FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LEZZA, A. M. S.
Right arrow Articles by GADALETA, M. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LEZZA, A. M. S.
Right arrow Articles by GADALETA, M. N.
(The FASEB Journal. 1999;13:1083-1088.)
© 1999 FASEB

Mitochondrial DNA 4977 bp deletion and OH8dG levels correlate in the brain of aged subjects but not Alzheimer's disease patients

ANGELA MARIA SERENA LEZZA*, PATRIZIA MECOCCI{dagger}, ANTONELLA CORMIO*, M. FLINT BEAL{ddagger}, ANTONIO CHERUBINI{dagger}, PALMIRO CANTATORE*, UMBERTO SENIN{dagger} and MARIA NICOLA GADALETA*1

* Department of Biochemistry and Molecular Biology, University of Bari, 70125 Bari, Italy;
{dagger} Department of Gerontology and Geriatrics, University of Perugia, 06122 Perugia, Italy; and
{ddagger} Neurology Research, MGH Harvard Medical School, Massachusetts General Hospital, Boston, Massachusetts 02114, USA

1Correspondence: Department of Biochemistry and Molecular Biology, University of Bari, Via Orabona 4, 70125 Bari, Italy. E-mail: m.n.gadaleta{at}biologia.uniba.it


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The levels of mitochondrial DNA 4977 bp deletion (mtDNA4977) and mitochondrial DNA 8'-hydroxy-2'-deoxyguanosine (OH8dG) were determined in the same samples from two brain areas of healthy subjects and Alzheimer's disease (AD) patients. A positive correlation between the age-related increases of mtDNA4977 and of OH8dG levels was found in the brain of healthy individuals. On the contrary, in both brain areas of AD patients, mtDNA4977 levels were very low in the presence of high OH8dG amounts. These results might be explained assuming that the increase of OH8dG above a threshold level, as in AD patients, implies consequences for mtDNA replication and neuronal cell survival.—Lezza, A. M. S., Mecocci, P., Cormio, A., Beal, M. F., Cherubini, A., Cantatore, P., Senin, U., Gadaleta, M. N. Mitochondrial DNA 4977 bp deletion and OH8dG levels correlate in the brain of aged subjects but not Alzheimer's disease patients.


Key Words: aging • mtDNA deletions • mtDNA oxidative damage • neurodegenerative disease


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
HUMAN mtDNA IS a 16569 bp-long circular molecule that codes for 2 ribosomal RNAs (rRNAs),2 22 transfer RNAs (tRNAs), and 13 polypeptides, which are part of four out of the five mitochondrial respiratory chain complexes (1) .

mtDNA is prone to oxidative damage (2 3 4) , since it lacks a histone-like coverage and is very close to the inner mitochondrial membrane, the major cellular source of reactive oxygen species (ROS). This was demonstrated by the presence in the mitochondrial DNA (mtDNA) of aged rat liver (5) and aged human brain (6) of high levels of 8'-hydroxy-2'-deoxyguanosine (OH8dG), a marker of DNA oxidative damage (7) . Other mtDNA modifications such as point mutations and deletions have been found with aging (2) ; in particular, the so-called `common deletion', which removes a region delimited by the ATPase 8 and ND5 genes, is the most frequently reported mtDNA deletion in human tissues (8) . In aging, mtDNA4977 preferentially accumulates in brain and muscle, tissues highly dependent on oxidative metabolism and composed of terminally differentiated cells (2) .

A correlation between ROS and mtDNA deletions was suggested, although no direct experimental evidence that ROS do in fact cause mtDNA deletions has yet been presented (9) . Measurement of the two most frequently reported kinds of mtDNA damage in the same specimens could better reveal their eventual relationship in aging and other situations where an oxidative stress is active. To accomplish this objective, we measured the levels of OH8dG and mtDNA4977 in the same brain samples from the parietal and frontal cortex of aged healthy subjects and Alzheimer's disease (AD) patients. The latter were chosen since oxidative stress, oxidative damage, and mitochondrial dysfunction have been reported in AD (10 11 12 13) . The mtDNA4977 (14 15 16 17) and OH8dG levels (6, 18) have already been measured in the brain of aging subjects and AD patients; however, these studies dealt with only one type of mtDNA damage at a time.

We report here that a positive correlation between these two kinds of mtDNA damage exists in the aging human brain; on the contrary, such a correlation does not occur in AD brain, where to a level of OH8dG higher than that in control brain always corresponds a lower level of mtDNA4977.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
DNase I, spleen 3'-exonuclease (phosphodiesterase II), snake venom 5'-exonuclease (phosphodiesterase I), alkaline phosphatase, RNase, 2'-deoxyguanosine, and all other reagents used for quantitative analysis of OH8dG were from Sigma Chemical Company (St. Louis, Mo.); ultrapure phenol, mannitol, sucrose, sodium dodecyl sulfate (SDS), and proteinase K were from Life Technologies (Gaithersburg, Md.); chloroform, ethanol, methanol, and isoamyl alcohol were from Fisher (Pittsburgh, Pa.); HindIII, PstI, dNTPs, 10x reaction buffer, and Taq DNA polymerase were from Boehringer (Mannheim, Germany); scintillation mixture Maxifluor was from J. T. Baker (Deventer, The Netherlands); Na acetate was from Carlo Erba (Rodano, Milan, Italy); oligonucleotides were from MedProbe (Oslo, Norway); {alpha}[32P] dATP was from Amersham (Little Chalfont, U.K.); and reagents for polyacrylamide gels were from Serva (Heidelberg, Germany).

Sources of DNA samples
Postmortem brain tissue specimens were obtained from the frontal and parietal cortices of six control subjects (three men, three women, age range 63–86 years) and seven patients suffering from AD (four men, three women, age range 51–79 years). The postmortem intervals in the two groups were 14.2 ± 1.7 h for the controls and 13.3 ± 2.3 h for the AD patients. Controls were not taking psychoactive medications at the time of death and were assessed to be free from mitochondrial encephalomyopathies and other neurological disorders. The causes of death were bronchopneumonia for three subjects, coronary artery disease for two subjects, and congestive heart failure for one subject. Diagnosis of AD, clinically based on DSM III-R criteria, was confirmed neuropathologically from the elevated number of cortical senile plaques and neurofibrillary tangles. The cerebral cortex was dissected from the white matter on a -10°C cold plate and then stored at -70°C until mitochondria were isolated. Frontal cortex consisted of cortex in front of the precentral gyrus and above the sylvian fissure; parietal cortex consisted of the areas posterior to the precentral gyrus and the parietoccipital sulcus, and above the sylvian fissure.

Isolation of mitochondria
Cerebral tissue (12–16 g wet weight) was homogenized in 2 ml of MSB-Ca2+ buffer (0.21 M mannitol, 0.07 M sucrose, 0.05 M Tris-HCl, pH 7.5, and 3 mM CaCl2) per gram of tissue in a motor-driven glass-Teflon homogenizer, as described in ref 6 . Mannitol was used because it is a good scavenger of oxygen radicals. The homogenate was centrifuged at 1500 g for 15 min in a swinging bucket rotor. The supernatant was centrifuged at 20,000 g for 20 min to pellet the mitochondria (6) . The cerebral mitochondria, pelleted at the end of this centrifugation, were resuspended in MSB-EDTA buffer (0.21 M mannitol, 0.07 M sucrose, 0.05 M Tris-HCl, pH 7.5, and 0.01 M EDTA) and partitioned in two different aliquots, respectively, for the quantitation of OH8dG and mtDNA4977.

Quantitative analysis of OH8dG
The quantitative method used for OH8dG has already been reported (6, 18) . Pelleted mitochondria, resuspended in MSB-EDTA, were treated with both RNase and DNase I before being lysed to eliminate nuclear DNA and RNA contamination. Then they were lysed by addition of 2% SDS and 400 µg/ml proteinase K. Samples were incubated at 37°C for 4 h. DNA extraction was performed on each sample into a fume hood with N2-enriched atmosphere and at half-light. The used phenol was freshly distilled and saturated with aqueous buffer. After three extractions with phenol-chloroform-isoamyl alcohol (25:24:1), mtDNA was precipitated with 1/10 volume of 3 M Na acetate (pH 7.4) and two volumes of ethanol at -20°C overnight. The precipitate was collected, dried, and dissolved in 10 mM Tris HCl, 1 mM EDTA (pH 7.5). The mean yield of mtDNA from the two brain areas of healthy subjects and AD patients was 10–15 µg/g tissue, as spectrophotometrically determined. mtDNA was digested with DNase I (200 U/mg DNA), spleen exonuclease (0.01 U/mg DNA), snake venom exonuclease (0.5 U/mg DNA), and alkaline phosphatase (10 U/mg DNA) in the presence of 40 mM Tris HCl (pH 8.5) containing 10 mM MgCl2 and incubated for 4 h at 37°C. The OH8dG content was determined in samples containing 30–35 µg mtDNA each by high-performance liquid chromatography (HPLC) with a 16-sensor coulometric electrode array cell. The apparatus (ESA model CEAS 55–0650) consisted of a refrigerated autosampler, two HPLC pumps controlled by an Epson Equity III + computer, and a column sensor compartment, which was maintained at 26 ± 0.01°C. The mobile phase A consisted of 80 mM lithium phosphate with 0.022 g/l SDS (pH 2.7), whereas the mobile phase B consisted of 100 mM lithium phosphate with 0.035 g/l SDS (pH 2.7) and 50% methanol. The flow rate was 1 ml/min and the sample run time was 45 min. The initial gradient was from 3 to 4% methanol over 20 min, followed by an increase to 40% methanol over 25 min.

Quantitative analysis of mtDNA4977
The quantitative method used for mtDNA4977 was the kinetics polymerase chain reaction (PCR) set up by some of us (19, 20) . Cerebral mitochondria were lysed by the addition of 1% SDS, 0.1 µg/µl proteinase K and digested at 37°C for 30 min. The lysate was extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1). DNA was precipitated with 0.3 M Na acetate (pH 5.3) and two volumes of ethanol at -80°C for 1 h. The DNA was resuspended in 100–200 µl of water and digested with HindIII and PstI at 37°C for 4 h. The digestion was carried out to prevent, in the following amplification reactions, the formation of competing nonspecific products deriving from the predominant, undeleted mtDNA. Quantitative PCR was performed using a Perkin Elmer DNA thermal cycler in 100 µl reaction mixtures containing mtDNA (0.5–2.5 ng of mtDNA for total mtDNA determination or 0.05–1 µg of mtDNA for deleted mtDNA quantitation), 20 µM of dNTP, 50 pmol of each primer, 2.5 U of Taq DNA polymerase, 1x reaction buffer made of 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, and 50 µCi of 3000 Ci/mM {alpha}[32P] dATP. The reactions were started by the addition of the enzyme after a 5 min denaturation at 94°C. The PCR profiles were as follows: 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C for 25 cycles, using the primers ND1-For 5' CCCGATGGTGCAGCCGC 3' (nt 3007–3023 on the L strand) and 3.5 Rev 5' CTAAGGTCGGGGCGGTGAT 3' (nt 3538–3520 on the H strand) for total mtDNA; 1 min at 94°C, 1 min at 65°C, and 1 min at 72°C for 30 cycles using the primers ATP-For 5' CCCCTCTAGAGCCCACTGTAAAGC 3' (nt 8282–8305 on the L strand) and 13 REV-bis 5' CTAGGGTAGAATCCGAGTATGTTG 3' (nt 13928–13905 on the H strand) for deleted mtDNA. Nucleotide positions were numbered according to ref 21 . The exponential phase of the amplification was followed by taking aliquots at determined cycles; they were run on 5% polyacrylamide gels (0.75 mm, 10 cm x 8 cm) in 1X TBE (0.09M Tris-borate, 0.002 M EDTA) at 130 volts for 1 h. The radiolabeled PCR products visualized by autoradiography were cut out of the gel, dried at 80°C for 4 h in scintillation vials, and counted. The incorporated radioactivity was transformed in concentration (mol/µl) and used in a plot vs. the number of cycles. The extrapolation at 0 cycles of the experimental line allowed determination of the absolute initial concentrations of the template species without the need for external amplifications as referring standards (19, 20) . The method was previously validated with known quantities of mtDNA in the range used for the experimental determinations.

Data analysis
Statistical significance was set at P<0.05. All statistical computations were performed using the computer program Statistica/Mac by Stat Soft, Inc. (Tulsa, Okla.). The mean ± SE was calculated for each group of data. Comparisons were made by unpaired Student's t test, and correlation was examined using linear and nonlinear regression.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The percentages of mtDNA4977 and the levels of mtDNA OH8dG were determined in the gray matter of frontal and parietal cortices of healthy subjects and AD patients. The percentage of mtDNA4977 was measured by a kinetics PCR method. Two representative autoradiograms showing the amplification of deleted and total mtDNA and the corresponding semilogarithmic plot used to quantitate the respective level of mtDNA4977 are reported in Fig. 1 . mtDNA OH8dG levels were measured by means of a HPLC-EC (HPLC-electrochemical) method, as reported in Materials and Methods. The levels of mtDNA4977 and of OH8dG vs. the subjects ages of death are plotted in Fig. 2 . As seen in Fig. 2A, B , the mtDNA4977 and OH8dG levels increased with age in the two brain areas of healthy subjects. The increase in both kinds of mtDNA damage showed a significant exponential trend only in the frontal area, whereas in the parietal area it did not reach statistical significance, probably because of the smaller age range of the samples. On the contrary, in both areas of AD patients (Fig. 2C, D ), the mtDNA4977 level increased exponentially with age whereas the OH8dG content remained unchanged at all examined ages. Therefore, a positive and highly significant linear correlation between mtDNA4977 and OH8dG levels (R = 0.989, P<0.001) was found only in the frontal area of the healthy subjects, where both variables fitted significant exponential age-related trends. The same correlation was not demonstrable in the AD patients because of the lack of a significant age trend for the OH8dG levels. Moreover, by comparing mtDNA4977 levels in the frontal or parietal brain area, respectively, from healthy subjects and AD patients (Fig. 2A, C or Fig. 2B, D ), it appears that the deletion level was lower, in both brain areas, in the AD patients than in the healthy subjects; it was particularly low in the younger-deceased patients, whereas it approached control values in the older ones. On the contrary, the OH8dG content in both brain areas was about one order of magnitude higher in AD patients than in the healthy subjects at all ages examined.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Quantitative determination of the mtDNA4977 level in the parietal cortex of a 51-year-old AD patient. A) Autoradiogram of the gel showing the progressive increase of the 669 bp product derived from deleted mtDNA. The numbers at the top of the lanes refer to the number of cycles. M = bp size marker (pBR 322 x HinfI). The starting amount of template DNA for PCR was 50 ng mtDNA. B) Autoradiogram of the gel of the 532 bp product derived from total mtDNA. The other details are as in panel A. The starting amount of template DNA for PCR was 0.5 ng mtDNA. C) Semilogarithmic plot of the products concentrations (moles/µl) vs. cycles numbers. The two PCR kinetics reach a plateau phase after a different number of cycles, depending on the abundance of the respective DNA template species.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Age-dependent accumulation of mtDNA4977 and OH8dG in the frontal and in the parietal cortices of healthy subjects and Alzheimer's disease patients. The level of mtDNA4977 was expressed as the percentage of mtDNA-deleted molecules with respect to total mtDNA molecules. The level of OH8dG was expressed as the percentage of OH8dG with respect to total OH8dG+dG present in mtDNA. Percentages of mtDNA4977 and mtDNA OH8dG vs. age of death were reported, respectively, in the frontal cortex (A) and the parietal cortex (B) of healthy subjects, and in the frontal cortex (C) and parietal cortex (D) of AD patients. The values ± SE are the averages from three separate HPLC injections and mtDNA4977 determinations; the OH8dG values, where appropriate, are multiplied for 101 or 102. (—) mtDNA4977; (•—•—•) OH8 DG.

To compare the mtDNA4977 and OH8dG levels of frontal and parietal cortices of all the examined healthy and AD subjects, we aggregated, by brain region and independently of the subjects ages, all the values reported in Fig. 2 . The results are reported in Fig. 3 . The mean values of mtDNA4977 and OH8dG levels did not show significant differences between frontal and parietal areas either in the healthy or the AD group. Significant differences, on the contrary, were found both in frontal and parietal areas when controls and AD patients were compared; namely, the OH8dG level in the AD patients was about six- to eightfold higher than in the healthy subjects, whereas the mtDNA4977 percentage in the AD patients was about threefold lower than in the controls.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Comparison of the mtDNA4977 and mtDNA OH8dG mean levels in frontal and parietal cortices of controls and AD patients. The data are the mean values ± SE of the levels reported in Fig. 2 . For the mtDNA4977 level in controls: frontal cortex 0.550 ± 0.152 (n=5) and parietal cortex 0.372 ± 0.069 (n=4); in AD patients: frontal cortex 0.124 ± 0.048 (n=4) and parietal cortex 0.113 ± 0.057 (n=6). OH8G content (multiplied by 10) in controls: frontal cortex 0.005 ± 0.002 (n=4) and parietal cortex 0.013 ± 0.003 (n=4); in AD patients: frontal cortex 0.038 ± 0.004 (n=4) and parietal cortex 0.072 ± 0.012 (n=6). Significance levels: * = P < 0.05 in comparisons between AD patients and controls.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
In this paper we examined the relationship between mtDNA4977 and OH8dG levels measured in the brain of the same aging healthy subjects and AD patients. The values of mtDNA4977 reported here are comparable to those previously determined by other authors in the brains of healthy subjects (14, 15) and AD patients (16, 17) . As to the OH8dG levels, they are in the range already reported by some of us for the same brain regions of healthy subjects (6) and AD patients (18) . The issue of the measure of the OH8dG content is highly debated today because analyzed tissue, extraction procedure, and assay method can influence the determination of the measured value (22 23 24 25 26) . In this research, the HPLC-EC assay and all experimental precautions for obtaining reliable measurements were used (22, 24) . Furthermore, the real aim of this study was the comparison of the relationships between OH8dG and mtDNA4977 levels, respectively, in healthy subjects and AD patients. Since such a comparison showed a statistically significant difference of behavior between the two groups, we think that the results reported here are meaningful despite the possible questionable absolute values, as has also been suggested (22, 26) . In fact, we report a positive correlation between mtDNA4977 and OH8dG levels in aging human brain and a different pattern of the two kinds of mtDNA damage in AD patients. A positive correlation between OH8dG and mtDNA7436 levels was reported previously only in aging human heart (27) . The hypothesis presented was that increased levels of oxidized bases in mtDNA, causing local separation of the double strand, should favor the formation of deletions during mtDNA replication. This hypothesis might also explain our results in healthy subjects.

Moreover, we found lower levels of mtDNA4977 in the presence of a higher content of OH8dG in the frontal and parietal cortices of AD patients compared with that of healthy subjects. The mtDNA4977 level appears much lower in the younger deceased patients than in the older deceased ones, although the OH8dG level does not change with the age of death of the patients. This suggests that the OH8dG load of mtDNA measured in the youngest AD patients is the maximum life-compatible OH8dG load of mtDNA. The very low levels of mtDNA4977 in younger deceased patients might suggest that the OH8dG damage occurs earlier and/or faster in these subjects than in older deceased patients; therefore, mtDNA4977 accumulates more slowly in younger deceased patients owing to the disease-related, very high OH8dG damage to mtDNA. It is possible that the increase of oxidized bases represented by OH8dG above a threshold level, as in AD brain, may hinder the mitochondrial DNA replication apparatus. This may result in the accumulation of fewer mtDNA deleted molecules and eventually in the depletion of mtDNA in more `at risk' neurons (10) . We should remember that OH8dG formation on mtDNA can take place as long as the cause of the oxidative damage to mtDNA is active, whereas the formation and accumulation of mtDNA deleted molecules require mtDNA replication. Although by using synthetic oligonucleotides containing OH8dG in the template strand, Pinz et al. (28) demonstrated that elongation of mtDNA polymerase was not inhibited, we should consider that the situation might be different in vivo. In fact, it has been reported that the highest content of dG in human mtDNA is present in a highly conserved domain, the central domain of the D-loop region, where (GG)n repeats (with n ranging from 3 to 6) are almost exclusively found (29) . The hydroxylation of G in the D-loop region of mtDNA may alter the binding of proteins involved in the process of mtDNA replication (30) , becoming crucial to it. Consistent with this hypothesis might be the decreased recovery of mtDNA reported in rats chronically consuming ethanol, where an increase of oxidized mtDNA was described (31) , and the mtDNA depletion that accompanies the massive accumulation of OH8dG in the azidothymidine-induced experimental rat model of mitochondrial myopathy (32) .

An alternative explanation for the low mtDNA4977 levels in the younger deceased AD patients can be suggested when one considers the very low values of mtDNA4977 also reported in patients with Huntington's disease compared with those in age-matched controls. Such low values were explained with astrocytic gliosis in the affected areas where the deletion-rich neurons should have been replaced by relatively deletion-poor astrocytes (33) . However, the OH8dG level was not measured in that study. Astrocytic gliosis has been reported in AD patients (34) and might also justify the data here reported.

Although more experimental data are needed to verify the hypothesis that high levels of OH8dG may interfere with mtDNA replication in the metabolically most active neurons or in those particularly vulnerable to this type of damage, such a hypothesis, as well as that of the disease-related gliosis, might explain the low levels of mtDNA4977 reported here in the same AD patients specimens where high levels of OH8dG were measured. This might be a good clue to understanding some of the molecular changes involved in AD at the mitochondrial level, where disease- and age-related oxidative stress might be working synergistically in the pathogenesis of the disease (34) .


   ACKNOWLEDGMENTS
 
The authors are grateful to Ms. R. Longo for word processing and Mr. F. Fracasso for technical assistance. This work was supported by funds from Grant N. 97.2877.14 from CNR, Italy, and from MURST Italy COFIN '98 of the Research Program `Regolazione della biogenesi dei mitocondri nell'invecchiamento ed in condizioni di stress ossidativo'.


   FOOTNOTES
 
2 Abbreviations: AD, Alzheimer's disease; EC, electrochemical; HPLC, high-performance liquid chromatography; mtDNA, mitochondrial DNA; OH8dG, 8'-hydroxy-2'-deoxyguanosine; PCR, polymerase chain reaction; rRNA, ribosomal RNA; ROS, reactive oxygen species; SDS, sodium dodecyl sulfate; tRNA, transfer RNA.

Received for publication March 3, 1998. Revision received February 4, 1999.
   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Wallace, D. C. (1992) Diseases of the mitochondrial DNA. Annu. Rev. Biochem. 61,1175-1212[Medline]
  2. Wallace, D. C., Bohr, V. A., Cortopassi, G., Kadenbach, B., Linn, S., Linnane, A. W., Richter, C., and Shay, J. W. (1995) The role of bioenergetics and mitochondrial DNA mutations in aging and age-related diseases. In Molecular Aspects of Aging (Esser, K., and Martin, G. M., eds) pp. 199–225, John Wiley & Sons Ltd., Chichester, Sussex, U.K.
  3. Shigenaga, M. K., Hagen, T. M., Ames, B. N. (1994) Oxidative damage and mitochondrial decay in aging. Proc. Natl. Acad. Sci. U. S. A. 91,10771-10778[Abstract/Free Full Text]
  4. Yakes, F. M., Van Houten, B. (1997) Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 94,514-519[Abstract/Free Full Text]
  5. Richter, C., Park, J. W., Ames, B. N. (1988) Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl. Acad. Sci. U. S. A. 85,6465-6467[Abstract/Free Full Text]
  6. Mecocci, P., MacGarvey, U., Kaufman, A. E., Koontz, D., Shoffner, J. M., Wallace, D. C., Flint Beal, M. (1993) Oxidative damage to mitochondrial DNA shows marked age-dependent increase in human brain. Ann. Neurol. 34,609-616[Medline]
  7. Ames, B. N., Shigenaga, M. K., Hagen, T. M. (1993) Oxidants, antioxidants, and the degenerative diseases of aging. Proc. Natl. Acad. Sci. U. S. A. 90,7915-7922[Abstract/Free Full Text]
  8. Schon, E. A., Rizzuto, R., Moraes, C. T., Nakase, H., Zeviani, M., DiMauro, S. (1989) A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science 244,346-349[Abstract/Free Full Text]
  9. Beckman, K. B., Ames, B. N. (1998) The free radical theory of aging matures. Physiol. Rev. 77,547-581
  10. Flint Beal, M., Hyman, B. T., Koroshetz, W. (1993) Do defects in mitochondrial energy metabolism underlie the pathology of neurodegenerative diseases?. Trends Neurosci 16,125-131[Medline]
  11. Benzi, G., Moretti, A. (1995) Age- and peroxidative stress-related modifications of the cerebral enzymatic activities linked to mitochondria and the glutathione system. Free Rad. Biol. Med. 19,77-101[Medline]
  12. Schapira, A. H. V. (1996) Oxidative stress and mitochondrial dysfunction in neurodegeneration. Curr. Opin. Neurol. 9,260-264[Medline]
  13. Lyras, L., Cairns, N. J., Jenner, A., Jenner, P., Halliwell, B. (1997) An assessment of oxidative damage to proteins, lipids, and DNA in brain from patients with Alzheimer's disease. J. Neurochem. 68,2061-2069[Medline]
  14. Soong, N. W., Hinton, D. R., Cortopassi, G., Arnheim, N. (1992) Mosaicism for a specific somatic mitochondrial DNA mutation in adult human brain. Nature Genet 2,318-323[Medline]
  15. Corral-Debrinski, M., Horton, T., Lott, M. T., Shoffner, J. M., Flint Beal, M., Wallace, D. C. (1992) Mitochondrial DNA deletions in human brain: regional variability and increase with advanced age. Nature Genet 2,324-329[Medline]
  16. Corral-Debrinski, M., Horton, T., Lott, M. T., Shoffner, J. M., McKee, A. C., Flint Beal, M., Graham, B. H., Wallace, D. C. (1994) Marked changes in mitochondrial DNA deletion levels in Alzheimer brains. Genomics 23,471-476[Medline]
  17. Cavelier, L., Jazin, E. D., Eriksson, I., Prince, J., Bave, U., Oreland, L., Gyllensten, U. (1995) Decreased cytochrome-c oxidase activity and lack of age-related accumulation of mitochondrial DNA deletions in the brains of schizophrenics. Genomics 29,217-224[Medline]
  18. Mecocci, P., MacGarvey, U., Flint Beal, M. (1994) Oxidative damage to mitochondrial DNA is increased in Alzheimer's disease. Ann. Neurol. 36,747-751[Medline]
  19. Lezza, A. M. S., Boffoli, D., Scacco, S., Cantatore, P., Gadaleta, M. N. (1994) Correlation between mitochondrial DNA 4977-bp deletion and respiratory chain enzyme activities in aging human skeletal muscles. Biochem. Biophys. Res. Commun. 205,772-779[Medline]
  20. Gadaleta, M. N., Lezza, A. M. S., and Cantatore, P. (1999) Mitochondrial DNA deletions. In Methods in Aging Research (Yu, B., ed) pp. 475–511, CRC Press, Boca Raton, Fla.
  21. Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., Young, I. G. (1981) Sequence and organization of the human mitochondrial genome. Nature (London) 290,457-465[Medline]
  22. Beckman, K. B., Ames, B. N. (1996) Detection and quantification of oxidative adducts of mitochondrial DNA. Methods Enzymol 264,442-453[Medline]
  23. Beckman, K. B., Ames, B. N. (1997) Oxidative decay of DNA. J. Biol. Chem. 272,19633-19636[Free Full Text]
  24. Kasai, H. (1997) Analysis of a form of oxidative DNA damage, 8-hydroxy-2'-deoxyguanosine, as a marker of cellular oxidative stress during carcinogenesis. Mutat. Res. 387,147-163[Medline]
  25. Cadet, J., Douki, T., Ravanat, J. L. (1997) Artifacts associated with the measurement of oxidized DNA bases. Environ. Health Perspect. 105,1034-1039[Medline]
  26. Helbock, H. J., Beckman, K. B., Shigenaga, M. K., Walter, P. B., Woodall, A. A., Yeo, H. C., Ames, B. N. (1998) DNA oxidation matters: the HPLC-electrochemical detection assay of 8-oxo-deoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. U. S. A. 95,288-293[Abstract/Free Full Text]
  27. Ozawa, T. (1994) Mitochondrial cardiomyopathy. Herz 19,105-118[Medline]
  28. Pinz, K. G., Shibutani, S., Bogenhagen, D. F. (1995) Action of mitochondrial DNA polymerase {gamma} at sites of base loss or oxidative damage. J. Biol. Chem. 270,9202-9206[Abstract/Free Full Text]
  29. Saccone, C. (in press) Structure, and evolution of metazoan mitochondrial genome. In Frontiers of Cellular Bioenergetics: Molecular Biology, Biochemistry, and Physiopathology (Papa, S., Guerrieri, F., and Tager, J., eds) Plenum Publishing Company Ltd, London
  30. Cantatore, P., Daddabbo, L., Fracasso, F., Gadaleta, M. N. (1995) Identification by in organello footprinting of protein contact sites and of single-stranded DNA sequences in the regulatory region of rat mitochondrial DNA. J. Biol. Chem. 270,25020-25027[Abstract/Free Full Text]
  31. Cahill, A., Wang, X., Hoek, J. B. (1997) Increased oxidative damage to mitochondrial DNA following chronic ethanol consumption. Biochem. Biophys. Res. Commun. 235,286-290[Medline]
  32. Hayakawa, M., Ogawa, T., Sugiyama, S., Tanaka, M., Ozawa, T. (1991) Massive conversion of guanosine to 8-hydroxy-guanosine in mouse liver mitochondrial DNA by administration of azidothymidine. Biochem. Biophys. Res. Commun. 176,87-93[Medline]
  33. Chen, X., Bonilla, E., Sciacco, M., Schon, E. A. (1995) Paucity of deleted mitochondrial DNAs in brain regions of Huntington's disease patients. Biochim. Biophys. Acta 1271,229-233[Medline]
  34. Smith, M. A., Sayre, L. M., Monnier, V. M., Perry, G. (1995) Radical aging in Alzheimer's disease. Trends Neurosci 18,172-176[Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
S. Maynard, S. H. Schurman, C. Harboe, N. C. de Souza-Pinto, and V. A. Bohr
Base excision repair of oxidative DNA damage and association with cancer and aging
Carcinogenesis, January 1, 2009; 30(1): 2 - 10.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
V. Pesce, A. Cormio, F. Fracasso, A. M. S. Lezza, P. Cantatore, and M. N. Gadaleta
Age-Related Changes of Mitochondrial DNA Content and Mitochondrial Genotypic and Phenotypic Alterations in Rat Hind-Limb Skeletal Muscles
J. Gerontol. A Biol. Sci. Med. Sci., June 1, 2005; 60(6): 715 - 723.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Yamagata, K. Muro, J. Usui, M. Hagiwara, H. Kai, Y. Arakawa, Y. Shimizu, C. Tomida, K. Hirayama, M. Kobayashi, et al.
Mitochondrial DNA Mutations in Focal Segmental Glomerulosclerosis Lesions
J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1816 - 1823.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LEZZA, A. M. S.
Right arrow Articles by GADALETA, M. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LEZZA, A. M. S.
Right arrow Articles by GADALETA, M. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS