| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Neuropathology,
Institute of Forensic Medicine and
Department of Psychiatry, Philipps-University, Marburg, Germany
1Correspondence: Department of Psychiatry, University Hospital, Rudolf-Bultmann Str. 8, D-35039 Marburg, Germany. E-mail: stumm{at}mailer.uni-marburg.de
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: drug abuse • neurotoxicity • bcl gene family
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Main clinical toxic features of amphetamines such as hyperthermia,
circulation, and hepatic failure correlate with pathomorphological
demonstration of acute myocyte and hepatocyte necrosis. Amphetamines
have also been associated with teratogenesis and increased fetal and
infant death rates related to maternal drug abuse comparable to the
effects of cocaine (2,
3)
.
In addition, `Ecstasy' and other amphetamine-derived drugs induce
hallucinations as well as long-term neuropsychiatric alterations such
as panic disorders, psychosis, and affective disorders (4
5
6)
. Very
recently, quantitative positron emission tomographic evidence (PET)
studies provided evidence of a decrease in brain 5-HT transporters in
human MDMA users, strongly suggesting toxic effects of `Ecstasy' in
human serotonergic neurons (7)
. Indeed, for several years experimental
data had demonstrated neurotoxicity to neurons of laboratory animals
and nonhuman primates (8
9
10
11)
. So far, reports of the neurotoxic
effects of amphetamines are focused to serotonergic and dopaminergic
neurons, which are located mainly in midbrain structures. However,
structural neuronal alterations have also been detected in the striatum
and prefrontal cortex of amphetamine-treated rats, indicating a more
general toxic process (12,
13)
. The underlying mechanisms of action in
amphetamine neurotoxicity are still unknown, although there is some
evidence for hydroxyl radical formation and for activation of apoptotic
pathways (14
15
16
17
18)
.
The present study aimed to determine whether amphetamines deleteriously affect cortical neurons and, if so, which cell death-associated pathways are involved in the neurotoxic process.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. In brief, pregnant Wistar rats were killed after
halothane narcosis by cervical dislocation and fetuses (E 18) were
removed after midline incision. Neocortical regions were microdissected
under sterile conditions and kept on ice in preparation medium
(Dulbecco's modified Eagle's medium (DMEM)/25 mM HEPES). After
mechanical dissociation of tissue, cells were centrifuged, resuspended
in MEM (minimal essential medium) supplemented with antibiotics
(antibiotic/antimycotic solution: 10,000 U penicillin, 10,000 µg
streptomycin, 25 µg amphotericin B/ml in saline), 1 mM pyruvate, and
10% heat-inactivated fetal calf serum. They were then plated at a
density of 1.75 x 105 cells/well in
poly-D-lysine-coated 24-well dishes. After 24 h, the medium was
replaced by a serum-free medium (START V). Cells were maintained at
37°C and 5% CO2 at a humidity of 95–100% and
used for experiments starting at day 11 of cultivation in
vitro. Cell culture media and supplements were purchased from
Seromed (Berlin, Germany), poly-D-lysine from Sigma (Deisenhofen,
Germany), and cell culture dishes from Nunc (Wiesbaden, Germany).
Treatment with amphetamines
Cortical neurons were treated with 125, 250, 500, 750, and 1000
µM of D-amphetamine (DA), methamphetamine (MA),
methylenedioxyamphetamine (MDA), and MDMA for 1, 24, and 96 h,
respectively. All amphetamines were supplied by Sigma (München,
Germany); stock solutions were prepared in phosphate-buffered saline
and further diluted in medium under sterile conditions.
Quantification of cell viability
Cellular morphology was photographically documented by phase
contrast microscopy after 1, 24, and 96 h of amphetamine
treatment. In addition, cell viability after 96 h of exposure to
amphetamines was quantified by a modified MTT
[3-(4,5-dimethyl-tetrazol-2-yl)-2,5-diphenyl-tetrazolium bromide]
assay (EZ4 U, Biozol GmbH, Eching, Germany). After 3.5 h of
incubation at the end of the treatment period, absorption was measured
at 490 nm in a microplate reader (Dynatech, Denkendorf, Germany). A 620
nm reference filter was used to correct for nonspecific background
values. Data of the MTT assay represent results of four independent
experiments. Differences between treatments were evaluated using
Kruskal-Wallis one-way analysis of variance on ranks.
Analysis of DNA fragmentation
Isolation of genomic DNA and agarose gel electrophoresis
Genomic DNA was extracted from cortical neurons treated with 500
µM each of DA and MA for 96 h, as follows. Cells were washed in
phosphate-buffered saline and rinsed in homogenization buffer
containing 10 mM TrisCl (pH 7), 10 mM EDTA, and 0.6% sodium dodecyl
sulfate. After 30 min of incubation with 10 µg/ml RNase A at 56°C,
NaCl was added to an end concentration of 1 M and the mixture was
incubated for an additional 2 h at 4°C. Protein precipitations
were removed by 20 min of centrifugation at 4°C and 20,000
g; the supernatant was extracted first with
phenol-chloroform-isoamyl alcohol (25:24:1) and then with
chloroform-isoamyl alcohol (24:1). Precipitation of DNA was performed
with absolute ethanol overnight at -20°C and centrifugation at
20,000 g for 20 min. After photometric quantification, 5
µg of each DNA sample were run on 1.6% agarose gel and visualized
with ethidium bromide staining.
In situ biotinylation of DNA strand breaks and immunodetection
DNA fragmentation was determined in situ after
96 h of treatment with 500 µM of amphetamines and in control
cells. For this purpose, we used the FragEL Klenow Kit from
Calbiochem-Novabiochem (Bad Soden, Germany) according to the
manufacturer's protocol. In brief, DNA strand breaks within the nuclei
were labeled by biotinylated dNTPs and Klenow polymerase, and detected
with a peroxidase-coupled secondary antibody. Visualization was
performed by 3'-diaminobenzidine tetrahydrochloride.
RNA extraction and detection of gene products by reverse
transcription-polymerase chain reaction (RT-PCR)
Total mRNA was extracted from cultured and untreated cells with
the RNeasy total RNA isolation kit (Quiagen, Hilden, Germany). cDNA
first-strand synthesis was performed, incubating 250 ng RNA of control
and treated cells for 90 min at 37°C in a 20 µl standard RT
reaction mix containing random hexamers (6.25
A260 units/ml), 1X RT reaction buffer, 10 mM DTT,
62.5 µM dNTPs, and 100 U MMLV reverse transcriptase (Life
Technologies, Eggenstein, Germany). First-strand cDNA (2.5 µl) was
used as template for subsequent PCR, applying primers (MWG, Ebersberg,
Germany) for
ß-actin: forward: 5'TGGAGAAGAGCTATGAGCTGCCTG3';
reverse: 5'GTGCCACCAGACAGCACTGTGTTG3';
bax: forward 5'CCAAGAAGCTGAGCGAGTGTCTC3';
reverse: 5'AGTTGCCATCAGCAAACATGTCA3';
bcl-2: forward: 5'CACAAT CTCCCCCAGTTCACC3';
reverse: 5'CACAATCCTCCCCCAGTTCACC3';
bcl-x: forward: 5'GGAGAGCGTTCAGTGATC3';
reverse: 5'CAATGGTGGCTGAAGAGA3';
p97: forward: 5'CGTCAAAGGAAGAACTGCT3';
reverse: 5'AGGGGGATGTCAACCT C3';
c-fos: forward: 5'GGTGAAGGCCTCCTCAGACT3';
reverse: 5'CTGGCCGTCTCCAGTGCCAA3'; and
c-jun: forward: 5'TGAAGTGACCGACTGTTCTATG;
reverse: 5'CCAT TGCTGGACTGGATG3'.
PCR mix contained 1x PCR reaction buffer, 1.5 mM
MgCl2, 20 µM dNTPs, 100 nM primer, and 0.5 U
Taq polymerase (Quiagen, Hilden, Germany). PCR products were
separated by electrophoresis in 5% nondenaturating polyacrylamide gels
and visualized by silver staining as described previously (20)
.
Semiquantitative analysis was assessed by using the NIH Image analysis
program on a Macintosh Power PC.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
|
This morphological effect of amphetamine treatment was underscored by
quantification of neurotoxicity by using the MTT cell viability test.
After an incubation period of 96 h, we observed dose-dependent
toxic effects for all four compounds compared with untreated cells
(Fig. 2
A–D). Using a mean dosage of 500 µM of amphetamines, we
found that all four amphetamine compounds induced a significant
decrease in cell viability compared with control (P<0.01 in
Kruskal-Wallis one-way analysis of variance on ranks). The
nonmethylated derivatives DA and MDA showed a significantly higher
neurotoxicity with 49.6% ± 16.8 (DA) and 43.3% ± 7.0 (MDA) cell
viability than the methylated amphetamine compounds MA and MDMA, with
neuronal survival rates of 74.8% ± 9.4 and 65.8% ± 11.4,
respectively (P<0.01 in Kruskal Wallis) (Fig. 3
).
|
|
DNA fragmentation
Genomic DNA extracted from untreated cortical neurons explanted
and grown in vitro for 14 days showed a high proportion of
high molecular weight DNA and only a distinct laddering of DNA due to
endonucleosomal cleavage in the agarose gel electrophoresis. However,
after 96 h treatment with 500 µM of DA and MA, the amount of
apoptotically cleaved DNA dramatically increased and the typical DNA
laddering phenomenon was present (Fig. 4
).
|
Using the FragEL DNA fragmentation assay, we observed only 3–5%
positive nuclei in the untreated control cells. However, after 96 h of 500 µM MA and DA treatment, prominent immunoreactivity and
nuclear fragmentation were present in approximately 40% (MA)-70% (DA)
of cells (Fig. 5
).
|
Alteration of gene expression
Analysis of gene expression was performed after treatment with 500
µM of amphetamines DA, MDA, MA, and MDMA for 1, 24, and 96 h,
respectively.
Using RT-PCR, we observed distinct differential expression patterns of
the bcl-xL (long) and
bcl-xS (short) isoforms during amphetamine
treatment (Fig. 6
A). Bcl-xL was down-regulated by all
four amphetamine compounds after 96 h of incubation. In contrast,
the bcl-xS isoform was induced by amphetamine
treatment. Induction was observed as soon as 1 h after treatment
with MA and MDMA and after incubation for 96 h with the
nonmethylated compounds DA and MDA. Although up-regulation of the
bcl-xS splice variant was delayed in DA and MDA
treatment, the intensity of induction after 96 h treatment was as
prominent as for MA and MDMA. No significant transcriptional regulation
was observed for bax and bcl-2 mRNA when compared with the expression
of the housekeeping gene ß-actin (Fig. 6B
).
|
The immediate early gene c-jun and the inhibitor of translation
initiation p97 were up-regulated by both DA and MDA. Whereas a 2.5-fold
induction of p97 mRNA was observed transiently after 1 h of drug
treatment (Fig. 7
B), c-jun showed a prolonged fourfold induction, with a peak
at 24 h of treatment (Fig. 7A
). The methylated
amphetamine analogs MA and MDMA did not significantly influence c-jun
or p97 transcription. No significant changes in c-fos mRNA levels were
observed in any of the experiments (data not shown). RT-PCR results
were confirmed by semiquantitative analysis using the NIH Image
analysis program (Fig. 6A
, Fig. 7A, B
).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Amphetamines are widely misused as psychostimulatory and hallucinatory
agents. The analogs MDA and MDMA as main compounds of the designer drug
`Ecstasy' became appallingly prominent as recreational drugs of abuse
during the last decade. Postmortem findings in accumulating human
deaths associated with `Ecstasy' intoxication resemble hepatocyte and
myocyte necrosis as well as brain perivascular hemorrhagic and hypoxic
changes (1)
. McCann and co-workers were able to demonstrate a decrease
in brain 5-HT transporters in abstinent human MDMA users by
quantitative PET studies (7)
. Their data strongly suggest that
`Ecstasy' leads to long-lasting toxic effects in human serotonin
neurons.
For a decade, animal experiments have provided evidence that
certain amphetamine analogs have the potential to directly damage
central monoaminergic neurons. It has been shown in nonhuman primates
and rodents that DA is toxic to dopaminergic neurons, MDMA to
serotonergic neurons, and MA to both (8,
9)
. This neurotoxic effect and
the amphetamine-induced behavioral syndrome are associated with a
massive and rapid depletion of serotonin and dopamine storages by
enhanced release and blocked reuptake of neurotransmitters (21)
. The
underlying mechanism for neuronal cell damage is still unknown, but
involvement of oxygen-based free radicals in the mediation of toxicity
has been suggested by several authors (16
17
18,
22,
23)
. The attenuation
of MA neurotoxicity in CuZn-superoxide dismutase transgenic mice and
pretreatment with ascorbic acid supported the hypothesis that
endogenous formation of 6-hydroxydopaminee and 5,7-dihydroxytryptamine
might be responsible for the toxic effects. In this context, activation
of apoptotic pathways by amphetamine intoxication has recently been
discussed. Cadet et al. (14,
24)
demonstrated that MA neurotoxicity in
rat neural cells is preventable by overexpression of antiapoptotic
bcl-2 protein and homozygous knockout of p53. Evidence for
amphetamine-induced apoptosis has also come from Simantov and Tauber
(15)
, who showed cell cycle arrest in G2M phase and DNA laddering in
the human placental serotonergic cell line JAR after 48 h of MDMA
and DA treatment.
Whereas earlier investigations have mainly been restricted to
serotonergic and dopaminergic neurons, the present study focused on
amphetamine neurotoxicity in rat cortical neurons. Induction of
endonucleosomal DNA cleavage demonstrated by DNA laddering in the gel
electrophoresis and in situ detection accompanies
significant loss of cell viability in the primary cortical cell
cultures. Furthermore, we were able to show differential expression of
the bcl-xL/S gene during amphetamine treatment.
The protective long-splice variant bcl-xL, was
down-regulated by amphetamines, whereas the contrary effect was
observed for the proapoptotic bcl-xS isoform,
which was up-regulated during the progress of neuronal cell damage. In
contrast, bax and bcl-2 expression were not affected by amphetamine
treatment. These data are in accordance with the observation of
Parasadanian et al. (25)
, who emphasized the role of
bcl-xL as an antiapoptotic regulator, especially
for mature central neurons. They demonstrate that overexpression of
bcl-xL in transgenic mice prevents apoptosis of
cortical and hippocampal neurons in a hypoxia–ischemia paradigm.
However, a complete lack of bcl-xL expression in
knockout mice leads to extensive apoptotic neuronal cell death and
lethality at embryonal day 13, underscoring the crucial role of
bcl-xL in the survival of postmitotic neurons
(26)
. Therefore, the drug-dependent regulation of the
bcl-xL/S variants observed during the progress of
amphetamine neurotoxicity might be an important step in the induction
of amphetamine-induced apoptosis of rat cortical neurons in
vitro.
Regulation of pro- and antiapoptotic genes is well characterized in the
hypoxia–ischemia paradigm and occurs simultaneously with changes in
the expression pattern of the immediate early genes (27,
28)
. However,
a direct functional connection between these gene families has not yet
been established. Expression of c-jun can be associated with both cell
proliferation and cell death, depending on cofactors such as c-fos
expression (29,
30)
. In ischemic neuronal cell damage, induction of
c-jun without coexpression of its AP-1 partner c-fos and inhibition of
protein synthesis initiation are the most predictive markers for
delayed neuronal death. In the present study we observed a prolonged
induction of c-jun transcription after 24–96 h of treatment with the
highly toxic DA and its ring substitute MDA. The methylated and less
toxic MA and MDMA analogs, however, did not significantly alter the
c-jun RNA level. A c-fos induction was not present after either of the
amphetamine treatments. These findings were underscored by the
differential induction of p97 after amphetamine treatment. p97 inhibits
initiation of protein biosynthesis as a competitive homologue of the
initiation factor E4F (31)
. Similar to c-jun, a transient up-regulation
of p97 after 1 h treatment is also induced only by DA and MDA, but
not by MA or MDMA.
In conclusion, our investigation demonstrates amphetamine-induced neurotoxicity in cortical neurons accompanied by apoptotic DNA fragmentation. Furthermore, we were able to associate amphetamine-induced differential regulation of the bcl-xL/S splice variants with neuronal cell death. Down-regulation of the protective bcl-xL and simultaneous induction of the proapoptotic bcl-xS variant accompany the neurotoxic effect. Expression of the immediate early transcription factor c-jun and the translation initiation inhibitor p97 are restricted to the nonmethylated DA and MDA analogs and thereby to high neurotoxic potential.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received for publication May 27, 1998.
Revision received January 25, 1999.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. P. Capela, A. Meisel, A. R. Abreu, P. S. Branco, L. M. Ferreira, A. M. Lobo, F. Remiao, M. L. Bastos, and F. Carvalho Neurotoxicity of Ecstasy Metabolites in Rat Cortical Neurons, and Influence of Hyperthermia J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 53 - 61. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jayanthi, X. Deng, B. Ladenheim, M. T. McCoy, A. Cluster, N.-s. Cai, and J. L. Cadet Calcineurin/NFAT-induced up-regulation of the Fas ligand/Fas death pathway is involved in methamphetamine-induced neuronal apoptosis PNAS, January 18, 2005; 102(3): 868 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. JAYANTHI, X. DENG, P.-A. H. NOAILLES, B. LADENHEIM, and J. L. CADET Methamphetamine induces neuronal apoptosis via cross-talks between endoplasmic reticulum and mitochondria-dependent death cascades FASEB J, February 1, 2004; 18(2): 238 - 251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. CADET, S. JAYANTHI, and X. DENG Speed kills: cellular and molecular bases of methamphetamine-induced nerve terminal degeneration and neuronal apoptosis FASEB J, October 1, 2003; 17(13): 1775 - 1788. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. THIRIET, B. LADENHEIM, M. T. McCOY, and J. L. CADET Analysis of Ecstasy (MDMA)-induced transcriptional responses in the rat cortex FASEB J, December 1, 2002; 16(14): 1887 - 1894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Deng, S. Jayanthi, B. Ladenheim, I. N. Krasnova, and J. L. Cadet Mice with Partial Deficiency of c-Jun Show Attenuation of Methamphetamine-Induced Neuronal Apoptosis Mol. Pharmacol., November 1, 2002; 62(5): 993 - 1000. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. N. KRASNOVA, M. T. MCCOY, B. LADENHEIM, and J. L. CADET cDNA array analysis of gene expression profiles in the striata of wild-type and Cu/Zn superoxide dismutase transgenic mice treated with neurotoxic doses of amphetamine FASEB J, September 1, 2002; 16(11): 1379 - 1388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. JAYANTHI, X. DENG, M. BORDELON, M. T. MCCOY, and J. L. CADET Methamphetamine causes differential regulation of pro-death and anti-death Bcl-2 genes in the mouse neocortex FASEB J, August 1, 2001; 15(10): 1745 - 1752. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, T. Hayashi, C.-F. Chang, Y.-H. Chiang, L.-I Tsao, T.-P. Su, C. Borlongan, and S.-Z. Lin Methamphetamine Potentiates Ischemia/Reperfusion Insults After Transient Middle Cerebral Artery Ligation Stroke, March 1, 2001; 32(3): 775 - 782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Deng, B. Ladenheim, L.-I Tsao, and J. L. Cadet Null Mutation of c-fos Causes Exacerbation of Methamphetamine-Induced Neurotoxicity J. Neurosci., November 15, 1999; 19(22): 10107 - 10115. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
