brain regions of healthy subjects
(6)
and AD patients (18)
. The issue of the measure of the
OH8dG content is highly debated today because
analyzed tissue, extraction procedure, and assay method can influence
the determination of the measured value (22
23
24
25
26)
. In this research, the
HPLC-EC assay and all experimental precautions for obtaining reliable
measurements were used (22,
24)
. Furthermore, the real aim of this
study was the comparison of the relationships between
OH8dG and mtDNA4977 levels,
respectively, in healthy subjects and AD patients. Since such a
comparison showed a statistically significant difference of behavior
between the two groups, we think that the results reported here are
meaningful despite the possible questionable absolute values, as has
also been suggested (22,
26)
. In fact, we report a positive correlation
between mtDNA4977 and OH8dG
levels in aging human brain and a different pattern of the two kinds of
mtDNA damage in AD patients. A positive correlation between
OH8dG and mtDNA7436 levels
was reported previously only in aging human heart (27)
. The hypothesis
presented was that increased levels of oxidized bases in mtDNA, causing
local separation of the double strand, should favor the formation of
deletions during mtDNA replication. This hypothesis might also explain
our results in healthy subjects.
Moreover, we found lower levels of mtDNA4977 in
the presence of a higher content of OH8dG in the
frontal and parietal cortices of AD patients compared with that of
healthy subjects. The mtDNA4977 level appears
much lower in the younger deceased patients than in the older deceased
ones, although the OH8dG level does not change
with the age of death of the patients. This suggests that the
OH8dG load of mtDNA measured in the youngest AD
patients is the maximum life-compatible OH8dG
load of mtDNA. The very low levels of mtDNA4977
in younger deceased patients might suggest that the
OH8dG damage occurs earlier and/or faster in
these subjects than in older deceased patients; therefore,
mtDNA4977 accumulates more slowly in younger
deceased patients owing to the disease-related, very high
OH8dG damage to mtDNA. It is possible that the
increase of oxidized bases represented by OH8dG
above a threshold level, as in AD brain, may hinder the mitochondrial
DNA replication apparatus. This may result in the accumulation of fewer
mtDNA deleted molecules and eventually in the depletion of mtDNA in
more `at risk' neurons (10)
. We should remember that
OH8dG formation on mtDNA can take place as long
as the cause of the oxidative damage to mtDNA is active, whereas the
formation and accumulation of mtDNA deleted molecules require mtDNA
replication. Although by using synthetic oligonucleotides containing
OH8dG in the template strand, Pinz et al. (28)
demonstrated that elongation of mtDNA polymerase was not inhibited, we
should consider that the situation might be different in
vivo. In fact, it has been reported that the highest content of dG
in human mtDNA is present in a highly conserved domain, the central
domain of the D-loop region, where (GG)n repeats
(with n ranging from 3 to 6) are almost exclusively found
(29)
. The hydroxylation of G in the D-loop region of mtDNA may alter
the binding of proteins involved in the process of mtDNA replication
(30)
, becoming crucial to it. Consistent with this hypothesis might be
the decreased recovery of mtDNA reported in rats chronically consuming
ethanol, where an increase of oxidized mtDNA was described (31)
, and
the mtDNA depletion that accompanies the massive accumulation of
OH8dG in the azidothymidine-induced experimental
rat model of mitochondrial myopathy (32)
.
An alternative explanation for the low mtDNA4977
levels in the younger deceased AD patients can be suggested when one
considers the very low values of mtDNA4977 also reported in
patients with Huntington's disease compared with those in age-matched
controls. Such low values were explained with astrocytic gliosis in the
affected areas where the deletion-rich neurons should have been
replaced by relatively deletion-poor astrocytes (33)
. However, the
OH8dG level was not measured in that study.
Astrocytic gliosis has been reported in AD patients (34)
and might also
justify the data here reported.
Although more experimental data are needed to verify the hypothesis
that high levels of OH8dG may interfere with
mtDNA replication in the metabolically most active neurons or in those
particularly vulnerable to this type of damage, such a hypothesis, as
well as that of the disease-related gliosis, might explain the low
levels of mtDNA4977 reported here in the same AD
patients specimens where high levels of OH8dG
were measured. This might be a good clue to understanding some of the
molecular changes involved in AD at the mitochondrial level, where
disease- and age-related oxidative stress might be working
synergistically in the pathogenesis of the disease (34)
.
 |
ACKNOWLEDGMENTS
|
|---|
The authors are grateful to Ms. R. Longo for word processing and
Mr. F. Fracasso for technical assistance. This work was supported by
funds from Grant N. 97.2877.14 from CNR, Italy, and from MURST Italy
COFIN '98 of the Research Program `Regolazione della biogenesi dei
mitocondri nell'invecchiamento ed in condizioni di stress
ossidativo'.
 |
FOOTNOTES
|
|---|
2 Abbreviations: AD, Alzheimer's disease; EC,
electrochemical; HPLC, high-performance liquid chromatography; mtDNA,
mitochondrial DNA; OH8dG, 8'-hydroxy-2'-deoxyguanosine;
PCR, polymerase chain reaction; rRNA, ribosomal RNA; ROS, reactive
oxygen species; SDS, sodium dodecyl sulfate; tRNA, transfer RNA. 
Received for publication March 3, 1998.
Revision received February 4, 1999.
 |
REFERENCES
|
|---|
-
Wallace, D. C. (1992) Diseases of the mitochondrial DNA. Annu. Rev. Biochem. 61,1175-1212[Medline]
-
Wallace, D. C., Bohr, V. A., Cortopassi, G.,
Kadenbach, B., Linn, S., Linnane, A. W., Richter, C., and Shay,
J. W. (1995) The role of bioenergetics and mitochondrial DNA
mutations in aging and age-related diseases. In Molecular Aspects
of Aging (Esser, K., and Martin, G. M., eds) pp. 199225,
John Wiley & Sons Ltd., Chichester, Sussex, U.K.
-
Shigenaga, M. K., Hagen, T. M., Ames, B. N. (1994) Oxidative damage and mitochondrial decay in aging. Proc. Natl. Acad. Sci. U. S. A. 91,10771-10778[Abstract/Free Full Text]
-
Yakes, F. M., Van Houten, B. (1997) Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 94,514-519[Abstract/Free Full Text]
-
Richter, C., Park, J. W., Ames, B. N. (1988) Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl. Acad. Sci. U. S. A. 85,6465-6467[Abstract/Free Full Text]
-
Mecocci, P., MacGarvey, U., Kaufman, A. E., Koontz, D., Shoffner, J. M., Wallace, D. C., Flint Beal, M. (1993) Oxidative damage to mitochondrial DNA shows marked age-dependent increase in human brain. Ann. Neurol. 34,609-616[Medline]
-
Ames, B. N., Shigenaga, M. K., Hagen, T. M. (1993) Oxidants, antioxidants, and the degenerative diseases of aging. Proc. Natl. Acad. Sci. U. S. A. 90,7915-7922[Abstract/Free Full Text]
-
Schon, E. A., Rizzuto, R., Moraes, C. T., Nakase, H., Zeviani, M., DiMauro, S. (1989) A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 244,346-349[Abstract/Free Full Text]
-
Beckman, K. B., Ames, B. N. (1998) The free radical theory of aging matures. Physiol. Rev. 77,547-581
-
Flint Beal, M., Hyman, B. T., Koroshetz, W. (1993) Do defects in mitochondrial energy metabolism underlie the pathology of neurodegenerative diseases?. Trends Neurosci 16,125-131[Medline]
-
Benzi, G., Moretti, A. (1995) Age- and peroxidative stress-related modifications of the cerebral enzymatic activities linked to mitochondria and the glutathione system. Free Rad. Biol. Med. 19,77-101[Medline]
-
Schapira, A. H. V. (1996) Oxidative stress and mitochondrial dysfunction in neurodegeneration. Curr. Opin. Neurol. 9,260-264[Medline]
-
Lyras, L., Cairns, N. J., Jenner, A., Jenner, P., Halliwell, B. (1997) An assessment of oxidative damage to proteins, lipids, and DNA in brain from patients with Alzheimer's disease. J. Neurochem. 68,2061-2069[Medline]
-
Soong, N. W., Hinton, D. R., Cortopassi, G., Arnheim, N. (1992) Mosaicism for a specific somatic mitochondrial DNA mutation in adult human brain. Nature Genet 2,318-323[Medline]
-
Corral-Debrinski, M., Horton, T., Lott, M. T., Shoffner, J. M., Flint Beal, M., Wallace, D. C. (1992) Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age. Nature Genet 2,324-329[Medline]
-
Corral-Debrinski, M., Horton, T., Lott, M. T., Shoffner, J. M., McKee, A. C., Flint Beal, M., Graham, B. H., Wallace, D. C. (1994) Marked changes in mitochondrial DNA deletion levels in Alzheimer brains. Genomics 23,471-476[Medline]
-
Cavelier, L., Jazin, E. D., Eriksson, I., Prince, J., Bave, U., Oreland, L., Gyllensten, U. (1995) Decreased cytochrome-c oxidase activity and lack of age-related accumulation of mitochondrial DNA deletions in the brains of schizophrenics. Genomics 29,217-224[Medline]
-
Mecocci, P., MacGarvey, U., Flint Beal, M. (1994) Oxidative damage to mitochondrial DNA is increased in Alzheimer's disease. Ann. Neurol. 36,747-751[Medline]
-
Lezza, A. M. S., Boffoli, D., Scacco, S., Cantatore, P., Gadaleta, M. N. (1994) Correlation between mitochondrial DNA 4977-bp deletion and respiratory chain enzyme activities in aging human skeletal muscles. Biochem. Biophys. Res. Commun. 205,772-779[Medline]
-
Gadaleta, M. N., Lezza, A. M. S., and
Cantatore, P. (1999) Mitochondrial DNA deletions. In Methods in
Aging Research (Yu, B., ed) pp. 475511, CRC Press, Boca Raton,
Fla.
-
Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., Young, I. G. (1981) Sequence and organization of the human mitochondrial genome. Nature (London) 290,457-465[Medline]
-
Beckman, K. B., Ames, B. N. (1996) Detection and quantification of oxidative adducts of mitochondrial DNA. Methods Enzymol 264,442-453[Medline]
-
Beckman, K. B., Ames, B. N. (1997) Oxidative decay of DNA. J. Biol. Chem. 272,19633-19636[Free Full Text]
-
Kasai, H. (1997) Analysis of a form of oxidative DNA damage, 8-hydroxy-2'-deoxyguanosine, as a marker of cellular oxidative stress during carcinogenesis. Mutat. Res. 387,147-163[Medline]
-
Cadet, J., Douki, T., Ravanat, J. L. (1997) Artifacts associated with the measurement of oxidized DNA bases. Environ. Health Perspect. 105,1034-1039[Medline]
-
Helbock, H. J., Beckman, K. B., Shigenaga, M. K., Walter, P. B., Woodall, A. A., Yeo, H. C., Ames, B. N. (1998) DNA oxidation matters: the HPLC-electrochemical detection assay of 8-oxo-deoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. U. S. A. 95,288-293[Abstract/Free Full Text]
-
Ozawa, T. (1994) Mitochondrial cardiomyopathy. Herz 19,105-118[Medline]
-
Pinz, K. G., Shibutani, S., Bogenhagen, D. F. (1995) Action of mitochondrial DNA polymerase
at sites of base loss or oxidative damage. J. Biol. Chem. 270,9202-9206[Abstract/Free Full Text]
-
Saccone, C. (in press) Structure, and evolution of metazoan
mitochondrial genome. In Frontiers of Cellular Bioenergetics:
Molecular Biology, Biochemistry, and Physiopathology (Papa, S.,
Guerrieri, F., and Tager, J., eds) Plenum Publishing Company Ltd,
London
-
Cantatore, P., Daddabbo, L., Fracasso, F., Gadaleta, M. N. (1995) Identification by in organello footprinting of protein contact sites and of single-stranded DNA sequences in the regulatory region of rat mitochondrial DNA. J. Biol. Chem. 270,25020-25027[Abstract/Free Full Text]
-
Cahill, A., Wang, X., Hoek, J. B. (1997) Increased oxidative damage to mitochondrial DNA following chronic ethanol consumption. Biochem. Biophys. Res. Commun. 235,286-290[Medline]
-
Hayakawa, M., Ogawa, T., Sugiyama, S., Tanaka, M., Ozawa, T. (1991) Massive conversion of guanosine to 8-hydroxy-guanosine in mouse liver mitochondrial DNA by administration of azidothymidine. Biochem. Biophys. Res. Commun. 176,87-93[Medline]
-
Chen, X., Bonilla, E., Sciacco, M., Schon, E. A. (1995) Paucity of deleted mitochondrial DNAs in brain regions of Huntington's disease patients. Biochim. Biophys. Acta 1271,229-233[Medline]
-
Smith, M. A., Sayre, L. M., Monnier, V. M., Perry, G. (1995) Radical aging in Alzheimer's disease. Trends Neurosci 18,172-176[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
S. Maynard, S. H. Schurman, C. Harboe, N. C. de Souza-Pinto, and V. A. Bohr
Base excision repair of oxidative DNA damage and association with cancer and aging
Carcinogenesis,
January 1, 2009;
30(1):
2 - 10.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Pesce, A. Cormio, F. Fracasso, A. M. S. Lezza, P. Cantatore, and M. N. Gadaleta
Age-Related Changes of Mitochondrial DNA Content and Mitochondrial Genotypic and Phenotypic Alterations in Rat Hind-Limb Skeletal Muscles
J Gerontol A Biol Sci Med Sci,
June 1, 2005;
60(6):
715 - 723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yamagata, K. Muro, J. Usui, M. Hagiwara, H. Kai, Y. Arakawa, Y. Shimizu, C. Tomida, K. Hirayama, M. Kobayashi, et al.
Mitochondrial DNA Mutations in Focal Segmental Glomerulosclerosis Lesions
J. Am. Soc. Nephrol.,
July 1, 2002;
13(7):
1816 - 1823.
[Abstract]
[Full Text]
[PDF]
|
 |
|